III.A.3: Improving dwarf mode sieges
# III.D.2: Allowing conflict over succession, schisms and contested claims to entity positions in world genAnd this is truly epic.
# III.D.3: Allowing such conflict in regular play
Wow i cant choice what is the coolest new thing yet, so many new thing that will improve dwarf fortress, lets hope that this version will come as soon as possibleWell, let's look back.
I.A: Appearance tags for the raws and associated data (beards, color, etc.)
I.A. Make caves and the underground more interesting
Wow i cant choice what is the coolest new thing yet, so many new thing that will improve dwarf fortress, lets hope that this version will come as soon as possibleWell, let's look back.
39a took 5 months to complete. Was it worth the wait? I think yes.
I suspect, with all the pre-reqs he has to implement, this one will probably take longer.
Language Improvements
* I: Basic rewrite of names to support syntax trees and different, larger phrases
* II: Grammars for each language for different realizations of stored abstract phrases
Wound Handling
* I: Track wounds individually and do scarring (and thereby remove phantom limb pain and unconsciousness)
* II: Wound infection and some other diseases
Wow i cant choice what is the coolest new thing yet, so many new thing that will improve dwarf fortress, lets hope that this version will come as soon as possible
Language Improvements
* I: Basic rewrite of names to support syntax trees and different, larger phrases
* II: Grammars for each language for different realizations of stored abstract phrases
I: Getting migrants/armies to move over the world map again
I: Ways to obtain food while traveling (hunt/gather)
I: Store resource counts at sites, controlled by map properties and world gen professions
I: Track wounds individually and do scarring (and thereby remove phantom limb pain and unconsciousness)
I: Creation of the adventurer's group as an entity (as with civ/religion/etc.)
I.C: Eggs and feathers, associated skills and objects
I: Basic rewrite of names to support syntax trees and different, larger phrases
# I.C: Graveyards and other burial arrangements with associated fun stuff
# I: Creation of the adventurer's group as an entity (as with civ/religion/etc.)
"I.B: Remove good/evil regions and add more specific associations instead"
I want to know what this one entails.
Yay! Does this includes water?I think you can already get water in Adventure Mode with a waterskin. So, No. ;D
I think you can already get water in Adventure Mode with a waterskin. So, No. ;D
But how? Can I refill my waterskin? I have never managed to do that before.
The plans truly are amazing. There's not one thing I'm not waiting for, but my most anticipated parts are the premilinary Caravan Arc parts, ruler succession (and births) in regular game and the randomized creatures, plants and megabeasts. Oh, and also the adventurer home/hovel.
The others of the few games are also roguelikes. In ADOM, you can chop down a tree and use the log as a weapon.Somebody's bound to ask what that is.
Zompist has the most detailed description in how to create a realistic language I've ever seen. He makes Tolkien look like 2 year old with a crayon.
Zompist has the most detailed description in how to create a realistic language I've ever seen. He makes Tolkien look like 2 year old with a crayon.
While the link provided was interesting, that's a dumb thing to say. As an example, someone might be able to translate the DF elven vocabulatory to more or less match this (http://hem.passagen.se/benninge/quenya-english.html). Many common words could be given quenyan meanings, and less common words such as bunion, wallow, parity and broil could be constructed following the word-building rules Tolkien made up. They wouldn't actually be quenyan, but they could sound like it.
As far as I know, this is discussion about the new dev_next page, not about DF development in general.
If not, rename the title future of the fortress 5 please.
And then wrestling could use a hierarchical selection UI, probably pretty easy (select left hand, then select third head, rather than having to scroll through *everything*; as it is I barely ever bother gouging out anything's eyes, and I never break limbs).
It would be so funny if you were tunnelling and...
"Horror! Your miners have struck a Dragon Nursery!"
and then
"Oh no! The Eggs are Hatching!"
and then
"Your civilisation has crumbled to its end."
Hmmm, is this FotF 5? Seems like it's getting shorter every time. ::)
Anywho. Toady, what future development, of all of them, are you most excited about implementing? :P
Also linked to on the above reference, this guy's page (http://www.xibalba.demon.co.uk/jbr/index.html) has lots of exhaustive information on making languages listed in the right column. Fascinating reading even if you're note into linguistics, with four different examples of language making, each quite enlightening.OMG
Hmmm, is this FotF 5? Seems like it's getting shorter every time. ::)
Anywho. Toady, what future development, of all of them, are you most excited about implementing? :P
I'm not good with favorites or best-ofs and stuff. I think it'll all be pretty cool.
So on FotF threads (not sure if this one or the other one would be the best place to ask, but this has the best name for it), what do people want out of those now anyway? There are often questions mixed with meandering degeneracy, and I'm not sure how to set that up. If I sticky one, I'd like it to be one I've made myself, so that I can change the OP if necessary, but I dunno what the OP should be, really, or what people want out of it.
Eh Toads, if you are looking to buy a cheap computer, you could try the monthly/bi-monthly UW surplus property sale on August 5th.
http://www.washington.edu/admin/surplus/ (http://www.washington.edu/admin/surplus/)
I doubt that you could get a wicked gaming rig there, but you might be able to get a servicable backup machine for under $200 that could probably run DF reasonably well, perhaps with upgraded RAM.
Then again, with your recent influx of wealth ( :) ) I guess that you might be looking for something nicer than a generic computer lab box.
I doubt that Toady needs a decent gaming rig. I just cant imagine as Toady is playing with Crysis! ;D
FotF is usually great for two things. Discussing the cool new dev_nows, as well as being able to clarify points you've blogged about. I feel just focusing on those two points, and limiting conversation to it, would be nifty. Maybe make FotF one of the few threads we actually moderate for off topicness, to keep it nice and clean, and full of information.
I doubt that Toady needs a decent gaming rig. I just cant imagine as Toady is playing with Crysis! ;D
I can't see me playing Crysis ever:
"OMG! Look at these graphics! Wait, why is the water rippling in a non realistic way? And why do the prom fronds look like they're made out of cut steel? Holy **** I can see the PORES on that dude's face....wait. WHY WOULD I WANT TO?!?" D:
The added pores to the faces, but didn't bother giving the eyeball all that much texture space, so it doesn't look like it can orbit in its socket (it looks taped on, basically). Man that game tweaks my nerves.
The one I did yesterday was for world gen refugee groups. Most of the movement code was in place from back when the game had nomads, but now it'll create those groups and associated entities from the refugees, instead of stuffing them into vaguely correct sites and causing civil wars on occasion.
Oh, does this mean that you're one step closer to making nomadic civs?
AFAIK, they will travel to some site (even reclaim ruins) and settle there.
Speak of FotF, anyone else thinking about this?
I.C: Graveyards and other burial arrangements with associated fun stuff
The return of skeletal pikemen... and more?
Maybe funeral processions? Actual graves?
Speak of FotF, anyone else thinking about this?
I.C: Graveyards and other burial arrangements with associated fun stuff
The return of skeletal pikemen... and more?
Maybe funeral processions? Actual graves?
Keep in mind, also, that Toady was talking about making the sites where battles took place important as well. Imagine visiting an ancient battle site and having all the dead warriors rise up to fight a battle which happened centuries ago.This needs to happen. (http://www.impawards.com/1993/posters/army_of_darkness.jpg)
I'm pleased with the current version, and though it is shortsighted, pigheaded, and selfish of me, I'd still like to see some performance optimizations go in. I understand the early state of the game. I understand there is major work to be done. I understand that such things are on the backburner.Ok, now that you've got your wish (getting 200fps with a river and a magma pipe in a 6x7 multi-cliff fort at the start, prior version was ~30 same type layout) perhaps we need to be able to throttle framerate in-game. Why? because after the first season, 200fps is great, but the first week, you almost want to have it pause every time a task completes, and at 200 fps even a brand new miner chews thru stone like butter and the days fly by in an instant.
However I, more then anything, want to run a massive fortress of 400 dwarves fighting a horde of 4000 goblins. I just want to see that before I die, really.
perhaps we need to be able to throttle framerate in-game.You know there's a limit max fps option in the init.
the first pass on underground changes
I know the Army Arc was expected, but this:I like the look on Urist Minerdwarf's face. It's like he's saying.Quotethe first pass on underground changes
This is awesome. I can't wait for this one, for obvious reasons:
Urist Minerdwarf has discovered an underground cave!
Id Fisherdwarf cancels fish: interrupted by Subterranean Shark Bat!
So, uh, what does this entails?
II: Improving military organization/command structure
How does Toady plans to improve it? I'm very curious about it.
So, uh, what does this entails?
II: Improving military organization/command structure
How does Toady plans to improve it? I'm very curious about it.
Probably it will be easier to create/manage squads. Also maybe we will have regiments or something like that. [IE control more squads as one].
..as an addition..
What I would like to see -somewhat related to this- is:
http://www.bay12games.com/forum/index.php?topic=23784.0
000001 ? [adventure mode][combat] cannot block fireballs in any way right now
000002 ? [adventure mode][display] allow adjustment of speed of adv mode flying objects -- projectiles too fast
000003 ? [adventure mode][display] memory stairways occasionally obscured by the flashing stuff
000004 ? [adventure mode][inventory] some mechanism for swapping grasps, getting a weapon to the favored hand specifically
stopped fell moods from occurring if the fortress race does not drop a corpse
... I assume this is due to a mod that allows corpse-less playable race in fortress mode. Hm... fastest way to destroy a fortress, a single fell dwarf going around grabbing everyone and killing everyone.Quotestopped fell moods from occurring if the fortress race does not drop a corpse
Seriously... It's a pretty in-depth game that needs that particular fix... :)
Quotestopped fell moods from occurring if the fortress race does not drop a corpse
Seriously... It's a pretty in-depth game that needs that particular fix... :)
got rid of world gen crash during succession after death of prolific long-standing position holders with inbred descendants
AFAIK, MT is something of a taboo here. Not because Toady despise it, but because rewriting DF to use MT would take far too much time and we would gain very little from it for the effort taken (If you don't have a dual-core or quad-core the game might even run slower on your current PC and take much more memory with MT). Most of us wouldn't even notice the difference between ST and MT DF. And the potential amount of MT bugs that it could bring (which, by experience, I can tell you are way harder to get rid of) would be catastrophic for the game.
OK, I'm an addict. I admit it. Toady skipped a few days lately. I need my daily dose of The Future of the Fortress, or I'm getting restless.
Common, Toady, please have mercy... you musn't skip days like this. Do you know how exciting is it to read about your latest accoplishments? Can you imagine the torments we have to endure if we have to wait one more day? :'(
;)
Anything that can make it out into the raws is fair game for randomization.
So will it matter eventually if I start with 7 dwarves from The Red Dagger instead of The East Lash or The Room of Treasure or whatever the dwarven civs are in that world? In ways other than what stones and meats they can give you, I mean. That'd be neat, so long as there's a way to tell what the differences are before embarking.
I think you'll need scripting language for the magic system, so pick a good one! As far as randomizing societies, I think the number of mods people will make would be more fun than random societies. At least keep the randomized societies optional.
The later magic is implemented, the happier I'll be. Not that I'm ideologically against magic (it would be cool to have a really subtle and not "magic fireball in your face" system, but that's another discussion). I imagine this is an issue that will really divide the community.I think you'll need scripting language for the magic system, so pick a good one! As far as randomizing societies, I think the number of mods people will make would be more fun than random societies. At least keep the randomized societies optional.
Keep in mind that magic won't be implemented for quite a long time. So we have lot of time to discuss about it, so keep posting suggestions that what would you like to see regarding magic / magic system.
The later magic is implemented, the happier I'll be. Not that I'm ideologically against magic (it would be cool to have a really subtle and not "magic fireball in your face" system, but that's another discussion). I imagine this is an issue that will really divide the community.I think you'll need scripting language for the magic system, so pick a good one! As far as randomizing societies, I think the number of mods people will make would be more fun than random societies. At least keep the randomized societies optional.
Keep in mind that magic won't be implemented for quite a long time. So we have lot of time to discuss about it, so keep posting suggestions that what would you like to see regarding magic / magic system.
All that will also affect what resources your civilization has available. For example, a conquest might give your civilization access to a new source of iron or to a trade route with a distant civilization, affecting the prices of the goods you buy from (or sell to) the caravans. If an enemy civilization razes one of your civilization's settlements and kills a bunch of skilled weaponsmiths, the quality of any further weapons you import might be noticeably reduced - and the refugees fleeing from the destruction will look for a new home and might end up at your own fortress.
I'll also be lifting ethics up into an entity instance rather than entity raw definition set of variables, so that they can vary between civs and change during play.
Wow, the Recent Developments update for today is awesome. Specially this bit:QuoteI'll also be lifting ethics up into an entity instance rather than entity raw definition set of variables, so that they can vary between civs and change during play.
;D ;D ;D
We got an update on a Saturday?! What happened to that mysterious weekend/end of month project?
This is The Collective of Workers. It is a socialist society. It is at war with The United Counties, a Constitutional Republic. The Collective Workers is at peace with The High Council, a Monarchy.
Something like that? All human civs too. This would really make all the different races less like their own civilizations. So instead of Elves vs. Dwarves, it would be a few dwarves and a few elves under a monarchy versus a bunch of dwarves, some humans, and a hell lot of kobolds under a Republic.
That would be awesome.
Since 2006, when I started reading dev_logs, there wasn't a month so uneventful like this one, though we could guess Toady was making a lot of work that just wasn't interesting enough for a dev_log.
But he is too silent lately! Six days without a post? Did we scared Toady away of his own forum? >:(
We miss you Toady!
Yes I am pretty sure that it will divide the community [in fact its dividing the community even now, if you take a look at the suggestions regarding magic], however the problem can be easily solved in the future. As we all know, DF is and will be mod friendly, so there is one way to make everyone happy. We will need to have a magic system, traiditional or alternative, so the players who would like to see magic in DF will be happy. Those players who dont want to see any magic in the game will have the possibility to remove it from the game with editing the RAW files. I think that this is the best way at least.
"I.B: Remove good/evil regions and add more specific associations instead"
I want to know what this one entails.
It probably (and I hope so) means that previously generic good/evil regions will be tied now to powers and deities directly instead, and fantastic creatures will also spawn on them depending on their association with said powers and deities.
"I.B: Remove good/evil regions and add more specific associations instead"
I want to know what this one entails.
It probably (and I hope so) means that previously generic good/evil regions will be tied now to powers and deities directly instead, and fantastic creatures will also spawn on them depending on their association with said powers and deities.
Agreed. For example, we might get more flavors of "Evil" - Zombie/Skeletal evil, Tear-Your-Face-Off evil, Teeming With Demons evil, etc...
Yes I am pretty sure that it will divide the community [in fact its dividing the community even now, if you take a look at the suggestions regarding magic], however the problem can be easily solved in the future. As we all know, DF is and will be mod friendly, so there is one way to make everyone happy. We will need to have a magic system, traiditional or alternative, so the players who would like to see magic in DF will be happy. Those players who dont want to see any magic in the game will have the possibility to remove it from the game with editing the RAW files. I think that this is the best way at least.
Same way for tech - and that way it works out both ways!
Y'know, it'd be interesting to see how dwarves would handle it if you used Magic and Tech together... :D
It's the 24th now, has Toady started on his end-of-month break?
Question: Once DF hits 1.0, will Toady release the source code? Because I had a crazy awesome idea for a game. It's just pie-in-the-sky daydreaming, but it would rule, and it'd probably be easiest with the DF source.
I never forget anything.
Absolutely epic dev_now update today.
(and some new parts like teeth, claws/nails, lips, ribs, hair, etc.)
First thing to do in new version: Punch out an elf's teeth, and then start pulling his hair.
That's a 404, Tormy.
Sweet looking stuff up there today with the rewrite of some of the creature bodies and damage code. I was wondering, Toady, if you would be able to address the "MIRV Crossbow Bolts" oddity that crops up on particular crits. You know, when a bolt seems to go in an eye, break a neck, purée a lung and come out the left knee.It's not that crazy, it's just the way damage is dealt that needs to be changed somehow. A bolt can hit anything in a given larger bodypart, for instance heart liver and both lungs if the bolt hits the upper body. It's fun, but probably wouldn't be missed.
It's hilarious, but it contributes to some of the range/melee balance issues, because there's always a chance that every arrow will annihilate five major organs and snap off a toe. I was wondering if the new body/tissue layouts would have an effect on crits and organ damage?
As a result of tissue layering, the 15 HP per BP system is being more or less dropped to make way for individual wound tracking. Unless you look at the specific descriptions, you'll still have wounded BP lists and so on displayed in pretty much the same way, though. Aside from having more accurate combat text (though I'm not sure if that's coming with this push) and the scars/improved healing/pain management that come from wound tracking, it also means that smaller creatures will be able to cause very slight wounds to large creatures in many cases where they'd do nothing before. A 1 out of 15 guaranteed BP HP drop is too large in many cases (thus the current no-damage chances), but adding a scratch to the skin tissue doesn't have to count for so much. So even if you aren't really hurting the titan, at least you can make little marks on it and bother it or something.
As soon as you realize where the tags are and what they do it's a short, bloody trip from Dwarf Fortress: Slaves to Armok to Dwarf Scientist: That which Armok did not intend
I want to tear out someone's rib and stab them in the hair with it.
I want to tear out someone's rib and stab them in the hair with it.
Or do it the other way around.
HOLY FUCKING SHIT FORMATIONS + SPARRING FIXES FUCK YEAR
FUCK YES SPARRERS NOT BECOMING VEGETATIVE MAYBE.
What forum was that?
I have mentally blocked my finger from ever clicking on a link to that place.
The latest dev_now update is making me all giddy.
I was wondering, Toady, if you would be able to address the "MIRV Crossbow Bolts" oddity that crops up on particular crits. You know, when a bolt seems to go in an eye, break a neck, purée a lung and come out the left knee.
I was wondering if the new body/tissue layouts would have an effect on crits and organ damage?
Regarding scratches, will multiple scratches in the same area slowly open up wounds or start to cause pain? I'm envisioning a giant being swarmed by rats or piranhas or something here, and it would make some of the lamer cave monsters more interesting if you saw one and suddenly had to worry if there were enough around to swarm you.
Is weapon equipping receiving any attention? Specifically, the inability to use pikes, whips, bows, and blowguns in fortress mode. In know it's called "Dwarf Fortress", but beyond the hilarity of a dwarf using a blowgun, I know I'm not the only person to try playing "Human Town" and "Kobold Cave".
Likewise, do you think the 'two weapons' system needs any changes?
And just because it's related, is a creature Mounting system anywhere on the horizon? Dang humans get the breaks.
And just because it's related, is a creature Mounting system anywhere on the horizon? Dang humans get the breaks.
I'm not sure... I'd put it in adv mode first, and at that point there'd be an opportunity to do it for dwarf mode, but... well, it's not in my set of easy visualizations for them.
Is weapon equipping receiving any attention? Specifically, the inability to use pikes, whips, bows, and blowguns in fortress mode. In know it's called "Dwarf Fortress", but beyond the hilarity of a dwarf using a blowgun, I know I'm not the only person to try playing "Human Town" and "Kobold Cave".
At the very least, the choices will be based on the entity defs, so if you play a human town, you'll get the human lists. I didn't have any plans at this time for exotic weapon use -- certainly it makes sense that a dwarf, when pressed, would use whatever is around, but culturally it would be odd to have a unit based around it. At the same time, if that's all you've got in significant numbers, you should be able to do it, maybe with some backlash among those dwarves with the "values tradition" personality facet, especially if you have proper weapons available.
And just because it's related, is a creature Mounting system anywhere on the horizon? Dang humans get the breaks.
I'm not sure... I'd put it in adv mode first, and at that point there'd be an opportunity to do it for dwarf mode, but... well, it's not in my set of easy visualizations for them.
Yeah, there will be cumulative effects, so that you can have an actual effect. Even something like a swarm of vicious biting insects causing real trouble for your adventurer in a marsh or something should be possible through the system. Again, it'll be a matter of feel here, with some missteps likely, hopefully with amusing results.
At the same time, if that's all you've got in significant numbers, you should be able to do it, maybe with some backlash among those dwarves with the "values tradition" personality facet, especially if you have proper weapons available.
Choosing quality weapons. I have tens of high quality steel axes lying in my storage while the champions run around with normal iron axes.
Yeah, and of course there's the opposite, which is using sparring weapons instead of *Adamantine Short Sword*s.
Great to hear you've thought about it. I was specifically referring to the how the military weapon menu doesn't have options to order units to carry anything but dwarf weapons. I guess that'll be irrelevant, since I assume the entire military menu system is being rebuilt?
I've got some pitchable ideas. For Fortress Mode, the Animal menu could mark animals for Available For Mount in the same way as pets (probably after they've received mount training at a kennel), and the squad or equipment menu could order a unit to Use Mount. Then they just run off to grab a creature, and from then on they're linked as mounts (and I guess infants?) already do. It's imprecise and a little clunky, but as functional as it needs to be.
1. A rider performs most actions based on their on speed, but moves across tiles at the mount's speed.
2. Mounts can be enraged or spooked by training and nearby combat, fighting or running depending on raw tags (probably existing ones).
3. Attacks made on the rider have a chance to hit the mount, based on size. (This of course raises questions of barding armor, which I couldn't imagine how to approach.)
I like to play with a set of Gate Guards - at the moment these are assigned individual positions (which are alcoves in the entrance passages) because I like the idea of bearskin-and-redcoared sentries standing to attention (for game months on end LOL). At the moment, to achieve this, every alcove needs a pair of one-dwarf squads assigned to it (a Spring/Autumn and a Winter/Summer shift).
It would be nice if the new system went someway to making this easier (perhaps the 'formations' mentioned could mean that a particular squad has multiple position points assigned to it, and fills them as best as it can) but my main worry is that this behaviour won't be b0rkened, since not only is it aesthetically pleasing, it's also very handy as an anti-thief/snatcher technique (I'm not a big fan of traps ATM).
I wonder which domestic animals spook. Just animals that are used to be preyed upon and used to being able to run away from it? Does the herd aspect matter at all? I usually hear it in terms of cattle stampedes.
Yeah, one of our initial concerns with going to a system with commanders and their soldiers was that people that are used to using the military system with individual squads (ie a lot of people, because figure out the 'm'ilitary screen is annoying, so people just activate dwarves). You'll be able to give dwarves individual assignments and positions even within a squad. The larger squad structure will be more for sieges or larger military matters, as well as for a notion of command and organization and responsibility. Hopefully most everything that people used to do will still be possible and in fact easier under the new system.Ooh, sounds lovely!
Yeah, we're going to go after getting dwarves to have the weapons and armor you want when you want them to have them. This was originally going to involve assigning squads to groups of weapon racks/armor stands, possibly including training weapons, and other settings, but I haven't settled on anything. It's still stewing a bit, and is on the list of problems that will be less major problems on the release.
Of course, war horses can have that trained out of them, but it takes a LOT of effort. Which is why they were so expensive, and only knights and nobility could afford to have them
"Staircases should probably not be traversable"
sorry for the late post, but this is the DF picture I think tormy was trying to link to (it's 404 on 4chan now). 100% Safe-For-Work:Spoiler (click to show/hide)
In fact, of anything of whats been mentioned is going to be fairly awesome. I don't think anythings been added to DF that I sit there and think "urgh... why?" every new feature is as exciting as the last
The big one for me will be adventurer mode getting the skills from fortress mode. And the whole being able to build your own house and have it stored as a site. Making an adventurer whose hand carved his house in a forest and forged his own sword with ore he got from HFS, good times :D
Yeah, adventurer mode will be much more interesting
You know, I wouldn't mind if it added a week or two to the release date, poisons and diseases would be quite epic. :)
like an ascii Fable I've always imagined it to be
lol dwarven witch doctors
So, does does this mean we will be able to flood our chasms with magma again?
theres a point, is there jellyfish in DF atm? I'm voting here for adding jellyfish with stings in the next version
I want to create an adventurer who goes around capturing different jellyfish and stacking them in his house
Kaptur is a Polish word for hood :P Maybe that's why?an adventurer who goes around capturing different jellyfishFor some strange reason I got the impression you meant he was going to wear a Jellyfish on his head.
I am Urist! Lord of the Jellyfish!
Coming up with the Number, I was going through the skill code and it seems I'll have to find preliminary answers to some deep questions, like "do the undead have souls?", since I added "souls" to units to store information when I was putting in the mental attribute framework. I suppose the answer should be "it depends"...
What I notice happens is Toady starts off strong then slows to a crawl... Then suddenly goes lightspeed. Then slows to a crawl for a very short period of time.
Hopefully Toady has discovered the latest trend of businesses offering grocery delivery, cutting out about 2 hours every 3rd day or so for getting groceries. I've found that this service is one of the keys to never having to leave the house.
JoRo: milk is a controversial subject. I've encountered opinions that in most cases, an adult human lacks the ability to digest unprocessed milk.
I can imagine the latest in noble torture now: lock the hapless noble in a jail cell right next to a talentless dwarf playing the trombone.Why not several talentless dwarves playing bagpipes?
Urist Bagpiper cancels Eat: Urist Copycat is doing his song no justice
Toady, did you know that regular exercising and a good deal of fresh air greatly improve the efficiency of the mind? That's because it increases the amount of oxygen the brain receives.
EMPATHY - being able to feel other peoples' stuff.
Who else wants dwarves feeling their stuff?
EMPATHY - being able to feel other peoples' stuff.
Who else wants dwarves feeling their stuff?
Correct description: "Empathy is the capacity to recognize or understand another's state of mind or emotion." Definitely a must have in the game. :)
Well Empathy is probably going to improve a Mayor's ability to take in complaints.
Well Empathy is probably going to improve a Mayor's ability to take in complaints.
...and don't forget! Empathy will be also very important, once Dwarf Poker! will be implemented! ;D
[Sorry I couldn't miss it, since I am a poker player 8)]
Toady, I don't think that musical ability should be an attribute. It should be a skill tied to the creativity attribute.
I'm curious about the four unarmed skills. Dodging was mentioned, and I expect one is related to things like locking joints and throwing enemies... or perhaps those are separate?
I wonder if this means somewhere down the line though, that we can get a raw file full of unarmed attacks, and the skill levels/body parts required, before people start to do execute them.Yes, if unarmed moves require a certain skill level, then we won't need to worry about getting Chuck Norris'd by children. I like that.
Musicality is an intrinsic understanding of those sorts of things. There will be several skills when the time comes (particular instruments, categories of instruments, singing, rhythm [which could also come up with dancing], etc.). Enough of what I read suggested that it deserved its own spot, but of course there are going to be issues. I'd personally be all for splitting up analytical ability into a few more, as the current setup doesn't account for all the mathematicians I've met, but any system is going to have splits and joins that don't cover everything or cover too much.
Toady: I understand what you mean about musicality. It makes more sense to me now, I think.
Speaking of unarmed combat, here's what I'm wondering: If wrestlers end up using multiple offensive skills and other military units continue to use only one, will that result in problems/balance issues with skills? I guess it depends on what those skills are and how they're used.
Musicality is an intrinsic understanding of those sorts of things. There will be several skills when the time comes (particular instruments, categories of instruments, singing, rhythm [which could also come up with dancing], etc.). Enough of what I read suggested that it deserved its own spot, but of course there are going to be issues. I'd personally be all for splitting up analytical ability into a few more, as the current setup doesn't account for all the mathematicians I've met, but any system is going to have splits and joins that don't cover everything or cover too much.
Out of curiosity, will we be able to hook up percussion cams to a waterflow, that we can create programmable hydropowered instruments (Similar to in the Book of Ingenious Devices?)
There is so much I want to ask about Toady and his plans for Martial arts, or lack thereof, but I am under the impression that it is either a secret or he is never really planning on developing it into that dramatic of a system.
Wait, what? Is magic in the combat arc? Is there a typo somewhere?
Well, worlds can have magic in all sorts of different ways, and my main thing there is going to be world gen parameters. The ability for martial arts to have a magical component is certainly not unheard of, and so would often occur, but I don't really plan on having a stock notion in the raws of magic (aside from current and future abilities for certain creatures, which we've already got and will likely continue on in that way).
Martial arts are the sort of things I'd randomize each time (as with magical arts) in my own worlds and the vanilla game, but I'd be open to allow raws for them as I'm sure people have their favorites and stuff they'd like in their modded worlds.
Here's a question:
Because of the sheer amount of redesigning and content, will there be new additions to the Dwarf Fortress vocabulary to cope with it? Take for example say... potential RNG martial arts styles or creative art pieces. Certainly the current vocabulary isn't large enough without being overly repetitive if more and more things need to make more use of it.
Martial arts are the sort of things I'd randomize each time (as with magical arts) in my own worlds and the vanilla game, but I'd be open to allow raws for them as I'm sure people have their favorites and stuff they'd like in their modded worlds.
Speed is sort of a weird thing that won't be established until I get to the body part of the countdown. Right now it'll depend on strength + agility, but really it should also depend on physical dimensions as well. That can kind of be implied by strength + agility, but to get good description paragraphs based on appearance, the atts + one size variable aren't sufficient. In a way this is a start of the custom attributes, as they'd depend on the creatures. For creatures without extra appearance attributes (I won't have spend time coming up with them for sharks and so on, most likely, not for a long while anyway), speed will probably depend on strength and agility equally.
Tormy... SIZE=physical dimensions.
I live right next to a grocery store... I'm taking vitamin D supplements now, since I hardly ever go outside, he he he.
Toady: I understand what you mean about musicality. It makes more sense to me now, I think.
Speaking of unarmed combat, here's what I'm wondering: If wrestlers end up using multiple offensive skills and other military units continue to use only one, will that result in problems/balance issues with skills? I guess it depends on what those skills are and how they're used.
Eh? Why should unarmed combat be "balanced" against weapon skills.
Toady: I understand what you mean about musicality. It makes more sense to me now, I think.
Speaking of unarmed combat, here's what I'm wondering: If wrestlers end up using multiple offensive skills and other military units continue to use only one, will that result in problems/balance issues with skills? I guess it depends on what those skills are and how they're used.
Eh? Why should unarmed combat be "balanced" against weapon skills.
Nice long post you have there, but that wasn't the point I was trying to make at all. My apologies.
What I meant was: In current game terms, working on three skills at a time instead of one will result in more skill increases overall and therefore things like better attribute bonuses, or perhaps slower than normal skill growth if you have to work at 3 at once instead of focusing on one. I wasn't referring to the actual effectiveness of the skill itself being "balanced".
Toady: I understand what you mean about musicality. It makes more sense to me now, I think.
Speaking of unarmed combat, here's what I'm wondering: If wrestlers end up using multiple offensive skills and other military units continue to use only one, will that result in problems/balance issues with skills? I guess it depends on what those skills are and how they're used.
Er, sorry for the lecture. :)
Eh? Why should unarmed combat be "balanced" against weapon skills.
Nice long post you have there, but that wasn't the point I was trying to make at all. My apologies.
What I meant was: In current game terms, working on three skills at a time instead of one will result in more skill increases overall and therefore things like better attribute bonuses, or perhaps slower than normal skill growth if you have to work at 3 at once instead of focusing on one. I wasn't referring to the actual effectiveness of the skill itself being "balanced".
I am pretty sure that the weapon skill will be broken up also
Some ideas:
- chance to block incoming attacks with a given weapon type
- "special" attack manoeuvres [combos? = damage boost] with a given weapon type
- chance to disarm the weapons with a given weapon time
Each of stones, metals, plants, trees and creatures now has material lists which can be placed in the raws which cover pretty much everything that was sort of haphazardly defined before (there isn't currently a point to having a list within a stone or metal rather than just having one though).
Personally I am thrown off by Toady's willingness to answer questions so It is always a pleasant surprise even though he does it consistantly.
I am used to a game being mostly a secret until it comes out. So 50% "I won't tell" and the number increases with Freeware.
The release of DF version 1.0..... I think we'll all be old geezers at that point. This is, of course, a good thing.
Mister, you've messed up something in your post ^ ... :P
The release of DF version 1.0..... I think we'll all be old geezers at that point. This is, of course, a good thing.
I don't know if Id still be interested in Dwarf Fortress by the time version 1 comes out... By then they may have helmets that create videogames for you just by thinking of them.
Lawnmower Man is another movie which is similar, it was made around the time in the 90's that people were going gaga over virtual reality games.
I saw an article about these people who made a game which basically took shadow boxing to the next level.. the players' shadows were projected onto a screen, and a camera recorded their movements and mirrored them in the game.. it's probably for sure that in 50 years there will be some pretty sophisticated virtual reality game systems, especially considering the new 360 degree video thing that they can do these days in movies.
Lawnmower Man is another movie which is similar, it was made around the time in the 90's that people were going gaga over virtual reality games.
I saw an article about these people who made a game which basically took shadow boxing to the next level.. the players' shadows were projected onto a screen, and a camera recorded their movements and mirrored them in the game.. it's probably for sure that in 50 years there will be some pretty sophisticated virtual reality game systems, especially considering the new 360 degree video thing that they can do these days in movies.
Yeah. Maybe not even in 50 years, but sooner. I would say it would be possible to have something like that in ~30 years even.
Just think about that what did we have like 30 years ago? Hell, even the C-64 is only ~25 years old... :D
In the Beginning, there was Pong. But that was boring, so people didn't waste much time on it.
Then was the Computer's wrath kindled against man. And it swore in its wrath to better pong. And behold, the Computer said, "Let there be blobs." And there were blobs. And the Computer saw the blobs, and it saw that they bounced randomly on the screen. And the Computer was entranced for hours on end.
Then came forth the Programmer. And he saw the blobs, and saw that they were most Heinous. And he said unto the Computer, "Hey, let me blow up the blobs." And the computer was awakened from its stupor.
And the computer said, "Let there be a triangle." And there was a triangle. And the programmer did smite the blobs with the triangle. And thus was created Asteroids.
Lawnmower Man is another movie which is similar, it was made around the time in the 90's that people were going gaga over virtual reality games.
I saw an article about these people who made a game which basically took shadow boxing to the next level.. the players' shadows were projected onto a screen, and a camera recorded their movements and mirrored them in the game.. it's probably for sure that in 50 years there will be some pretty sophisticated virtual reality game systems, especially considering the new 360 degree video thing that they can do these days in movies.
Yeah. Maybe not even in 50 years, but sooner. I would say it would be possible to have something like that in ~30 years even.
Just think about that what did we have like 30 years ago? Hell, even the C-64 is only ~25 years old... :D
From the Apocryphal note of AtariCode: [Select]In the Beginning, there was Pong. But that was boring, so people didn't waste much time on it.
Then was the Computer's wrath kindled against man. And it swore in its wrath to better pong. And behold, the Computer said, "Let there be blobs." And there were blobs. And the Computer saw the blobs, and it saw that they bounced randomly on the screen. And the Computer was entranced for hours on end.
Then came forth the Programmer. And he saw the blobs, and saw that they were most Heinous. And he said unto the Computer, "Hey, let me blow up the blobs." And the computer was awakened from its stupor.
And the computer said, "Let there be a triangle." And there was a triangle. And the programmer did smite the blobs with the triangle. And thus was created Asteroids.
Version 1 will be so perfect that it will no longer be the game.The release of DF version 1.0..... I think we'll all be old geezers at that point. This is, of course, a good thing.
I don't know if Id still be interested in Dwarf Fortress by the time version 1 comes out... By then they may have helmets that create videogames for you just by thinking of them.
Question, Toady...
Since you're overhauling the body mechanics, are you going to make it so that redundant parts can be an asset? Having two hearts for example could make it possible to survive the loss of one, likewise with heads. Or the two parts could be given different jobs, like one head is the emotions, the other head the skills?
On that avenue can you set it so that if one of the two parts is lost the creature dies?
On that avenue can you set it so that if one of the two parts is lost the creature dies?
That's how it currently is, which makes hydrae a tad less dangerous than they should be.
"Measure of lethality" might be making things overcomplicated.
"Measure of lethality" might be making things overcomplicated.
Pfft. DF is all about being overly complicted. :p
Seriously though, since this kind of thing wouldn't really be exposed to the end user except in the RAWs (which only modders see anyway), I think increased customizability at the cost of simplicity is a worthy trade-off.
Pfft. DF is all about being overly complicted. :p
Seriously though, since this kind of thing wouldn't really be exposed to the end user except in the RAWs (which only modders see anyway), I think increased customizability at the cost of simplicity is a worthy trade-off.
Hm, do you find DF overly complicated right now? I think that all parts of the game are easily understandable, once the player is getting used to the ASCII graphics.
Spoiler (click to show/hide)
I have a question:
How long army arc is being developed, 'cause I'm going to be worried if it will take more than 2.5D arc :o
Footkerchief:
Then organs should be divided into cumulative (eyes for seeing, legs for walking, kidneys for...) and necessary (vocal cords and tongue for speech).
Will we be able to determine certain body layers' hardness? So we can have a creature with a hard exoskeleton but a soft, easy to gouge out inside.
Will we be able to determine certain body layers' hardness? So we can have a creature with a hard exoskeleton but a soft, easy to gouge out inside.
I was wondering about this too, in the context of material lists in general. It would be nice to be able to individually specify material properties such as hardness, sharpness, and strength (catchall for tensile, shear, compressive, etc.) with hardcoded defaults based on the material category (e.g. silk shouldn't be sharp unless otherwise specified). Dragons with exceptionally strong bones, feathertree treants easier to kill, flint being sharper than granite but not as sharp as obsidian, chitin being hard but brittle.
You'll still be able to lose a single tooth, it just doesn't have its own individual name (there are currently 6 groups).
I'm still curious if with all this body detail if there would be sexual organs.
I'm still curious if with all this body detail if there would be sexual organs.
Though I'm okay with the idea that DF inhabitants breed via spores.
I wonder if Skin will be one entity or several... hmmm
I suspect it will be an entity for every external part of the body for the most part (excluding some such as the eyes) as otherwise it could make silly instant flaying scenes.
EDIT: Subject at hand. If I cut off teleported away a cow's udder would milk come out?
I'm gonna be a doomsayer and predict this will destroy DF.
This seems rather unneeded at this time, will only make the game more complicated.
It would serve no purpose at this time, and as such it willl just slow things down.
And slowing them down is by no means a good idea.
Does "caste stuff" mean creature polymorphism?
Does "caste stuff" mean creature polymorphism?
Id hope it would be summed up entirely as "Groin" at mostWhich feels like something of a ripoff when we get down to tentacle demons.
The Tentacle demon's main source of villainy isn't that he is a sexually charged demon, but rather that he is surrounded by so much inuendo that he forces good dwarves to get evil thoughts stuck inside their head.
I'm just a squidman, man; I don't get how mammals like you can go around talking like I'm some kind of embodiment of sexual perversion when about half of you have a pseudopod welded to your groin. It's just ignorant, is what it is.
:( I feel like toady is getting stuck on overly detailed body parts. I think I would have rather had more game, rather than more detail in the game we already have.
I haven't played in a couple months, can someone sum up major changes before I start a community fortress on another forum?
Without the revamped body parts/added body parts the military aspect can't expand. i.e; goblin sieges would still fall to a single wrestling champion who's been at it for a mere few weeks. Now, maybe you like an easy fort, but I'm fairly tired of having five soldiers defend the realm successfully while 100 odd other dwarves go about with idle and party status.These things could be balanced out more easily, just adding more properties to various body parts we already have would also be enough to make things like ranged combat more realistic.
:( I feel like toady is getting stuck on overly detailed body parts. I think I would have rather had more game, rather than more detail in the game we already have.
It allows people to get injured reasonably with their skin getting harmed rather then lets say their gut
It allows the Spine to get damaged rather then the Spinal Cord
This all prevents the occurance of the "God stats" problem by allowing weaker people who whittle stronger creatures down as well as allowing these stronger creatures to appear strong. (I can't explain it well)
I haven't played in a couple months, can someone sum up major changes before I start a community fortress on another forum?
- Variable amount of tiles displayed (i.e. true fullscreen)
- Site finder (basically an automated, built-in regional prospector)
- Highly customizable world gen
- More complex civilization histories with wars, conquest, etc.
- Embark settings can be saved
- Ability to forbid/dump/melt/hide items en masse, either with a designation or from Stocks
- Ability to place large sections of constructions (walls, floors) at once, rather than one at a time
Depending on how many months you've been away, these may or may not be new to you.
Personally, I'm ok with an unskilled speardwarf killing a dragon. But, it should be a one in a million chance. You know, the stuff grand stories are made of. And said dwarf should become an instant hero of the people for such a grand deed. As it is, you just sort of groan and wonder why the dragon wasn't cooler.
Yeah, but I maintain that there are plenty of examples out in the game universe of mechanics that balance combat without resorting to tracking multiple groups of teeth which is just needlessly complex. I don't like losing a dwarf out of a fort to maintain framerate for teeth.
Personally, I'm ok with an unskilled speardwarf killing a dragon. But, it should be a one in a million chance. You know, the stuff grand stories are made of. And said dwarf should become an instant hero of the people for such a grand deed. As it is, you just sort of groan and wonder why the dragon wasn't cooler.
Erom the hit on the FPS of the Game would be almost unnoticeable at such minor things like aditional bodyparts. New bodeyparts are not weather. They mostly get loaded if you look at "dwarves" (Elves,Gobos, Catgirls etc) and when this creatures get hit by something. Adding some more options wouldnt make it slower i say.
So Toady went to an Obama victory celebration party last night, I take it?
I'm just thankful Toady isn't (hopefully) adding cavities and skin cancer.
So Toady went to an Obama victory celebration party last night, I take it?
End date 03/22/09
Well, his new dev_now used the word polymorphism, so it looks like that's in.
I think it's sexual polymorphism...Man! First it's Tentacle Demons, now this! Is DF turning into a Japanimation Game?
Starting Date 10/17/08
Starting # 1295
Current Date 11/05/08
Current # 1138
(Elapsed days) 19
(# to date) 157
(Rate) 8.26
Days Remaining 137.72
End date 03/22/09
These numbers can change to reflect different rates; as it is, the numbers are a little skewed due to the end-of month break. After a few more weeks, we may have a smaller number.
I feel like toady is getting stuck on overly detailed body parts. I think I would have rather had more game, rather than more detail in the game we already have.
I just hope he doesn't go all hair crazy like he did in armok 1... Cuz it was just ridiculous.
I just hope he doesn't go all hair crazy like he did in armok 1... Cuz it was just ridiculous.
Explain, I wasn't around during the first Chapter of Slaves to Armok
ARMOK 1 WAS 3D!?! Or at least Isometric!?!
While we're blessed with your almighty presence, what has been your general attitude regarding the request for more building-block materials such as rotatable/movable building components?
Because of the sheer amount of redesigning and content, will there be new additions to the Dwarf Fortress vocabulary to cope with it? Take for example say... potential RNG martial arts styles or creative art pieces.
Is skill synergy getting added along with all the other skill/att changes?
Since you're overhauling the body mechanics, are you going to make it so that redundant parts can be an asset? Having two hearts for example could make it possible to survive the loss of one, likewise with heads. Or the two parts could be given different jobs, like one head is the emotions, the other head the skills?
How long army arc is being developed, 'cause I'm going to be worried if it will take more than 2.5D arc
now it is offical, we have more detail than even the goriest games ever made
I wonder if "send in a chitin tissue to fill the skin role in the exoskeleton plan" means that you actually create the chitin in the creature material list and then send that material. I suppose for things like iron men you would also have to be able to pass materials from outside the creature definition, i.e. iron.
Will we be able to determine certain body layers' hardness?
(catchall for tensile, shear, compressive, etc.)
Upper Incisors, Lower Incisors, Upper Canines, Lower Canines, Upper Molars and Lower Molars?
I'm still curious if with all this body detail if there would be sexual organs.
So Toady went to an Obama victory celebration party last night, I take it?
I'm just thankful Toady isn't (hopefully) adding cavities and skin cancer.
I hope the fact that the map changes have relatively few numerical points is just an indication that each point is a bit bigger than in the other things.
Your priorities suck!
Quote from: Sir Nils OlavWill we be able to determine certain body layers' hardness?
For this release, yeah, you will be able to specify material properties that have combat ramifications for each tissue layer/material of the body parts. I don't think I posted the new material definitions... many of the hardness-type properties don't have use yet and won't for a while, but I did go kind of nuts with it, because I wanted it to last a while. It's a somewhat troubling list. In particular:Quote from: Footkerchief(catchall for tensile, shear, compressive, etc.)
C.. catchall? I probably should have. I was bad again.
Quote from: Footkerchief(catchall for tensile, shear, compressive, etc.)
C.. catchall? I probably should have. I was bad again.
Quote from: MagicJugglerWhile we're blessed with your almighty presence, what has been your general attitude regarding the request for more building-block materials such as rotatable/movable building components?Quote from: umimanBecause of the sheer amount of redesigning and content, will there be new additions to the Dwarf Fortress vocabulary to cope with it? Take for example say... potential RNG martial arts styles or creative art pieces.
Generally when I add a new nameable thing I add new words (you can look near the end of the word file and tell what I was adding sometimes), but there's nothing this time, I think... I'm not sure. Map features maybe. When I get to the martial arts stuff I most probably will.
I think all this new body typing stuff will add another good element to the game. It's not the stuff I'm personally looking forward to the most, but I'm patient. And it'll still make everything more fun, so why should we stress about it?
Edit: Just thought of a question. Are any of these changes going to have an effect on the world gen combat? Perhaps even let megabeasts not suck during world gen?
For what it's worth, I think your priorities are awesome.
Toady, is there any developement reason why you can't make intermediate releases that include all the wrapped up features you've finished on but leaving out the bits you're working on still?
You are such a jerk. :P
Toady, is there any developement reason why you can't make intermediate releases that include all the wrapped up features you've finished on but leaving out the bits you're working on still?
You are such a jerk. :P
Dang... I really gotta get myself a copy of that game...
Dang it... I cannot find that old page anymore...
I think the classical Armok pages are dead... ohh well.
Dang... I really gotta get myself a copy of that game...
Dang it... I cannot find that old page anymore...
I think the classical Armok pages are dead... ohh well.
Yeah, its a pity you just can't go here (http://www.bay12games.com/armok/)...
Edit: Just thought of a question. Are any of these changes going to have an effect on the world gen combat? Perhaps even let megabeasts not suck during world gen?
Quote from: MagicJugglerWhile we're blessed with your almighty presence, what has been your general attitude regarding the request for more building-block materials such as rotatable/movable building components?*Looks and notices no reply to his quote...was this an error?
If there a possibility of a release once the wounds are updated? Because that's honestly one of my big points of annoyance right now.
As long as combat in general is being improved, are the munitional application of coins, water and vomit going to be decreased?
I'm probably going to tackle things like siege towers, which are multi-tile, multi-level constructions that can move across the map while containing critters and items (much like boats would be), and that also opens up some more thought along the lines of improved traps and all that.
I am kinda curious to what he expanded Sizes to. If I were to guess Id say he multiplied it by 5 so a Dragon is size 100
I am kinda curious to what he expanded Sizes to. If I were to guess Id say he multiplied it by 5 so a Dragon is size 100
Also let's don't forget about the SIZE variences in a given race. I suppose it will work like [example]:
Troll
Minimum SIZE: 15
Maximum SIZE: 20
So trolls will be generated randomly between SIZE 15 and 20. 8)
I am kinda curious to what he expanded Sizes to. If I were to guess Id say he multiplied it by 5 so a Dragon is size 100
Also let's don't forget about the SIZE variences in a given race. I suppose it will work like [example]:
Troll
Minimum SIZE: 15
Maximum SIZE: 20
So trolls will be generated randomly between SIZE 15 and 20. 8)
I'm curious how relative body part sizes fit into that.
You just need to expand the head-hole a bit to accept two different heads. I would imagine a giant with a large neck would have armor sutable for a smallish etten.
Eventually, but the Combat Arc is more likely for that.Quote from: MagicJugglerWhile we're blessed with your almighty presence, what has been your general attitude regarding the request for more building-block materials such as rotatable/movable building components?*Looks and notices no reply to his quote...was this an error?
Ah, yeah, I missed it among the many blocks, even though or perhaps because it was first. My general attitude... there are a couple things I guess. Once sieges are up for improvement in the army arc, I'm probably going to tackle things like siege towers, which are multi-tile, multi-level constructions that can move across the map while containing critters and items (much like boats would be), and that also opens up some more thought along the lines of improved traps and all that. There's also a dev item on generalized workshops, which I haven't fleshed out really, about allowing more types of jobs to take place at say, a table with some tools, and then allow specialization with more equipment, perhaps homogenizing this with the notion of rooms and stockpiles and activity zones and so on under one sensible umbrella. Nothing finalized though.
so has toady resolved the issue with multi-tiled machines and creatures with the seige-engines?
Some thoughts on clothing. If dwarves are Size 30, with variance +/-3, would we have to order different sizes of armor to be built? Like Size 33 for big guys, and Size 30 for the smaller end?
Some thoughts on clothing. If dwarves are Size 30, with variance +/-3, would we have to order different sizes of armor to be built? Like Size 33 for big guys, and Size 30 for the smaller end?
I am clueless, but this sounds a bit too complicated to me. [Even tho, it makes sense and sounds realistic]
I guess I'm for it if Toady can come up with a way to make resizing/appropriate sizing built into the game in a reasonably seamless way. Perhaps instead of simply making X shirts we have a system where dwarves go to the tailor/leatherworker and get a shirt made for them?
I hope Toady won't make anything like varied clothing sizes. If there is one thing Dwarf Fortress doesn't need, it's more micromanagement.
And, more realism doesn't always mean more fun. There is a thing called "abstraction", which can really improve playability at times.
I hope Toady won't make anything like varied clothing sizes. If there is one thing Dwarf Fortress doesn't need, it's more micromanagement.
And, more realism doesn't always mean more fun. There is a thing called "abstraction", which can really improve playability at times.
I'm not sure how feasible this is, but if the stacking system was revamped this would be less of a problem. You could have all the variety of clothes you wanted, and have it all stacked into an abstract "Shirts [8]" stack which has three Size 8 shirts, four Size 5 shirts, and 1 Size 6 shirt. This could expand to food, weapons... really, just about anything.
Assuming that's anywhere close to feasible, of course.
This is a miscellaneous note, but it needs to be said: Every, single, recorded wolf attack on a human in real life- every one- was an attack by a rabid wolf. In DF worlds, either Rabies is more contagious than the common cold, or adventurers are actually made of raw spam.
This doesn't solve the main problem, which is that you would still have to produce certain numbers of each size. E.g. equipping your 30-dwarf military with plate requires checking each dwarf to see how many need "large," how many need "small," etc. That's the part that involves excessive micro.
That said, we currently have very little knowledge on how size variation will work.
Remembered to make ribs internal.Imagine what would happen if he had forgotten.
This is a miscellaneous note, but it needs to be said: Every, single, recorded wolf attack on a human in real life- every one- was an attack by a rabid wolf. In DF worlds, either Rabies is more contagious than the common cold, or adventurers are actually made of raw spam.
QuoteRemembered to make ribs internal.Imagine what would happen if he had forgotten.
Creepiest bug ever?
This is a miscellaneous note, but it needs to be said: Every, single, recorded wolf attack on a human in real life- every one- was an attack by a rabid wolf. In DF worlds, either Rabies is more contagious than the common cold, or adventurers are actually made of raw spam.I don't remember the lines "My, what a foamy mouth you have / The better to display my illness, my dear." So there's a recorded non-rabid wolf attack on a human.
I hope Toady won't make anything like varied clothing sizes. If there is one thing Dwarf Fortress doesn't need, it's more micromanagement.
This is a miscellaneous note, but it needs to be said: Every, single, recorded wolf attack on a human in real life- every one- was an attack by a rabid wolf. In DF worlds, either Rabies is more contagious than the common cold, or adventurers are actually made of raw spam.
How little they know about dwarven steel. Tsk tsk tsk.This is a miscellaneous note, but it needs to be said: Every, single, recorded wolf attack on a human in real life- every one- was an attack by a rabid wolf. In DF worlds, either Rabies is more contagious than the common cold, or adventurers are actually made of raw spam.I don't remember the lines "My, what a foamy mouth you have / The better to display my illness, my dear." So there's a recorded non-rabid wolf attack on a human.
Wolves (and other predators) attack things they can kill without getting hurt. Children and sheep and bambies, basically. And dwarves are child-sized.
I think I might have a solution to the clothing dilemma.
An idea could be for a job to be to add a new profession called "Tailor" which would allow one to get a Dwarf's or other character's dimensions (who is "designated for measurement") and the better the skill of the tailor, the quicker a fit will be made. From there, you can create a clothing/armor but rather than setting it by size, you set it by Dwarf (and you have the option to hide Dwarfs you don't want to make clothing for beforehand...e.g. that Champion who already has full plate doesn't need more). Clothing types would have a spectrum of low-high fitting, and the closer the clothing type's median is to the Dwarf's dimensions, the better the fit and the snugger the Dwarf (or other creature) feels. :)
I think I might have a solution to the clothing dilemma.
An idea could be for a job to be to add a new profession called "Tailor" which would allow one to get a Dwarf's or other character's dimensions (who is "designated for measurement") and the better the skill of the tailor, the quicker a fit will be made. From there, you can create a clothing/armor but rather than setting it by size, you set it by Dwarf (and you have the option to hide Dwarfs you don't want to make clothing for beforehand...e.g. that Champion who already has full plate doesn't need more). Clothing types would have a spectrum of low-high fitting, and the closer the clothing type's median is to the Dwarf's dimensions, the better the fit and the snugger the Dwarf (or other creature) feels. :)
I envisioned the Tailor as a dwarf who does a "measure dwarf" job at his workshop,
QuoteI envisioned the Tailor as a dwarf who does a "measure dwarf" job at his workshop,
The current job system can't really handle "two dwarves to be in the same place at the same time", as evidenced by crappy liaison meetings, and I suspect changing it to be able to do so would be somewhat more complex than it sounds.
This is a miscellaneous note, but it needs to be said: Every, single, recorded wolf attack on a human in real life- every one- was an attack by a rabid wolf. In DF worlds, either Rabies is more contagious than the common cold, or adventurers are actually made of raw spam.
Wolf attacks ocour not only when they have rabbies.
Quote from Toadys dev_log
1088. More material stuff. Also the possibility in the raws to set names for each profession type for creatures and also within the different morphs for each creature. It's still a grind down to the mid 1030s where the wounds start.
It sounds more like we can call female speargoblins "eyepokers" while the male ones are "lungpiercers" or whatever.
and there could always be a surprise like a few hundred getting done in a day
Time Elapsed: 25This prediction is like those wonderful progress bar indicators when you're installing software: totally meaningless :)
# Complete: 217
Time Remaining: 124.19
End Date: 03/15/09
I would just like to say that my borgle's borgles are *extremely* borgly. They're, like, *huge*.
I think we're all overlooking something important here.
Dwarves can be fat now.
Urist McPile cancels job: climb stairs: Exhausted
I wonder if adipose tissue is part of the standard tissue complement now.
Where do I find the counter?
You too?I wonder if adipose tissue is part of the standard tissue complement now.
wow, that just made me think of a dr who episode.
also, dwarves should get quality haircuts, related to positive thoughts
Urist McScruffy has been ecstatic lately. His finely cut hair is starting to grow out of shape a little. His beard is splendidly cut, and decorated with +wood pearls+.
Damn, the speed of the progress IS AMAZING!!!. Looks like tommorow I get to play with the new hairy dwarves...
Neonivek, do you want some bags of money? I have plenty!
I like cookies!
"everybody becomes shaggy over time"
Damn, ninja'd to the Cousin Itt picture.
Anyone else planning to let hair go the way of worn clothes, and just let your dwarves turn into naked hairballs? Castaway Fortress.
I kinda wonder how Toady will describe a French Braid without the term "French"
I suddenly realized that polymorphism means that we could make only the females milk-able, suddenly solving half the milking problem.
Damn, the speed of the progress IS AMAZING!!!. Looks like tommorow I get to play with the new hairy dwarves...
Neonivek, do you want some bags of money? I have plenty!
I like cookies!
Patience is a virtue. Anything worth having is worth waiting for.
Look remember that progress with either be moderate, SLOW, or Speedingly fast (usually toady has a point where he can knock over 100 in one day... usually bug fixes though)
also, dwarves should get quality haircuts, related to positive thoughts
Urist McScruffy has been ecstatic lately. His finely cut hair is starting to grow out of shape a little. His beard is splendidly cut, and decorated with +wood pearls+.
though I do predict the following problem:
Urist McBarber cancels cut hair: Getting drink
Urist McScruffy cancels wait for barber: Died of thirst.
it will be like giving water, where the dwarf waits endlessly in the barbershop and no dwarf with beardcutting enabled bothers to follow his profession
10/22/2008: 1203. I unified the trees and shrubs raws (though they are still split for all intents and purposes when it comes to playing the game, so you can't start planting trees or anything like that at this early stage). The join will be handy for future additions, although if there are bugs with dwarves eating oak mushrooms or chopping down wild strawberry trees, it won't come as a surprise.
I doubt we'll have trees with fruit. Especially since he said "though they are still split for all intents and purposes when it comes to playing the game, so you can't start planting trees or anything like that at this early stage". I assume that fruit trees fall under "anything like that".
I doubt we'll have trees with fruit. Especially since he said "though they are still split for all intents and purposes when it comes to playing the game, so you can't start planting trees or anything like that at this early stage". I assume that fruit trees fall under "anything like that".
a sign of mild boredom induced insanity
I like the idea of making apple pie by taking an apple tree to the smelter and setting it on fire.
e: hey Toady, if there's nothing to post in the dev log, you could give us a peek at some of new material/body/caste/appearance raws. I at least would find it interesting.
I kinda wonder how Toady will describe a French Braid without the term "French"
e: hey Toady, if there's nothing to post in the dev log, you could give us a peek at some of new material/body/caste/appearance raws. I at least would find it interesting.
I agree. It's not like he'd be really releasing part of the game early, but it would allow us to start making and/or thinking about user-made content for the new version. I'm very anxious to see some stuff for this new way of making bodies.
11/17/2008
"Today it was all the caravan plant stuff..."
Caravan plant stuff? What is that means? ???
^^^ Yeah. I think the caravans already know how to select biome-appropriate plants, so maybe he had to change the way caravans reference plant byproducts.
11/17/2008This is the army arc he's working on. So must be spies. In the caravans. You know that suspicion that elves might be in league with the kobolds? It's all true!
"Today it was all the caravan plant stuff..."
Caravan plant stuff? What is that means? ???
One would think that would be handled in the caravan arc. Then again, it could be helpful with the army arc resource management.
Eh, who knows.
11/17/2008
"Today it was all the caravan plant stuff..."
Caravan plant stuff? What is that means? ???that boy needs therapy
I'm not sure, but my guess is controlling what plants the caravans bring. Just a shot in the dark.
I wonder whether heritability is being taken into account in some fashion for the new appearance stuff.
...pearl, ivory, horn...
At least there's something in the devlog now.Quote from: Toady One...pearl, ivory, horn...
No more " item in bedroom"?
I wonder whether heritability is being taken into account in some fashion for the new appearance stuff. The only alternative would be generating individual appearance randomly, as personality currently seems to work.
However, if you're not on a coast you won't have pearl, so you're screwed for moods. :P Better cage the animals with ivories, too. Else, you'll hunt them to extinction in year 4.
At least there's something in the devlog now.Quote from: Toady One...pearl, ivory, horn...
No more " item in bedroom"?
well amber can be "mined" in sand. Russia does that with big machines. Maybe the corrals get carried with the waves to the Beach?
It would be awesome if amber could be mined from petrified wood.
I wonder if adipose tissue is part of the standard tissue complement now.
Damn, the speed of the progress doesn't look good. Looks like I'll have to wait a while before I get to play with the new hairy dwarves...
Toady, can be colours set too? And do get dwarfs and alike random haircolors/ one Haircolour out of an list? Can Hair become gray over the time?
Toady can you give us an example how the raw of an creature will look after the update?
Well with what he said about unifying materiel raws it sounds like we would be able to chop down a fruit tree and mod it so if you shove it in a smelter you get "(10) Juicy apples"
Caravan plant stuff? What is that means?
I wonder whether heritability is being taken into account in some fashion for the new appearance stuff.
No more " item in bedroom"?
QuoteI wonder whether heritability is being taken into account in some fashion for the new appearance stuff.
The 30 in the body part of the countdown after wounds but before venom and then site/civ stuff is mainly this. Hair and skin colors should be more or less preserved by offspring, and I think there will probably also be links for other appearance variables and perhaps att modifiers. Whatever comes up really.
The fat layer is linked to energy storage and can resize with that, and the muscle layer is linked to strength and can resize with that attribute.
The fat layer is linked to energy storage and can resize with that, and the muscle layer is linked to strength and can resize with that attribute. (There are a few countdowns left on that behavior though). This means that a fatter dwarf should move slower but block damage more readily (and be hit more often). They had a fat guy stop a bullet without "actual" damage in trauma life in the er a few days ago so I guess there's some clear reality there.
that boy needs therapy
... for the purposes of blood volume and damage resistance and so on ...
... blood volume ...
... for the purposes of blood volume and damage resistance and so on ...
... blood volume ...
So really, really huge creatures will have really, really, huge guts, which when ripped and teared, should hypothetically become blood baths of biblical proportions?
1055. Tanning/fat rendering/soap making jobs are now in the reaction raws,
"Huge! Huge! HUUUUUGE!"
"Where does he get SUCH POWER?"
The fat layer is linked to energy storage and can resize with that, and the muscle layer is linked to strength and can resize with that attribute. (There are a few countdowns left on that behavior though). This means that a fatter dwarf should move slower but block damage more readily (and be hit more often). They had a fat guy stop a bullet without "actual" damage in trauma life in the er a few days ago so I guess there's some clear reality there.
All very awesome stuff, but-
This actually makes me worry slightly. DF is ultimately a fantasy game, and there's a few creatures in the raws that don't strictly obey the laws of biology. If fat stores energy and you make a big creature with no fat storage, will it pass out all the time from exhaustion?
This actually makes me worry slightly. DF is ultimately a fantasy game, and there's a few creatures in the raws that don't strictly obey the laws of biology. If fat stores energy and you make a big creature with no fat storage, will it pass out all the time from exhaustion?Skeletal dragons spring to mind......
This actually makes me worry slightly. DF is ultimately a fantasy game, and there's a few creatures in the raws that don't strictly obey the laws of biology. If fat stores energy and you make a big creature with no fat storage, will it pass out all the time from exhaustion?Skeletal dragons spring to mind......
Presumably they'll be able to draw on some alternative "magical" source of energy. If creatures can mix and match these sources, then there's no problem. Would be good for e.g. elves, with their slightly magical nature, being able to perform better than their skinny, lanky bodies ought to permit.
6) Attributes that will grow together rather then seperately or simply linked
7) Attributes that go down as another go up
Quote1055. Tanning/fat rendering/soap making jobs are now in the reaction raws,
This implies we'll be able to add reactions to the Alchemist's Workshop!
All very awesome stuff, but-The fat layer is linked to energy storage and can resize with that, and the muscle layer is linked to strength and can resize with that attribute. (There are a few countdowns left on that behavior though). This means that a fatter dwarf should move slower but block damage more readily (and be hit more often). They had a fat guy stop a bullet without "actual" damage in trauma life in the er a few days ago so I guess there's some clear reality there.
This actually makes me worry slightly. DF is ultimately a fantasy game, and there's a few creatures in the raws that don't strictly obey the laws of biology. If fat stores energy and you make a big creature with no fat storage, will it pass out all the time from exhaustion?
A++ for vocabulary... (No sarcasm at all)6) Attributes that will grow together rather then seperately or simply linked
7) Attributes that go down as another go up
Ideally these wouldn't exist -- attributes are meant to be orthogonal.
"Huge! Huge! HUUUUUGE!"
"Where does he get SUCH POWER?"
"Huge! Huge! HUUUUUGE!"
"Where does he get SUCH POWER?"
Toady, have you ever read into Gurps GULLIVER (http://www.gamesdiner.com/gurps/GULLIVER/indexframe.html)?
I wonder if there is some corelation in this game between intelligence and brain size.
I wonder if there is some corelation in this game between intelligence and brain size.
I would hope not. Otherwise we'll have hivemind psychic whales or something crazy.
Wildly off-topic, but doesn't anybody else want to see what the fortresses Toady One makes look like? He only shows us the rare glimpse of the testing games he plays. Do they look anything like the in-game Mountain Halls?
I wonder if there is some corelation in this game between intelligence and brain size.
I would hope not. Otherwise we'll have hivemind psychic whales or something crazy.
On that avenue can you set it so that if one of the two parts is lost the creature dies?
That's how it currently is, which makes hydrae a tad less dangerous than they should be.
I know, but if he changed it so they don't have to die Id like to have the option so you can set the measure of lethality on losing an organ even if the creature has multiple. For example:
-A human being without a kidney will live, but will have a lowered lifespan and an injured constitution
-A Hydra who loses a head is completely unimpeded as if nothing happened (Hydras really should have "No pain")
-A Two headed snake who loses a head will most likely die (I think)
The strange thing is that Mike slept with his head, and somehow could still use it to crow, though it sounds really strange.On that avenue can you set it so that if one of the two parts is lost the creature dies?
That's how it currently is, which makes hydrae a tad less dangerous than they should be.
I know, but if he changed it so they don't have to die Id like to have the option so you can set the measure of lethality on losing an organ even if the creature has multiple. For example:
-A human being without a kidney will live, but will have a lowered lifespan and an injured constitution
-A Hydra who loses a head is completely unimpeded as if nothing happened (Hydras really should have "No pain")
-A Two headed snake who loses a head will most likely die (I think)
But consider the case of Mike the Headless Chicken (http://%22http://en.wikipedia.org/wiki/Mike_the_Headless_Chicken%22)...
The strange thing is that Mike slept with his head, and somehow could still use it to crow, though it sounds really strange.
...outside materials being any of the hardcoded materials, any of the materials from the material raws such as stone/metal/plants, or any of the materials from any creature, so you could have a "dwarf lung man" made entirely out of the dwarf lung material if you like, or one made out of sweet pod syrup...
...outside materials being any of the hardcoded materials, any of the materials from the material raws such as stone/metal/plants, or any of the materials from any creature, so you could have a "dwarf lung man" made entirely out of the dwarf lung material if you like, or one made out of sweet pod syrup...
Armok 1 had colors, descriptions and individual materials and functions for every single bodypart you had. It was awesome. It seems the same approach is going here.
The last devlog entry for the month and no one's talking about it.
Are hollow body parts implemented?
Yeah, gender differentiation was already confirmed. No official genitalia as yet, although it'll be trivially easy to mod them in, as complex as you want. If you could link tissue sizes to emotional states as you can to attributes... well, down that road lies only despair, but it WOULD have legitimate uses, like pufferfish bloating themselves when frightened.
Yeah, gender differentiation was already confirmed. No official genitalia as yet, although it'll be trivially easy to mod them in, as complex as you want. If you could link tissue sizes to emotional states as you can to attributes... well, down that road lies only despair, but it WOULD have legitimate uses, like pufferfish bloating themselves when frightened.
Technically this also could help officially mod in the Hulk
Technically this also could help officially mod in the Hulk
Size alteration could be fun in many cases, especially as a token ability. Go go mecha-dwarf battlemode.
@-***=.T
No official genitalia as yet, although it'll be trivially easy to mod them in, as complex as you want.
Hm. You know, I hope Toady has overhauling itemcorpses somewhere in the plans for this as well. It seems to fit, at any rate. Hm, "bodypartcorpse" would solve the hydra issue
Hm. You know, I hope Toady has overhauling itemcorpses somewhere in the plans for this as well. It seems to fit, at any rate. Hm, "bodypartcorpse" would solve the hydra issue - "[BPCORPSE:TYPE:HEAD:SKULL:NO_SUBTYPE:BONE:HYDRA]". And open a pathway for modders - "[BPCORPSE:TOKEN:RHAND:ITEM_WEAPON_SSWORD:NO_SUBTYPE:METAL:IRON]". :D
What hydra issue? They have one head that has a skull that contains their brain, the rest of the heads just have nerve lumps to control that head and a cartilage (unusable for crafts) skull.Ahem. And why does this main nerve center always happen to be the first and only head that the hydra ever gets chopped off? ;)
That's my explanation and I'm sticking to it. And modding it back in if I have to.
Because it counts just the presence of a [HEAD], not the number of parts with it. And yes, you'd have to add it to every creature with a head. Then again, this is what defaults are for, like [STANDARD_CORPSE]. The syntax is for definition of special cases. If you chop a minotaur's horn off, it must not disappear, it should be present as an item, a trophy!
Yeah, gender differentiation was already confirmed. No official genitalia as yet, although it'll be trivially easy to mod them in, as complex as you want. If you could link tissue sizes to emotional states as you can to attributes... well, down that road lies only despair, but it WOULD have legitimate uses, like pufferfish bloating themselves when frightened.
Yeah, gender differentiation was already confirmed. No official genitalia as yet, although it'll be trivially easy to mod them in, as complex as you want. If you could link tissue sizes to emotional states as you can to attributes... well, down that road lies only despair, but it WOULD have legitimate uses, like pufferfish bloating themselves when frightened.
"Engraved here is an image of a dwarf and a pair of *******. The dwarf is embracing the *******."
So who is planning to mod in sweet pod syrup men?Everyone.
If we had an idea of what the new RAW's looked like, I would post the code for a gingerbread man.So who is planning to mod in sweet pod syrup men?Everyone.
Everyone wants the candyman to come to town.
If we had an idea of what the new RAW's looked like, I would post the code for a gingerbread man.So who is planning to mod in sweet pod syrup men?Everyone.
Everyone wants the candyman to come to town.
Now if only we could make them weak to wate-
Idea: Do water elementals die if they are frozen in a freezing biome, or become ice elementals...
Basic Army Arc
What about two creatures being able to combine and morph into a new super creature. Like say some super badass goblin with 450 kills has finally attained enough power and alignment with his god, and the demon god melds with the goblin and now he's UberGoblin.
With you being able to TECHNICALLY apply gases and liquids as materials for the creature I wonder how long this puts us until we can have characters who are gases or liquids... Or at least until Blood is actually a seperate material.
Ehh dwarven souffles;
This is a *hot air roast*. It's ingredients are minced hot air, finely minced hot air, exceptionally minced hot air and dwarven sugar.
I wonder if at some point it would be possible to make items that effect what a creature is made out of. Certain mythological things pop into mind like the Midas touch turning everything to gold or the glare of Medusa turning adventurers to stone. I guess there would have to be a mechanic for keeping things alive after their composition has changed.
I wonder if that means someone who is very strong can actually increase their "Size" or if someone who is very strong only makes their muscles larger inside their body relative to everything else.
However: If fatness is linked to energy storage, well... do dwarves have different metabolisms or natural fatness? If not, I'm wondering if we'll get issues where any well-fed fortress ends up full of fat dudes and no skinny guys whatsoever. It would be hilarious, yet problematic/unrealistic.
So really, really huge creatures will have really, really, huge guts, which when ripped and teared, should hypothetically become blood baths of biblical proportions?
Haha. The blood won't actually flow, but it would be pretty badass if the amount of blood splatter was linked to actual blood volume loss, i.e. you cut off a Titan's arm and all the nearby tiles get drenched in blood.
This actually makes me worry slightly. DF is ultimately a fantasy game, and there's a few creatures in the raws that don't strictly obey the laws of biology. If fat stores energy and you make a big creature with no fat storage, will it pass out all the time from exhaustion?
Actually, he listed three jobs. That take place in three different workshops.
This implies (at least, without too much wishful thinking) that the reaction raws have been generalized to accept any workshop.
Do these support racegloss or something like it? Is there any support for selective racegloss so it's not just picking just _any_ appropriate material but limit it somehow
I can't wrap my mind around the idea of a game that models the color of your guts.
I'm hoping we'll be able to define phases of development (i.e. [Child] of creature has its own tokens, and at [Age] it becomes [Adolescent] and its tokens change).
Hm, so iron men are solid iron all the way through? Are hollow body parts implemented?
It would be cool to reanimate the empty molted exoskeletons of giant cave spiders.
I seem to recall making pants out of bunny brains in Armok 1. Will we be able to do the same thing with the new version I hope?
I wonder, does this ugrade include gender-differentiation ?
Can we give all the necessary tags for survival to a single body part?
Can we now make pig tail sock puppets?
Or will we just be limited to "pig tail man"?
With you being able to TECHNICALLY apply gases and liquids as materials for the creature I wonder how long this puts us until we can have characters who are gases or liquids... Or at least until Blood is actually a seperate material.
Better idea: Dwarves skin made of glass, organs made of beer.So who is planning to mod in sweet pod syrup men?Everyone.
Everyone wants the candyman to come to town.
Quote from: i are not good with compuSo really, really huge creatures will have really, really, huge guts, which when ripped and teared, should hypothetically become blood baths of biblical proportions?Quote from: FootkerchiefHaha. The blood won't actually flow, but it would be pretty badass if the amount of blood splatter was linked to actual blood volume loss, i.e. you cut off a Titan's arm and all the nearby tiles get drenched in blood.
The current version already sort of does this (as those that are bleeding a lot leave larger puddles), but yeah, it's a pain to track too much info about blood on map tiles (though it might happen when I do the liquid type expansion that's sort of a prereq for having terrifying areas with rivers of blood and all that). I'm probably going to do a bit this time with blood events that track more information about blood stains beyond the bits I've set aside now, but that'll depend on a few things (time, mostly).
This made me think of an arena that is supplied with combatants so quickly that it fills with their blood and results in everyone there drowning.
Although that kind of blood flow might be a tad unrealistic.
Just drowning in a river of blood is also quite disgusting.
What about evil regions that have rivers of blood?
Quote from: Jetman123What about evil regions that have rivers of blood?That would be a bit "too much". ;)
it might happen when I do the liquid type expansion that's sort of a prereq for having terrifying areas with rivers of blood and all that
Looking forward to using the new nearly invincible ironmen as the ultimate arena monsters.
I'll need to find a map with them and trap 'em early on.
Dragon vrs Bronze Colossus. Who will die first, the torn dragon or the melting Colossus.
I wonder if they'll still do the odd quick-regeneration thing? (Colossi.)
Quote from: TormyQuote from: Jetman123What about evil regions that have rivers of blood?That would be a bit "too much". ;)Quote from: Toadyit might happen when I do the liquid type expansion that's sort of a prereq for having terrifying areas with rivers of blood and all that
Ha! ;)
The question is, will this change anything during worldgen ? It's no use for collossi to be invincible if they die before.
God, it sounds deeply stupid.
Anyway you got it.
Edit: Just thought of a question. Are any of these changes going to have an effect on the world gen combat? Perhaps even let megabeasts not suck during world gen?
Eventually, but the Combat Arc is more likely for that.
there'd better be colloids. I want jelly monsters and foam hair and aerosol monsters
not very realistic: entire fortress would be able to survive from just 3-4 kittens a year, as long as every organ provides a complete meal
Edit: Also, if blood was edible (I think it actually is now, not sure. Either it or vomit is. One's potable, one's edible, probably. Ick.), and an entity was defined as okay drinking it, that entity's forts could survive at blood rivers.
Blood can be edible. I've eaten it before (both duck and pig blood) - it was in partially coagulated cubes, kind of like jello. It's actually really good, but I'm guessing it needs preparation.
There's also blood sausage.
Blood can be edible. I've eaten it before (both duck and pig blood) - it was in partially coagulated cubes, kind of like jello. It's actually really good, but I'm guessing it needs preparation.Don't forget a really nice rice covering is chicken blood + other spices.
There's also blood sausage.
Blood can be edible. I've eaten it before (both duck and pig blood) - it was in partially coagulated cubes, kind of like jello. It's actually really good, but I'm guessing it needs preparation.Don't forget a really nice rice covering is chicken blood + other spices.
There's also blood sausage.
But be warned: Blood often gives food a taste that can only be called iron-tasting. And by often I mean every time.
There's also blood sausage.
Eeewwww.. :o
There's also blood sausage.
Eeewwww.. :o
Hehe, it actually looks even worse than it sounds:
http://i34.tinypic.com/2qdd5wo.jpg (http://i34.tinypic.com/2qdd5wo.jpg)
..but tastes quite good with lingonberry (red stuff in picture).
There's also blood sausage.
Eeewwww.. :o
Hehe, it actually looks even worse than it sounds:
http://i34.tinypic.com/2qdd5wo.jpg (http://i34.tinypic.com/2qdd5wo.jpg)
..but tastes quite good with lingonberry (red stuff in picture).
Berries that taste like bologna and copper?
I give you the less disgusting blood sausage:Spoiler (click to show/hide)
Made of pork blood, less quality meat and groats. Tastes delicious. ;)
What kind of dwarf uses sheep?A carspidten? But that's only on feast days.
It would be carp liver, heart and lungs inside carp intestine inside giant cave spider liver, heart and lungs inside giant cave spider intestine inside kitten liver, heart and lungs inside kitten intestine.
]A carspidten? But that's only on feast days.
What kind of dwarf uses sheep?
It would be carp liver, heart and lungs inside carp intestine inside giant cave spider liver, heart and lungs inside giant cave spider intestine inside kitten liver, heart and lungs inside kitten intestine.
That reminds me, I'm going to donate again this month. Toady needs a good December!
Hey, do the new plant raws and reactions mean we can finally get/mod vegetable oil?
So we are from what Id guess 10 days away until the Raw list starts seriously moving!
Going on this assumption, and also assuming that progress after the slow patch will mirror progress before the slow patch, my release prediction is April 3rd.
Going on this assumption, and also assuming that progress after the slow patch will mirror progress before the slow patch, my release prediction is April 3rd.Toady would do those three days of work in March and then take the extra days off of April, I think.
Also, any clue why the devlog hasn't updated?
Toady would do those three days of work in March and then take the extra days off of April, I think.
Also, any clue why the devlog hasn't updated?
Because you touch F5 rather than Ctrl+F5 at night.
The Bay 12 server seems to lie about its date-modified stamps for some reason.
I think it'll be worth the wait.
I am going to write an little "random" Programm that creates, Creatures, Civs materials and extracts just for fun.
So now my eyebrows can fly off in a bloody arc? Awesome!
Grrhm... but can you imagine WHAT demands will the nobles now be making? "I want a sock of Giant Eagle Left Wing Leather"...
As soon as you realize where the tags are and what they do it's a short, bloody trip from Dwarf Fortress: Slaves to Armok to Dwarf Scientist: That which Armok did not intend
FINALLY!!! Why hasn't anyone made this yet?
Also, the devlog suggests that different states of the same creature type will now use different symbols. I sense confusion coming.
Also, the devlog suggests that different states of the same creature type will now use different symbols. I sense confusion coming.
This was mainly for the Antman... Queen type stuff, where I might use a capital A or something.
I wonder how many different castes will be permitted for a single race...
Also, the devlog suggests that different states of the same creature type will now use different symbols. I sense confusion coming.
This was mainly for the Antman... Queen type stuff, where I might use a capital A or something.
I wonder how inter-caste breeding will work.
Also, the devlog suggests that different states of the same creature type will now use different symbols. I sense confusion coming.
Also, the devlog suggests that different states of the same creature type will now use different symbols. I sense confusion coming.
This was mainly for the Antman... Queen type stuff, where I might use a capital A or something.
I wonder how many different castes will be permitted for a single race...
As many as you want, within reason. They are allocated as it loads them in from the raws. You'll probably experience weird slowdowns or memory problems if you add thousands of them, but I don't think you'll blow out any variables until you get around 32000, unless the raw loader can't handle files that are long.
Color variations and changes over time are done (for any tissue layer, from skin or muscle to the stomach to eyebrows or claws), and I've defined a new colored pattern definition for things like stripes and mottled patterns that can have more than one color at a time. So you could have your borgle's borgle fade from either their starting blue or starting red into a purple and green striped pattern gradually as they age, or something. Appearance modifier change rates are also done, so unit hair/nails can grow, or you could have your borgle's borgle grow thicker from age 10 years to age 15 years (it still can't be borgly to any degree). It only supports one start/end time at this point for growth rates, but today's changes are enough to go from having no facial hair for a human male at birth to having a beard start to grow after some years to having the beard gray slowly after a certain age is reached (with the color change being defined as a change at the root of more and more hairs rather than a fading of the color all around, as you might want for some other color changes). The length/color changes will matter for the descriptive paragraphs (which are up roughly after wounds in the countdown), and there can be all sorts of applications later on, from cultural entity rules to wrestling effects.(http://www.clipartof.com/images/thumbnail/508.gif)
will this update also allow for methamorhposis, like a gigantic supper-magot becoming a gigantic-supper cocon, and then a super fly ?
My borgle is thicker than your borgle. Oh yeah ladies, I am so borgly.
How are we supposed to mod in proper borgles? We must be able to show how borgly they are!
will this update also allow for methamorhposis, like a gigantic supper-magot becoming a gigantic-supper cocon, and then a super fly ?
I guess so... :D
Hey, do the new plant raws and reactions mean we can finally get/mod vegetable oil?
I think you can do that already via a plant extract?
...and there can be all sorts of applications later on, from cultural entity rules to wrestling effects.
Doesn't sound like it, no. Toady said that there's only one period of growth, so they could not seasonally alternate between long hair and short.
BUG 000638 □ [dwarf mode][environment] large ocean creatures unable to enter the play area
Yeah but really how much Ocean life do you have to deal with?
Though I admit it would be interesting to see Sea monsters (who can breathe on land) come from the ocean and attack your dwarves :D
will this update also allow for methamorhposis, like a gigantic supper-magot becoming a gigantic-supper cocon, and then a super fly ?
I guess so... :D
From earlier Toady posts and the dev log, I think you can do that, so long as you don't mind having your gigantic-super cocoon and maggot have all the same parts as your Super Fly.
will this update also allow for methamorhposis, like a gigantic supper-magot becoming a gigantic-supper cocon, and then a super fly ?
I guess so... :D
From earlier Toady posts and the dev log, I think you can do that, so long as you don't mind having your gigantic-super cocoon and maggot have all the same parts as your Super Fly.
I hardly think that was implied.
Quote from: i are not good with compuI'm hoping we'll be able to define phases of development (i.e. [Child] of creature has its own tokens, and at [Age] it becomes [Adolescent] and its tokens change).
Not yet -- I didn't want to deal with wound/inventory transfers yet for completely different bodies, but I'm hoping to get there in some future release.
I've embarked on a terrifying ocean with NO actual sea life there aside from vermin. I'd like for at least one zombie whale to show up!
Appearance modifier change rates are also done, so unit hair/nails can grow, or you could have your borgle's borgle grow thicker from age 10 years to age 15 years (it still can't be borgly to any degree).
Borgly had BETTER be a hardcoded adjective >:(
I wonder, will we also be able to use more abstract adjectives for a borgle's borgle ?
like making it a very borgly borgle ? Will it be able to get borglier over time ?
I wonder, will we also be able to use more abstract adjectives for a borgle's borgle ?
like making it a very borgly borgle ? Will it be able to get borglier over time ?
Yey, finally I can start working on more interesting creatures. Also looking forward to the enhanced versions of the existing mods.
Here's to hoping you can make creatures bleed liquid fire. Constantly. Out of their pores.
So, er... does it mean we can make fire scorpions that inject magma into you?
Fixed.
"I felt a great disturbance in the borgle, as if a million borgles screamed out in borgle and were suddenlysilencedBorgled."
"I borgled a borgly borgle in the borgle, as if a billion borgles borlged out in borgle and were borgly borgled."
Off the subject of Borgles...I agree! I must flood human towns with magma and have their homes be destroyed and obliterated!
Toady, do the material changes mean that constructed items will now properly respond to the heat of Magma? No more wooden magma channels and whatnot? Or is that still not something the game checks for?
http://starwars.wikia.com/wiki/Borgle_bat, oddly enough.
[/quote
Lol! :)
ASAULT:ACCEPTABLE
KILL_ENTITY_MEMBER:ACCEPTABLE
SLAVERY:UNTHINKABLE
Off the subject of Borgles...I understand there are two problems with magma and heat: (1) how to avoid the ridiculous outcome of having the magma pipe melt through everything, since the obsidian it's encased in should melt. (2) how to avoid having your dwarves catch on fire automatically every time they try to use a magma forge.
Toady, do the material changes mean that constructed items will now properly respond to the heat of Magma? No more wooden magma channels and whatnot? Or is that still not something the game checks for?
I understand there are two problems with magma and heat: (1) how to avoid the ridiculous outcome of having the magma pipe melt through everything, since the obsidian it's encased in should melt. (2) how to avoid having your dwarves catch on fire automatically every time they try to use a magma forge.
"It's Ove-A condiment, actually.
-What kind of name is Vegeta? What is that, some kind of vegetable juice drink?
keep in mind that walls reacting to magma properly would also mean that all stone except for bauxite would melt when in contact with magma
imagine the bugs, when entire maps completely melt on embark
"It's Ove-A condiment, actually.
-What kind of name is Vegeta? What is that, some kind of vegetable juice drink?
http://en.wikipedia.org/wiki/Vegeta_(food)
You live in Hungry Tormy? Hmm the more you know
How the heck did this conversation go towards Vegeta?
Well Borgyls have officially crossed the line into the territory of annoying, where Chuck Noris and Family Guy jokes live.What about a Chuck Norris joke that was originally used in Family Guy?
Well Borgyls have officially crossed the line into the territory of annoying, where Chuck Noris and Family Guy jokes live.
I know how to get this back on target.
Do undead fish float through the air swimming normally when they leave the water (which seems to be the RPG norm) or do they flop around menacingly like logic dictates?
Discuss.
Sharks have skeletons composed entirely of cartilage. What does a skeletal shark look like, and how does it stay rigid with no tissue?
Now my smurf mod will include a poison attack that injects blue dye into the victims.
Imagine Tribble's reaction to that.I CAN'T HEAR YOU OVER ME PAINTING ELEPHANTS GREEN! STEALTH ELEPHANTS!
Harmless? You obviously have nevr seen a swarm of a hundred smurfs descending upon a happless goblin siege, they bite hard!!! Green gobbos turn blue then breed with smurfs to create a super race that will take over the world!
I guess I could just go to the post office when it opens in 45 minutes.
My question; Will just about everything become materials? Dwarfs will the made out of muscle and bone and whatnot, but will objects be able to be made out of "dwarf" material?
Someone allay my fears.
My question; Will just about everything become materials? Dwarfs will the made out of muscle and bone and whatnot, but will objects be able to be made out of "dwarf" material?
Yes, the dev log mentioned that you can make things out of dwarf lung material, including other creatures like a "dwarf lung man."
It might depend on how butchering will be handled,
Speaking of which. Toady, PLEEESE add value tags for ALL materials and items! If you can't bother to do all items, do it for the weapons at least! Making new weapons balanced is such a PITA without the ability to alter their prices...
It might depend on how butchering will be handled,
Yeah, it all depends on this. Presumably he'll at least be doing basic things like making the size of the fat stack reflect the size of the creature's fat layer, and the meat stack reflect muscle tissue. What I'm really hoping for is that any tissue can specify its own butchering returns, which would enable organ meats and stuff like a Plump Helmet Man that actually returns plump helmet when butchered.
I think it would be interesting if every plump helmet spawn had a small chance to grow into a vicious Plump Helmet Man. Or if that only happened in certain special highly magical areas.
Question for Toady: Will the new soldier changes let us stop a soldier from what they're doing? Or at least let us change their priorities mid-combat?
now that all objects have a proper size, will throwing damage be fixed ?
Now that creatures can have non-standard materials for their parts will this allow dual purpose for them?
For example will a being with a skeleton made of Iron be capable of making both rather strong Bone armor and be capable of having its bones melted down into Iron?
...
If someone's skin was made out of Jewels, could you cut it into gems or turn it into extravegant leather?
My question; Will just about everything become materials? Dwarfs will the made out of muscle and bone and whatnot, but will objects be able to be made out of "dwarf" material?
Speaking of which. Toady, PLEEESE add value tags for ALL materials and items! If you can't bother to do all items, do it for the weapons at least! Making new weapons balanced is such a PITA without the ability to alter their prices...
I'd prefer entity-specific value modifiers for materials (http://www.bay12games.com/forum/index.php?topic=26505) and items.
So does this mean a sweet pod syrup dwarf would be cooked upon death or buried or buried then exhumed and cooked?
dev log form 12/03/2008
Now we are at the last 9 elements of the slow patch, which is really just a pile of small changes that were originally in 9 categories but have become something more loose than that. I'll decrease the countdown as I clear the list in ninths, rather than instituting a sub-countdown of 556 which is a larger looking number
(highlighting from heph)
There is still some reliance on item type in the jobs -- so a jeweler is looking for a rough "boulder" type item for gem cutting. In the same way, the leather working could make the skin into an extravagant leather, even though tanning shouldn't really work at all. You'll be able to melt down any "metal" class object, which would include the bones of a creature that happen to be metal. The boneworker will be able to work them (again relying on the "bones" item type), even though that's a bit weird given that the material isn't actually bone. It's all a work in progress as usual. I imagine in the future (way after this release), it'll treat some of these scenarios more rationally, but in general, yeah, you'll be able to do more things than before.
So does this mean a sweet pod syrup dwarf would be cooked upon death or buried or buried then exhumed and cooked?
The boneworker will be able to work them (again relying on the "bones" item type), even though that's a bit weird given that the material isn't actually bone.
There's the question then. WHICH dwarf material? Because if I understand right, you can make a creature with bones made of dwarf BONE material (dwarf bones), or dwarf EYE material, or dwarf BRAIN material, and so forth. If by "dwarf material" you mean dwarf MEAT, then it will just as well be possible.
I really don't understand your second "monstrosity with bones and muscle of the creature's own material". If you make a creature with bones that copy dwarf bones, then another creature with the bones of that creature would still be the same dwarf-material bones. That's how referencing should work, in any case.
edit: unless of course referencing the creature materials will just copy the properties, and leave the reference alone. Then you will only be able to make a creature with bones that have the same properties as dwarf bones, and then another creature with the same properties of bones, but in every case the name of the bone material would match that of the creature.
Mind you it would be a bone made of metal, not a hunk of solid metal in the general shape of a bone. Anything organic has lots of pockets of emptiness to decrease the weight and need for that material while keeping the strength. It is not beyond me to think of a carver shaving off bits of metal if it is like a sponge. A really fine sponge, but a sponge nonetheless.
Here is my question:
Now that creatures can have non-standard materials for their parts will this allow dual purpose for them?
For example will a being with a skeleton made of Iron be capable of making both rather strong Bone armor and be capable of having its bones melted down into Iron?
Or for something less "Melt it down"ish. If someone's skin was made out of Jewels, could you cut it into gems or turn it into extravegant leather?
Basically stuff along those lines I am aware that there is also a chance that certain combos could do nothing (For example a Tiger with Ruby eyes may not give material for rubies upon cutting it up just by virtue of having ruby eyes alone)
It'll let you do some weird things now, like farm plants that can be processed into weavable metal threadDoes this mean that you'll put in some changes so that things like "weave metal thread" don't automatically assume adamantine? That's the main reason I haven't put in any new metal cloth into my mod, the fact that it's a pain to tell what metal it's talking about.
Uh, noooo.....
My original example specifically called for the bone material to be made out of dwarfs. THAT is the material to be used. Dwarfs.
And in my second example I was more referring to say, a Borgle, who had bones made out of the Borgle material.
Which if absolutely everything was taken into account would probably make the game crash.
Thanks for the answers.We'll be able to have ironwood trees, and iron wood trees. ;D
Now, a new question based on today's dev notes.QuoteIt'll let you do some weird things now, like farm plants that can be processed into weavable metal threadDoes this mean that you'll put in some changes so that things like "weave metal thread" don't automatically assume adamantine? That's the main reason I haven't put in any new metal cloth into my mod, the fact that it's a pain to tell what metal it's talking about.
i think he meant live dwarfs. not any PART fo a dwarf, the whole thing.Uh, noooo.....
My original example specifically called for the bone material to be made out of dwarfs. THAT is the material to be used. Dwarfs.
And in my second example I was more referring to say, a Borgle, who had bones made out of the Borgle material.
Which if absolutely everything was taken into account would probably make the game crash.
There is no one "dwarfmaterial" -- it's meaningless to say "something made out of dwarves." Same for "borgle material," unless you specifically design a unique material which is used for all of the borgle's tissue layers. So if you have a single borgle material, you already have to make their bones out of borgle material by definition. The recursive aspect you're looking for doesn't make sense.
It seems like there's a need for a difference between 'bone' in the sense of a internal skeletal structure for a material and 'bone' in the sense of calcium based animal product used for decoration and crafting.Why?
It seems like there's a need for a difference between 'bone' in the sense of a internal skeletal structure for a material and 'bone' in the sense of calcium based animal product used for decoration and crafting.
wouldn't a borgles bones be made of borgle-bone material, and not just borgle material ?
just like a borgles borgle is made out of bogle borgle material, and not just borgle material
This all depends on the question that I asked, which is if creatures get their own material simply by existing.
A... ghrm. We don't really know how that system will work, but logic dictates that every creature will start out with default materials for flesh, bones, and all applicable tissues. If your question is of the "what if I call a material belonging to the creature from another material belonging to the same creature" variety, then my answer would be that you will get a default material if the material in question has not been initialized yet, or the actual material used for the creature if that material was already defined by that point. It would be an obvious loophole to plug, and Toady would probably think of that.
I presume the actual question you were trying to ask is "what would happen if I wanted to make a borgle, with bones made of borgle's borgle". The answer is: depends on whether the borgle's borgle is initialized before or after the borgle's bones; in one case you get a default material with average properties and a default name, in the other you get the borgle's borgle.
A... ghrm. We don't really know how that system will work, but logic dictates that every creature will start out with default materials for flesh, bones, and all applicable tissues. If your question is of the "what if I call a material belonging to the creature from another material belonging to the same creature" variety, then my answer would be that you will get a default material if the material in question has not been initialized yet, or the actual material used for the creature if that material was already defined by that point. It would be an obvious loophole to plug, and Toady would probably think of that.
I presume the actual question you were trying to ask is "what would happen if I wanted to make a borgle, with bones made of borgle's borgle". The answer is: depends on whether the borgle's borgle is initialized before or after the borgle's bones; in one case you get a default material with average properties and a default name, in the other you get the borgle's borgle.
Mind you it would be a bone made of metal, not a hunk of solid metal in the general shape of a bone. Anything organic has lots of pockets of emptiness to decrease the weight and need for that material while keeping the strength. It is not beyond me to think of a carver shaving off bits of metal if it is like a sponge. A really fine sponge, but a sponge nonetheless.
Good point. I would really expect Iron bones to provide excellent blood production. (The more you know: Bones provide most of the human bodies blood production)
I guess the carver would saw it open and make the carvings out of the bone marrow huh?
Having bones made of iron isn't such a great idea, really; your blood would cause them to rust. (Assuming your blood uses transports oxygen; although if you are respiring something at least as oxidizing as iron [which some microbes do 'breathe'] you're probably going to have the same problem.) Maybe if instead of blood the monster used hemolymph (like insects), since it isn't used to transport oxygen. The monster wouldn't be able to have very thick skin though (in order to get oxygen from the air to its inner tissues), and it'd still probably need to build membranes between its flesh and its iron bones in order to keep them from rusting out. Calcium and silica are really a lot easier for realistic living creatures to build rigid structures with in the first place. (Which really just means that our iron skeleton monsters had to have been built, forged, and/or cobbled together by MAD SCIENCE.)
About the bone carver: What makes you think the bone marrow of an iron bone is going to be regular bone marrow? It could be made of woven dwarf beards for all we know. Literally, if I understand Toady's material system correctly.
Do you know HOW MANY parameters do current materials have??? Temperatures for the three state transitions, weight, value, damage/block modifiers, plus special parameters. I don't expect anything to be added there except group controls for item creation, because those were mentioned.
Do you know HOW MANY parameters do current materials have??? Temperatures for the three state transitions, weight, value, damage/block modifiers, plus special parameters.
Man, I cannot wait for the new version. Just think, we'll get to actually see how the new raws and body functions work, instead of launching intermittent flamewars over theoretical Schrodinger's Implementations.
I don't think any new parameters are going to be added to materials, at least those pertaining to their physical properties would remain the same. There's no "new material system", there's mostly just "new materials" and probably "new material syntax". Toady mentioned new matglosses, and ways to determine groups of materials so that items can be made of specific ones. I don't think it will be possible to get any new functionality out of materials, but you will be able to get new functionality out of items because of the new material-related tags.
Quote from: Sir Nils OlavWill we be able to determine certain body layers' hardness?
For this release, yeah, you will be able to specify material properties that have combat ramifications for each tissue layer/material of the body parts. I don't think I posted the new material definitions... many of the hardness-type properties don't have use yet and won't for a while, but I did go kind of nuts with it, because I wanted it to last a while. It's a somewhat troubling list. In particular:Quote from: Footkerchief(catchall for tensile, shear, compressive, etc.)
C.. catchall? I probably should have. I was bad again.
Quote from: FootkerchiefI wonder if "send in a chitin tissue to fill the skin role in the exoskeleton plan" means that you actually create the chitin in the creature material list and then send that material. I suppose for things like iron men you would also have to be able to pass materials from outside the creature definition, i.e. iron.
Yeah.
Man, I cannot wait for the new version. Just think, we'll get to actually see how the new raws and body functions work, instead of launching intermittent flamewars over theoretical Schrodinger's Implementations.
Man, I cannot wait for the new version. Just think, we'll get to actually see how the new raws and body functions work, instead of launching intermittent flamewars over theoretical Schrodinger's Implementations.
Man, I cannot wait for the new version. Just think, we'll get to actually see how the new raws and body functions work, instead of launching intermittent flamewars over theoretical Schrodinger's Implementations.
Goodness I just want to see how epic Megabeasts (especially modded ones) will become!
Heck even without the new bodyraws the new stats can lead to some dangerous combinations!
The Butchery doesn't damage animals to death it just kills them.
The Butchery doesn't damage animals to death it just kills them.
I hope that changes. It would be amusing to see incompetent butchers frantically hacking at random spots on an animal while it freaks out and sprays blood everywhere. Of course, that means competent butchers need to be able to strike a good killing blow, which means they have to aim their strikes, which isn't possible yet.
The actual killing isn't really something you want to see a butcher stuff up.
Yeah, I'm super psyched about non-flesh animals. Maybe I'll try my hand at modding. Robot world! Terminator! Probably could mod in the Aliens from the movies, too - acid blood, super strong carapace, etc. It will be sweet.
Vanilla game sounds like it will be improved, too - Bronze Collossi will be intense if you can find them. Nothing to be trifled with.
Also I'm really looking forward to the new stats, and the whole 'if you don't use it you lose it' with stats/skills and such.
Make sure you don't take on a pitchblendeman with a hammer......
I wonder whether dragons will have a fire-breathing organ of some kind, and if so, what skeletal dragons are going to do?
Yeah, I'm super psyched about non-flesh animals. Maybe I'll try my hand at modding. Robot world! Terminator! Probably could mod in the Aliens from the movies, too - acid blood, super strong carapace, etc. It will be sweet.
Vanilla game sounds like it will be improved, too - Bronze Collossi will be intense if you can find them. Nothing to be trifled with.
Also I'm really looking forward to the new stats, and the whole 'if you don't use it you lose it' with stats/skills and such.
You could have a fungusman who drops rare seeds when he dies, or more realistic treants. Fill in those terrifying biomes with maddening creatures like monsters made from blood(ONLY blood).
Loving these updates so far. First thing I'm making is a full-lifecycle Purring Hornet that injects 25000-heat magma-poison into people, making them instantly explode. Mwahaha.
How about creatures that inject blood into their victims? I mean like reverse vampires. Would that attack make you bleed? Would it make you bleed if you don't normally have blood?RUN FOR YOUR LIFE! IT'S THE REVERSE VAMPIRES! They'll inject blood into you until you explode!
Loving these updates so far. First thing I'm making is a full-lifecycle Purring Hornet that injects 25000-heat magma-poison into people, making them instantly explode. Mwahaha.
Full life cycle? Polymorphism isn't going to extend that far this time around. I believe Toady has said (and I've repeated a couple times) that body parts on the same creature won't be able to change that drastically during the life cycle.
Diseases? Will a diseased animal injecting you give you an illness?
Diseases? Will a diseased animal injecting you give you an illness?
cocoon animals might be possible... Can't you drop a living critter as a corpse? (Purring Maggot dies and leaves behind a 'child' Hornet that grows up quickly)Loving these updates so far. First thing I'm making is a full-lifecycle Purring Hornet that injects 25000-heat magma-poison into people, making them instantly explode. Mwahaha.
Full life cycle? Polymorphism isn't going to extend that far this time around. I believe Toady has said (and I've repeated a couple times) that body parts on the same creature won't be able to change that drastically during the life cycle.
vermin barrel gnawing and cage escape
vermin barrel gnawing and cage escape
Bronze Collosus escaping (much carnage ensues) while player is distracted by firesnake induced explosions of booze: check
Lovin dis.
EDIT: A good reason to make metal barrels
It'll be nice to finally be able to run the game again
Or earlier than that... the wind part of the presnowstorm windstorm is causing my power to go out... not sure I'll be able to work today.
Quick! Everybody E-mail Toady One some electricity!We shall mail the electricity, and he can keep the envelopes for when his power goes out again!
Oh, that won't work.
The wind would take out the internet lines too...
Hey, let's pool some money and buy him one of those mini nuclear reactors!
If the wind's that strong outside, go stick a fan out the window and plug yer comp into it! :P
Unless you have some transformers.If the wind's that strong outside, go stick a fan out the window and plug yer comp into it! :P
What is this? The Movie "The Core"?
Fans don't have the ability to transform the kenetic energy of the wind into that usable by computers.
If the wind's that strong outside, go stick a fan out the window and plug yer comp into it! :P
What is this? The Movie "The Core"?
Fans don't have the ability to transform the kenetic energy of the wind into that usable by computers.
If the wind's that strong outside, go stick a fan out the window and plug yer comp into it! :P
What is this? The Movie "The Core"?
Fans don't have the ability to transform the kenetic energy of the wind into that usable by computers.
I live out in the middle of nowhere and usually the only thing that takes out power is:Water glue?
A) Car accidents
B) Branches from trees being knocked down by snow/wind onto power lines, causing fires.
C) Maintenance.
Also, freezing rain only happens a few times a year here, we still function. So whats an inch of snow? At least salt will melt that, gets to cold for salt here. Man it must suck to live in mild and tropic areas, having a heart attack every time you see water-glue.
Edit: I should clarify that while freezing rain isn't that common for my area, snow melting/rain falling then re-freezing on the ground isn't.
Damn that water glue.
Water glue?Ice, it likes to hold things together when it's first applied in its liquid state.
Meh, this mild area isn't paying off, too hot in the summer, not enough insulating clouds in the winter to keep it mild.
Freezing rain is very beautiful! I love what it does to the trees! I don't like however what it does to the roads.Well, maybe not in Ontario where they get ice storms big enough to knock down 60 year old elms and oaks.
Hey, another Ontarioite here (in Ottawa).
Freezing rain sucks majorly. A little bit isn't too bad, but wait until you get 3 straight days of it and all your trees and powerlines come a-tumbling down.
Sometimes our power lines get knocked out by AIDS.
Yeah, I'm super psyched about non-flesh animals. Maybe I'll try my hand at modding. Robot world! Terminator! Probably could mod in the Aliens from the movies, too - acid blood, super strong carapace, etc. It will be sweet.
Vanilla game sounds like it will be improved, too - Bronze Collossi will be intense if you can find them. Nothing to be trifled with.
Also I'm really looking forward to the new stats, and the whole 'if you don't use it you lose it' with stats/skills and such.
You could have a fungusman who drops rare seeds when he dies, or more realistic treants. Fill in those terrifying biomes with maddening creatures like monsters made from blood(ONLY blood).
A blood-only creature would probably just melt to death, unfortunately.
Surprisingly common where I live. Amazing things can happen with one in 17 have the damned thing.Sometimes our power lines get knocked out by AIDS.
Wow, I am surprised that they caught an immuno-deficiancy disease
Surprisingly common where I live. Amazing things can happen with one in 17 have the damned thing.Sometimes our power lines get knocked out by AIDS.
Wow, I am surprised that they caught an immuno-deficiancy disease
But technically that would be a computer virus that targets antiviral software on the government power management computers.
And ontopic: "...some of those ice/water problems should be handled."
What does this entitle, exactly? Specifying water to be used in reactions? Ice in reactions? We can use buckets in reactions now? Can we fill specific containers with reactions? Do reactions care for things inside containers now?
ANSWER THE DUKE-O-TRON NOW AND RECEIVE A PRIZE!
Currently it is impossible. Which is why the development of a fix for that would be grand.
Perhaps my failure to understand a joke has to deal with my lack of Iron-E in my diet.
Luckly I can just carve some out of your statement it is so thick! :D
Note: The general tone of my statement is friendly.
Is it really SUCH bad problem in America? o_O
You know, we have "russian winters" and nice storms and other crap but I haven't got a single problem with an electricity for 5 or 6 years already... I was almost sure that people in America have more stable systems. Sadly that I was wrong and there're areas with such troubles (well, the nature is fierce). I hope you'll be fine, Tarn.
8 left of what I'm doing now, 250 worth of wounds and health care concerns, 29 on descriptions and some skill/att stuff, 65 on venom, 165 for map features, 260 for entity positions, 195 for squads, and 75 for random crap and tests.
Quote from: Toady on Dev_now8 left of what I'm doing now, 250 worth of wounds and health care concerns, 29 on descriptions and some skill/att stuff, 65 on venom, 165 for map features, 260 for entity positions, 195 for squads, and 75 for random crap and tests.
What are these "Map features" ?
Ice blocks, yes. Buckets of water, no. Buckets of ice, no.
Currently it is impossible. Which is why the development of a fix for that would be grand.
http://www.bay12games.com/forum/index.php?topic=18742.msg184960#msg184960
http://www.bay12games.com/forum/index.php?topic=20389.msg217645#msg217645
begs to differ, but I have no experience, haven't ever went onto a glacier yet
1039. Fixed up a problem with fish stockpiles, god form selection for flying ones, creature placement in hostile environments vs. caste, caste litter sizes, some skill availability stuff, updated safe temperature stuff, placed totem flags on bodyparts so it knows which ones can make totems.
It was wondering that too... manifestations/incarnations of deities? That's what it sounds like, but holy crap.
It would be interesting if we had gods and spirits who built their own bodies to suit their particular deific style out of parts of other creatures. That way we could get some really weird Old testament angel/ chimeric/ lovecraftian gods who decided that what he really needed was 100 wings and 100 eyes to watch and go anywhere. Just wait until the more prolific ones start having kids, things man was not to know getting to know us too well?
If you don't mind me asking, Toady, where in NH did you live? I'm from the Conway area.
If you don't mind me asking, Toady, where in NH did you live? I'm from the Conway area.
Holy crap, Toady's in NH? That's both cool and terrible - cool, because I live in NH, and terrible, because that ice storm was fairly devastating to southern NH. I myself am without power and won't be getting it back until mid-week or later.
On the plus side, I did get awesome photos like this:Spoiler (click to show/hide)
I hope Toady's safe, warm and has electricity...
Whoa what the hell? No power for 3-4 days? How the hell is that possible? :o
The photo is pretty awesome btw. 8)
Whoa what the hell? No power for 3-4 days? How the hell is that possible? :o
The photo is pretty awesome btw. 8)
some cleaning of the poisoning code and the addition of materials to the injection special attack, so the material for venoms can now be specified properly (which is required for any future poison effects)
As for today's dev notes, I'm really looking forward to the next few days.
I should be able to release the tentative raw format at some point while I'm doing this.
Oh, goody! Here comes the wounds! I'm looking forward to seeing what Toady says when he gets the 'wound test arena' up and running.
Aw crap, carp will most likely end up as weaklings in the upcoming version. Toady, please keep the rivers deadly.
If arrows of SPECIFIC material become viable... Magical 10000-degree arrows, anyone? <Twang!>+<thunk!>+<pshhhhh...>=Puddle of molten bronze.
Ok then, for those you can have frost bolts. With temperatures of up to (or down to?) -10000 degrees Fahrenheit. You know, sometimes I think it is good DF doesn't model air. One shot of such an arrow would leave a trail of solid air. Nice way of building walls, btw.
I for one would like the Arena of Armok to become an official part of the game. You could select a creature from legends or something from the raws and control it in combat against a selected enemy group. You could even create two opposing AI groups or watch a battle from history.
Or, have an arena mode with Fortress Mode controls.
I was just, you know, hoping for something to make sure the creatures I make can actually stand up. (When religion first came into being in DF, a couple of my custom powers couldn't... Testing was fairly problematic)I for one would like the Arena of Armok to become an official part of the game. You could select a creature from legends or something from the raws and control it in combat against a selected enemy group. You could even create two opposing AI groups or watch a battle from history.
Or, have an arena mode with Fortress Mode controls.
If this actually was an arena... hmmm
Winner of these arenas could get the ability to become part of the real world with tons of gold and land!
Losers of course stay dead!
It's funny. Fargo got 10 inches of snow today. With LOTS of wind. school is lready canceled (about 18 hours in advance) and they NEVER cancel school here. I love when life an DF cross.
Urist was born with a third nose on his armpit.
Not sure if this is the place to discuss it, but.....
"Defining the arrangement of the dwarf's facial features and picking out names and positions"
From Today's update.
Are we going to be able to see subtle differences between the dwarves? How will we know what they look like?
Not sure if this is the place to discuss it, but.....
"Defining the arrangement of the dwarf's facial features and picking out names and positions"
From Today's update.
Are we going to be able to see subtle differences between the dwarves? How will we know what they look like?
Urist was born with a third nose on his armpit....where was his second nose?
Urist was born with a third nose on his armpit....where was his second nose?
Anyone else plan on modding in Potato Men?
Anyone else plan on modding in Potato Men?
Surely you mean Bloated Tuber Men?
I've actually half-seriously planned a dwarf portrait program that gives a fancy 2d-art pictures of your dwarves (and perhaps even human/elf/goblin merchants/diplomats/soldiers...) with size differences, hair/beard color/lenght, scars, clothing, weapon etc. Doesn't actually sound that hard but needs awfully lot of drawings (3d would be more flexible but is hard to make good looking). Another problem is to get the data from the game, but there's already programs that do it with map features so why not?
Might be funny to see those blood/vomit covered naked one-legged war veterans.
I've actually half-seriously planned a dwarf portrait program that gives a fancy 2d-art pictures of your dwarves (and perhaps even human/elf/goblin merchants/diplomats/soldiers...) with size differences, hair/beard color/lenght, scars, clothing, weapon etc. Doesn't actually sound that hard but needs awfully lot of drawings (3d would be more flexible but is hard to make good looking). Another problem is to get the data from the game, but there's already programs that do it with map features so why not?
Might be funny to see those blood/vomit covered naked one-legged war veterans.
Actually, is there any way to mod molten goblins in to the current version?Ya, we have this grate over the dining room to let in sunlight.
The boiling bronze equipment is the exact same problem that causes incompletely modded creatures to have boiling leather: default phase change points set to zero, which is far, far below anyatmospherictemperature.
Toady really should include some form of verification for invalid temperature data instead of just having the object instantly explode.
Would be good entertainment to have adult cats explode immediately. Embark with 150 kittens, leave them to adopt an owner and try to make a fortress that survives before armageddon.Toady really should include some form of verification for invalid temperature data instead of just having the object instantly explode.
That is a verification.
*Boom*
"Oh, the temperature must be off."
Would be good entertainment to have adult cats explode immediately. Embark with 150 kittens, leave them to adopt an owner and try to make a fortress that survives before armageddon.This is the new challenge, people!
Time trial mode.
I think your somewhat assuming that Dwarf Fortress temperatures are as linear as real life temperatures
With the new tissue system, you can edit adult cats to be made entirely out of wood and alcohol. Maybe magma too, who knows.
I'm sure we will eventually. Maybe the new evil biomes will be evil due to some big monster, or an artifact, and you'll have to kill the monster or take the artifact to a volcano and destroy it to cleanse the area. Your deity would assign quests like this for areas with opposing nature(A god of life and health would send you to cleanse an area based on pestilence, for example).
Actually, that's pretty cool. I should quote this to the Future of the Fortress.
Not related to exploding cats(Which totally rule), but I had an idea. Quoted from the thread about how Gods don't answer you.QuoteI'm sure we will eventually. Maybe the new evil biomes will be evil due to some big monster, or an artifact, and you'll have to kill the monster or take the artifact to a volcano and destroy it to cleanse the area. Your deity would assign quests like this for areas with opposing nature(A god of life and health would send you to cleanse an area based on pestilence, for example).
Actually, that's pretty cool. I should quote this to the Future of the Fortress.
The venom in the current version are already added to the creature and remain there for whatever the duration is, but it doesn't check temps on them. I'm hoping to do that this time around so that fire snakes can be proper and the "liquid fire" extract can be more wholesomely amusing when dwarves are bitten.
...
In what sense? Goblins that immediately melt into a pool and die, or goblins that remain molten and walk around? In any case, temperature-related wounds are coming up at some point here, so it'll sort itself out. I'd prefer if both cases are possible, but the latter is the more important one (for magma men).
Derailing from body designations a bit, who's excited about entity pets? If this is the controlling code for goblins with trolls and/or selective pack animals, some interesting combinations could occur. Spider-riders, anyone?
Erm...Where did you read this? You mean that we will be able to specify various entities and "give those" to specific races? Like you mod in a war troll for the goblins, and the gobbos will use those in their armies? This is what you meant? It would be awesome to have something like that, but I don't see this information anywhere..
12/08/2008: 1043. Entity pets, embark pets, dye flags, mill jobs, extract/farmer's workshop jobs, and some other things with plants. It'll let you do some weird things now, like farm plants that can be processed into weavable metal thread, though the categories of items for the jobs are still the same (thread/powder/liquid/seeds). For those watching the sub-countdown on these last 9 to the 1039 milestone, it's 243/556, so everything is still on schedule in that sense (about 60 a day).
No, but really, there will be whole new universes of fun to be had. I'll be greatly enthused to create my cactus-people with the body characteristics of a hollow gourd.
Derailing from body designations a bit, who's excited about entity pets? If this is the controlling code for goblins with trolls and/or selective pack animals, some interesting combinations could occur. Spider-riders, anyone?
Erm...Where did you read this? You mean that we will be able to specify various entities and "give those" to specific races? Like you mod in a war troll for the goblins, and the gobbos will use those in their armies? This is what you meant? It would be awesome to have something like that, but I don't see this information anywhere..
Derailing from body designations a bit, who's excited about entity pets? If this is the controlling code for goblins with trolls and/or selective pack animals, some interesting combinations could occur. Spider-riders, anyone?
Erm...Where did you read this? You mean that we will be able to specify various entities and "give those" to specific races? Like you mod in a war troll for the goblins, and the gobbos will use those in their armies? This is what you meant? It would be awesome to have something like that, but I don't see this information anywhere..
I think the misunderstanding is what exactly what an "entity" is. An entity is a civ. This is different from a unit, which is a creature. You can't set a member of an entity as a pet, but you can say that a specific entity will have specific pets.
I think your somewhat assuming that Dwarf Fortress temperatures are as linear as real life temperatures
They are. 1 degree Urist = 1 degree Farenheit.
Also I think an entity is something the game recognises as an actor.
I'd rather see (war) abstracted out into the caste system for animals.
Oh, and domesticable animals picking their own civs.
Oh, and domesticable animals picking their own civs.
What exactly do you mean by that? Do you want civs to have a list of possible domestic animals but only use some of them, they way clothing is now? Or are you thinking of something else?
...next to the wagon with the equipment that immediately explodes into clouds of boiling bronze while the dwarves flash between the dwarf and bar symbol wearing no-material clothes...
I fixed all the bugs I mentioned from last time.
Also, joules are a unit of energy, not temperature -- DF takes specific heat into account so they aren't the same
Derailing from body designations a bit, who's excited about entity pets? If this is the controlling code for goblins with trolls and/or selective pack animals, some interesting combinations could occur. Spider-riders, anyone?
Erm...Where did you read this? You mean that we will be able to specify various entities and "give those" to specific races? Like you mod in a war troll for the goblins, and the gobbos will use those in their armies? This is what you meant? It would be awesome to have something like that, but I don't see this information anywhere..
I think the misunderstanding is what exactly what an "entity" is. An entity is a civ. This is different from a unit, which is a creature. You can't set a member of an entity as a pet, but you can say that a specific entity will have specific pets.
Derailing from body designations a bit, who's excited about entity pets? If this is the controlling code for goblins with trolls and/or selective pack animals, some interesting combinations could occur. Spider-riders, anyone?
Erm...Where did you read this? You mean that we will be able to specify various entities and "give those" to specific races? Like you mod in a war troll for the goblins, and the gobbos will use those in their armies? This is what you meant? It would be awesome to have something like that, but I don't see this information anywhere..
I think the misunderstanding is what exactly what an "entity" is. An entity is a civ. This is different from a unit, which is a creature. You can't set a member of an entity as a pet, but you can say that a specific entity will have specific pets.
Yes, this is what I inferred from Toady's notes; hence my enthusiasm to see its implementation. And if it DOES control the use of war animals, there's worlds of hurt to be explored... goblins with dragons, anyone?
The 15th:Quote...next to the wagon with the equipment that immediately explodes into clouds of boiling bronze while the dwarves flash between the dwarf and bar symbol wearing no-material clothes...
The very next day:QuoteI fixed all the bugs I mentioned from last time.
Toady either has nothing else to do or else he is a coding god.
QuoteAlso, joules are a unit of energy, not temperature -- DF takes specific heat into account so they aren't the same
Joules can be used as a measurement of temperature... but I guess I mixed up and meant Kevlin where 0 is absolute 0
Ugh where did my spelling go... Kalvin? hmm I guess I don't know the spelling... but you know what I mean
A question about descriptions: Will clothing prevent adventurers from seeing information about appearances? Say, if a goblin is wearing a mask, will it say, "the goblin has brown, bloodshot eyes, and pointed teeth." Instead of "the goblin has brown, bloodshot eyes, a long, hooked nose, a scar on the left cheek, and pointed teeth."
This would be important, for instance, if someone had a cultist's tattoo hidden under robes.
He also has a very fickle fanbase who actually gives him less money if his updates are not all that exciting... Of a difference of hundreds of dollars!!!
Toady is surprisingly honest compared that lying his butt off would ensure he gets more money each month... I hope I didn't give him any ideas.
Another question to toady
Will size take into account the relative size of the opponent.
For example it is unlikely that a Hamster will be able to hit the back of a dragon from the ground... but something even larger (or rather taller) then the dragon would find it harder to hit lets say its belly
QuoteAlso, joules are a unit of energy, not temperature -- DF takes specific heat into account so they aren't the same
Joules can be used as a measurement of temperature... but I guess I mixed up and meant Kevlin where 0 is absolute 0
Ugh where did my spelling go... Kalvin? hmm I guess I don't know the spelling... but you know what I mean
Also, I see the token to define how quickly a dwarf grows, but not one that defines how quickly individual bodyparts grow. Am I just missing something?
Oh, and what's the plan for determining to which caste a child belongs when it's born?
So right now dwarves have the same probability to have brown eyes or some strange colours like orange?
I wonder if we can have ages of maturity be caste-specific. Also, is it possible to specify a caste without the capacity to procreate? It would be vital for a bee-like drone/queen/male structure.
I know these aren't the final raws, but when those final raws exist, we'll need a definitive list of which tokens are caste-specific and which ones are not.
if a dwarf likes dwarves with a specific eye color more, wouldn't a dwarv that likes the color of livers like, well...everything that has a liver ?
Oh, and what's the plan for determining to which caste a child belongs when it's born?
Hmmm...on the subject of how detailed to get the descriptions, maybe have a general overview one on screen, and have another screen you can go to from that one with full descriptive details?
1) Are you going to expand out the maximum number of reactions we can mod in?
2) Are you going to modify the alloy reactions to make them more in line with real life in some way? For example, bronze is actually 10% tin and 90% copper.
The uncertain holiday plans I mentioned last time have been cancelled due to snow-related unsafe driving conditions. I'll probably be working straight through the 23rd.Too bad, man. I'm getting the same storm system and not one flake of snow.
[CASTE:FEMALE]
The gender tag lets it know how breeding works.
[FEMALE]
[MULTIPLE_LITTER_RARE]
To add beards, put square brackets around the following:
BODY_DETAIL_PLAN:FACIAL_HAIR_TISSUE_LAYERS
[CASTE:MALE]
[MALE]
[BODY_DETAIL_PLAN:FACIAL_HAIR_TISSUE_LAYERS]1) Are you going to expand out the maximum number of reactions we can mod in?
What's limiting it now? Something about screen real estate? I'm not sure what you are referring to.
2) Are you going to modify the alloy reactions to make them more in line with real life in some way? For example, bronze is actually 10% tin and 90% copper.
This is the new format for making specific unit names for a creature. Any unit token can be used.
[PROFESSION_NAME:MINER:Digger:Diggers]
On a side note, one could make a third gender that is [FEMALE] but has a littersize tag, so that some dwarven women have few children, while others produce hordes.Catholic Dwarves....
Damn. I disagree with Granite26 on a lot. I think what is considered attractive should vary from culture to culture (which has some support in Power Goals as well - see "magical idiot peeper"). And I love the dwarven warriors carrying their babies into battle. I think male dwarves should do it too.
and you'll find that what has been considered beautiful has varied greatly between different cultures and ages.
and you'll find that what has been considered beautiful has varied greatly between different cultures and ages.
... It's not actual text(so I can't copy it here), but the first link I posted (cause I tend to do my research before talking) shows that against common misperception, previous eras' conceptions of beauty do conform remarkably well to our own. (This is especially true if when you accept that most people don't consider stick figures to be the height of beauty, but that IS my own opinion).
Sorry if I'm getting cranky and argumentative...
and you'll find that what has been considered beautiful has varied greatly between different cultures and ages.
... It's not actual text(so I can't copy it here), but the first link I posted (cause I tend to do my research before talking) shows that against common misperception, previous eras' conceptions of beauty do conform remarkably well to our own. (This is especially true if when you accept that most people don't consider stick figures to be the height of beauty, but that IS my own opinion).
Sorry if I'm getting cranky and argumentative...
Granite -- keep in mind that we're talking about a system for defining standards of beauty that could be applied to any creature, and the preference of extremes over averages certainly does occur in nature (peacock feathers, bright plumage, etc.).
Cultures vs. biology is important too. Perhaps each species could have its own sweet spot for each appearance "slider" (i.e. an optimal value somewhere between the min and max), maybe on a per-caste basis, while each culture could bias those standards to an arbitrary degree. So you'd have your average-loving humans if you wanted them, but you could also have all goblins having a thing for really pointy noses, except for one perverse goblin civ that likes pointy ears instead.
What is the difference in function between STANDARD_TISSUE and STANDARD_MATERIAL? Looking at the raws it looks like they perform the exact same function.
And shouldn't layering be automatic? What is the point of having muscle over skin? Although I like that Toady is trying to keep this game as loose as possible.
How will the scars modify the combat text?
Will it be more detailed or the scars will only be visible in the descriptions?
Or, are bodies still represented as trees in structure, but there's now a second sort of ephemeral connection between them using that AROUND:BY stuff? Kind of like "fuzzy" edges that don't supply any connection with the center?
QuoteAlso, is AROUND:BY symmetric?QuoteI have noticed that while there is some vague positioning in the head area (further resolution of detail would be nice, but it's not necessary for this particular update), but what is lacking is positioning of organs that we had so looked forward to.
Well, right now you can only add in 15 new reactions before it starts ignoring stuff at the top of the list.
Since I'm still thinking about metals, is there any plan to expand out the METAL_PREF tag in entities a bit more?
Dev_Next is probably the best summary we can give right now.
what happens when they wage war against a civ of magma-men ?
QuoteDoes this mean we can rename any of the professions?QuoteJob tags by gender. AKA no more valkeries with babe in arms.QuoteJob tags by caste: How will the fort handle this? A different jobs list depending on the dwarf?
Gender ratios: What's the gradation on these? for creatures with 2 sexes, a difference of as much as 1% can cause huge effects on the population balance
How much does this (skin thickness) actually matter in terms of combat? Will there be things that daggers can't cut through?
Surrounds. Right now, the cheeks 100 surround the teeth, but ribs 5 surround the heart. What kind of scale do we have, and is it additive?
Does bludgeoning damage transfer? (AKA is unlikely to do damage to skin or fat but will bruise muscle and break bone)
Looks like it's easy to make creatures grow as they get older. Can we shrink them back down?
Will it be possible to make dragons that get bigger and bigger for all time?
Caste Changes: I think you said this was impossible?
In the tissue raws, is MUSCULAR just to indicate a rippled texture?
How close were you to giving plants actual body definitions?
Should eye and nerve damage hurt more? It's at stock 5 pain now.
But will bp descriptions be visible in adv. mode?
Toady, how hard would it be to add variable stat advantages/disadvantages to creatures much like DAMBLOCK or SPEED?
I'm talking a natural agility/strength/toughness/endurance boost or reduction.
Erm, will those variables in the material raws that Toady says are unused be used further down the update?
Also, how come there is a basic metal material and then a whole metal raws which have considerably more metals in the first place, each using different variables?
Surely Eyebrows and Eyelashes could be incorporated into the standard face definition? Or does it have to do with them being hair, and therefor effected by the color definitions?
QuoteI have a question: What EXACTLY do tags like [ITEMS_HARD] and [ITEMS_BARRED] mean? ... However, [ITEMS_HARD] is in the Bone, Hair, Nail, and Tooth template.QuoteITEMS_HARD tag on Hair was one of the bugfixing things I mentioned. Horse Hair Platemail anyone?
Some phase change temperatures are also set to "NONE". Is this intentional?
All the layer stones seem to be [INORGANIC], but aren't some of them organic, like limestone and a lot of soils?
So, now we have layered skins on body parts. Does this mean that the [INTERNAL] token does a lot more now?
What does the :STP] part of a body part token mean?
What is the difference in function between STANDARD_TISSUE and STANDARD_MATERIAL? Looking at the raws it looks like they perform the exact same function.
And shouldn't layering be automatic? What is the point of having muscle over skin?
Query about the [CATEGORY:WHATEVER] tags in the body file. Is the list of categories hardcoded or will it adapt to whatever I put in there, so long as I adapt the other files to cover it?
For the HUMANOID body, the head has [DEFAULT_RELSIZE:500]
For all other defined bodies, the head is [DEFAULT_RELSIZE:300]
For the Dwarf,
[GENERAL_BABY_NAME:dwarven baby:dwarven babies]
[BABYNAME:dwarven baby:dwarven babies]
[CHILD:12]
[GENERAL_CHILD_NAME:dwarven child:dwarven children]
[CHILDNAME:dwarven baby:dwarven babies]
would seem to need the CHILDNAME to be altered.
I dunno. I've scratched my eye once, but I don't remember it being particularly worse, and I have no idea about various nerve damages. Right now the nervous tissue pain is set at zero, and I was going by the while-awake brain surgery videos I've seen. I dunno if getting your spine cut hurts or if it's like the brain, or if I'm wrong about the brain.
QuoteI dunno. I've scratched my eye once, but I don't remember it being particularly worse, and I have no idea about various nerve damages. Right now the nervous tissue pain is set at zero, and I was going by the while-awake brain surgery videos I've seen. I dunno if getting your spine cut hurts or if it's like the brain, or if I'm wrong about the brain.
Superficial eye damage causes only minor pain, but it can get to very painful or extremely painful if the eye is pierced, and the blood rushing through the wound will cause considerable pain aswell. Nerve damage pain is quite low, which is why nerve wounds are very dangerous, you can't tell if its wounded since there's only a minor pain, if any at all. A broken spine will only hurt well someone tries to get up and moves the bone away from its initial position, but otherwise he/she/it wound't feel it.
A good example is car crash victims: They think they're alright were they currently stand, they'll only feel pain if they move around or try to get up.
In short:
Eye pain: Low if only scratched, or otehrwise lightly damage, high/extreme if pierced/mangled or severely wounded.
Nerve pain: Low, if any at all, regarding spines, brain and related.Spoiler (click to show/hide)
welp, modding's gonna be pretty difficult from now on...
QuoteHow much does this (skin thickness) actually matter in terms of combat? Will there be things that daggers can't cut through?
That's coming up very soon, so I can't say exactly how much. The idea is that a thicker tissue would matter a lot, so a bulbous creature with a large layer of lardy rolls would have a great deal of protection. It'll take some balancing, and I'm not to the point where I've tested it out. In terms of daggers being able to cut in general, it currently uses the shear properties for this, and if the dagger is a harder material it will form some sort of cut (assuming the strike is forceful enough to get beyond the shear fracture point for, say, skin), but on a titan, that should be neglible unless you make a hobby out of it.
Yeah, serious thanks on the answers.
It'll be interesting to see how anything can kill a steel golem actually.
...I can't wait to create hideous abominations that defy biology, like something with blood made of bones.
That's now.So we get men made of things. We get Guts-Man, Ice-Man, Fire-Man, Axe-Man, Alcohol-Man...
But in the upcoming versions where creature strength is determined by the strength of what they are made by...
Maybe a very, very big hammer.
I can't wait to create hideous abominations that defy biology, like something with blood made of bones.
Slime blooded creatures?I can't wait to create hideous abominations that defy biology, like something with blood made of bones.
Creatures with slime blood for me. Or maybe a Sweet Pod Man that bleeds dwarven syrup.
Huh, I just noticed blood is only present in the new raws as a material template... are the "blood types" still hardcoded?
I can't wait to create hideous abominations that defy biology, like something with blood made of bones.
Creatures with slime blood for me. Or maybe a Sweet Pod Man that bleeds dwarven syrup.
Huh, I just noticed blood is only present in the new raws as a material template... are the "blood types" still hardcoded?
Will these creatures have actual creatures for blood? So when you make them bleed// kill them and they bleed out, you have a mass of slimes attack the dwarves?
Huh, I just noticed blood is only present in the new raws as a material template... are the "blood types" still hardcoded?
I've not looked at the new raws yet, but surely, this brings me a step closer to my goal of one day being able to milk and skin the philosopher.Or, as this issue will crop up, milking skin from the philosopher.
QuoteI dunno. I've scratched my eye once, but I don't remember it being particularly worse, and I have no idea about various nerve damages. Right now the nervous tissue pain is set at zero, and I was going by the while-awake brain surgery videos I've seen. I dunno if getting your spine cut hurts or if it's like the brain, or if I'm wrong about the brain.
Superficial eye damage causes only minor pain, but it can get to very painful or extremely painful if the eye is pierced, and the blood rushing through the wound will cause considerable pain aswell. Nerve damage pain is quite low, which is why nerve wounds are very dangerous, you can't tell if its wounded since there's only a minor pain, if any at all. A broken spine will only hurt well someone tries to get up and moves the bone away from its initial position, but otherwise he/she/it wound't feel it.
A good example is car crash victims: They think they're alright were they currently stand, they'll only feel pain if they move around or try to get up.
In short:
Eye pain: Low if only scratched, or otehrwise lightly damage, high/extreme if pierced/mangled or severely wounded.
Nerve pain: Low, if any at all, regarding spines, brain and related.Spoiler (click to show/hide)
QuoteI dunno. I've scratched my eye once, but I don't remember it being particularly worse, and I have no idea about various nerve damages. Right now the nervous tissue pain is set at zero, and I was going by the while-awake brain surgery videos I've seen. I dunno if getting your spine cut hurts or if it's like the brain, or if I'm wrong about the brain.
Superficial eye damage causes only minor pain, but it can get to very painful or extremely painful if the eye is pierced, and the blood rushing through the wound will cause considerable pain aswell. Nerve damage pain is quite low, which is why nerve wounds are very dangerous, you can't tell if its wounded since there's only a minor pain, if any at all. A broken spine will only hurt well someone tries to get up and moves the bone away from its initial position, but otherwise he/she/it wound't feel it.
A good example is car crash victims: They think they're alright were they currently stand, they'll only feel pain if they move around or try to get up.
In short:
Eye pain: Low if only scratched, or otehrwise lightly damage, high/extreme if pierced/mangled or severely wounded.
Nerve pain: Low, if any at all, regarding spines, brain and related.Spoiler (click to show/hide)
Ask some0ne with sciatica how bad their nerve pain is................
Will the sword do nothing, or will it act as a bludgeoning weapon since iron cannot cut steel?
Will eligibility for becoming a noble be able to be restricted on a caste-specific basis?
This might be too much, but separating central and peripheral nervous tissue might make sense, especially for things like pain and regeneration. I believe peripheral nervous system tissue can regenerate much, much more than something like the brain or spine, and certainly would have more pain reception.
Can the tag [BIOME:SUBTERRANEAN_WATER] be used for civs too?
Huh, I just noticed blood is only present in the new raws as a material template... are the "blood types" still hardcoded?
Hmmm... Gaseous blood...
That's the adamantine example there, but I don't know what affects what.
I hope so. I already have the boiling material flow it uses for the molten metals and alcohols, so it shouldn't be too hard. It would be cool to mix it with the poison effects when I get there.Oh yeah, steam-machinery creatures are coming!!
QuoteI dunno. I've scratched my eye once, but I don't remember it being particularly worse, and I have no idea about various nerve damages. Right now the nervous tissue pain is set at zero, and I was going by the while-awake brain surgery videos I've seen. I dunno if getting your spine cut hurts or if it's like the brain, or if I'm wrong about the brain.Superficial eye damage causes only minor pain, but it can get to very painful or extremely painful if the eye is pierced, and the blood rushing through the wound will cause considerable pain aswell. Nerve damage pain is quite low, which is why nerve wounds are very dangerous, you can't tell if its wounded since there's only a minor pain, if any at all. A broken spine will only hurt well someone tries to get up and moves the bone away from its initial position, but otherwise he/she/it wound't feel it.
A good example is car crash victims: They think they're alright were they currently stand, they'll only feel pain if they move around or try to get up.
In short:
Eye pain: Low if only scratched, or otehrwise lightly damage, high/extreme if pierced/mangled or severely wounded.
Nerve pain: Low, if any at all, regarding spines, brain and related.Spoiler (click to show/hide)
Ask some0ne with sciatica how bad their nerve pain is................
Protip: Don't.
In terms of adamantine weapons, the edge and shear properties mean it will be able to slice through steel for example quite easily, even though the low density means that it won't be effective in bludeoning weapons. Normal cutting weapons won't be able to slice through your adamantine armor, but you can still get knocked around.
Hmmm... Gaseous blood...
So no more one-shoting dragons with wooden spears. ;DYou forget about the soft underbelly
Hrm, quick question regarding armor/weapon material types:Depending on the material, most likely physically impossible.
Obviously, from what you've said, it will be difficult to cut through, say, steel with iron. But HOW difficult? I mean, someone with a bronze dagger should probably penetrate steel every now and then, and how hard will it be for someone with, say, an iron axe to penetrate steel chain or plate? I'm kind of wondering how this'll impact gameplay, and whether or not it'll make non-<best material available> equipment non-viable for use.
That's rather oversimplified, though. You can certainly cut a "stronger" material with a "weaker" one. It depends on a lot of things, like sharpness, thickness, how the force is applied, and whatever else.
For instance, here's a rather extreme example to illustrate the point: A 50-pound copper axe blade, sharpened extremely fine, should be able to penetrate a millimeter of good steel. I know that's ridiculous to use as an example, but it's just to show that there are more factors involved than a direct comparison of the materials, and saying "that's impossible!" just because one material is less inherently "strong" than the other.
I hope so. I already have the boiling material flow it uses for the molten metals and alcohols, so it shouldn't be too hard. It would be cool to mix it with the poison effects when I get there. I suppose powder blood should also be allowed now that I have a separate powder state. Then you can be attacked by Time Men that have glass on the outside and sand on the inside, and I can be fired. That might work better with a whole sand tissue layer though.
The yellow ones are the ones he's currently working on. The others will come later.
So we'll get better squad control, and so forth, but we won't be sending troops out on the world map just yet, as far as I know.
Only the yellow bits, squad control and wounds. This is only one of the first releases focused on the Army Arc.Oh, ok.
And your english isn't the best, but far better than many I've seen out in the internet. :)
QuoteHuh, I just noticed blood is only present in the new raws as a material template... are the "blood types" still hardcoded?
I just haven't gotten to bleeding wounds yet, so I haven't defined blood in the raws yet, as I'm not sure what I'll end up with. I was thinking of tracking blood events on the ground with a bit more precision, as there generally aren't a zillion of them and it's currently eating up a ton of map bits, so I'm not sure if the current blood type notion will survive. It'll take some looking at though. Everything about blood should make it out to the raws, though that isn't something I can promise.QuoteHmmm... Gaseous blood...
I hope so. I already have the boiling material flow it uses for the molten metals and alcohols, so it shouldn't be too hard. It would be cool to mix it with the poison effects when I get there. I suppose powder blood should also be allowed now that I have a separate powder state. Then you can be attacked by Time Men that have glass on the outside and sand on the inside, and I can be fired. That might work better with a whole sand tissue layer though.
I have a question regarding tissue/armour layers and damage dealing.
If an iron sword strikes some steel plate armour and fails to penetrate it, and the damage is converted to bludgeoning (AKA the force of the blow is spread out over the plate), will bludgeoning damage be inflicted to the creature beneath the armour?
That is, as my inexpert understanding of it goes, what tended to happen to sword strikes on chain and plate - unless the sword hit a weak point in the armour caused by poor forging, the wound inflicted would be a very serious bruise, regardless of how hard the armour material is, the force goes somewhere. Better forged armour would, I presume, better spread the force around.
[USE_MATERIAL_TEMPLATE:DRINK:PLANT_ALCOHOL_TEMPLATE]
USE_MATERIAL_TEMPLATE:DRINK:BLOOD_TEMPLATE
Gentlemen; OBSERVERather have
From the plant raw:Quote[USE_MATERIAL_TEMPLATE:DRINK:PLANT_ALCOHOL_TEMPLATE]
Now, given the implied nature of this statement, it should be entirely possible to create a similar concoction:QuoteUSE_MATERIAL_TEMPLATE:DRINK:BLOOD_TEMPLATE
DISCUSS
Gentlemen; OBSERVE
From the plant raw:Quote[USE_MATERIAL_TEMPLATE:DRINK:PLANT_ALCOHOL_TEMPLATE]
Now, given the implied nature of this statement, it should be entirely possible to create a similar concoction:QuoteUSE_MATERIAL_TEMPLATE:DRINK:BLOOD_TEMPLATE
DISCUSS
Aint no true dwarf until when you bleed on magma men, you explode from your alcohol content.
I have a question regarding tissue/armour layers and damage dealing.
If an iron sword strikes some steel plate armour and fails to penetrate it, and the damage is converted to bludgeoning (AKA the force of the blow is spread out over the plate), will bludgeoning damage be inflicted to the creature beneath the armour?
That is, as my inexpert understanding of it goes, what tended to happen to sword strikes on chain and plate - unless the sword hit a weak point in the armour caused by poor forging, the wound inflicted would be a very serious bruise, regardless of how hard the armour material is, the force goes somewhere. Better forged armour would, I presume, better spread the force around.
Additionally, if we're talking about a steel-skinned creature (Giant Magma Ants?) instead of a steel-armoured creature, is the force transfer handled differently?
Also, extra question I thought of while writing! Armour quality and material strength: Will they work as they currently do, as a multiplier of x1 to x2 (or whatever) to the strength? Maybe there could be something more interesting, with some kind of check to see if the blow has hit a poorly-forged weak spot where the material is thinner or poorly joined or whatever, and the standard material effect happening if the check is passed?
hmmm not sure how this would be done... layers that only cover the back. Is this possible?So no more one-shoting dragons with wooden spears. ;DYou forget about the soft underbelly
hmmm not sure how this would be done... layers that only cover the back. Is this possible?So no more one-shoting dragons with wooden spears. ;DYou forget about the soft underbelly
Also, more obsessing on blood: Sand is better bleeding out of mummies than time men... ;)
Could work.hmmm not sure how this would be done... layers that only cover the back. Is this possible?So no more one-shoting dragons with wooden spears. ;DYou forget about the soft underbelly
Also, more obsessing on blood: Sand is better bleeding out of mummies than time men... ;)
Make the back a separate body part and give it a much thicker layer? Then use the AROUND argument with a number of about 50 to indicate that half the body is surrounded by that back bodypart.
Toady, I have a question about castes. Some questions popped up in this (http://www.bay12games.com/forum/index.php?topic=27109.0) topic. So, we are just wondering about the possible differences between the castes. Is it possible that a caste has totally different creature tokes than other castes? Example: Caste X has NOFEAR, DAMBLOCK:10, NO_EAT, NOBONES for example, while Caste Y has DAMBLOCK:5 and nothing else?Probably!
[CREATURE:MULTIRACIAL]
[CASTE:RACE1]
...
[CASTE:RACE2]
...
:D
[CREATURE:HYBRID]
[CASTE:DWARF]
[NAME:dwarf:dwarves:dwarven]
[TILE:1][COLOR:3:0:0]
[GENPOWER:3]
[INTELLIGENT]
[TRANCES]
[BENIGN]
[CANOPENDOORS]
[PREFSTRING:beards]
[BODY:HUMANOID:2EYES:2EARS:NOSE:2LUNGS:HEART:GUTS:ORGANS:HUMANOID_JOINTS:THROAT:NECK:SPINE:BRAIN:5FINGERS:5TOES:MOUTH]
[STOUT]
[MAXAGE:150:170]
[ATTACK:MAIN:BYTYPE:GRASP:punch:punches:1:2:BLUDGEON][ATTACKFLAG_WITH]
[ATTACK:SECOND:BYTYPE:MOUTH:bite:bites:1:1:GORE][ATTACKFLAG_CANLATCH]
[CHILD:12][BABY:1][MULTIPLE_LITTER_RARE]
[DAMBLOCK:1]
[FAT:3]
[SIZE:6]
[EQUIPS]
[CAVE_ADAPT]
[DIURNAL]
[CRAFTSMAN_NAME:craftsdwarf:craftsdwarves]
[FISHERMAN_NAME:fisherdwarf:fisherdwarves]
[HAMMERMAN_NAME:hammerdwarf:hammerdwarves]
[SPEARMAN_NAME:speardwarf:speardwarves]
[CROSSBOWMAN_NAME:marksdwarf:marksdwarves]
[AXEMAN_NAME:axedwarf:axedwarves]
[SWORDSMAN_NAME:swordsdwarf:swordsdwarves]
[MACEMAN_NAME:macedwarf:macedwarves]
[PIKEMAN_NAME:pikedwarf:pikedwarves]
[BOWMAN_NAME:bowdwarf:bowdwarves]
[SPEECH:dwarf.txt]
[STANDARD_FLESH]
[HOMEOTHERM:10067]
[LAYERING:50]
[ALCOHOL_DEPENDENT]
[SWIMS_LEARNED][SWIM_SPEED:2500]
[PERSONALITY:IMMODERATION:0:55:100]
[PERSONALITY:VULNERABILITY:0:45:100]
[PERSONALITY:STRAIGHTFORWARDNESS:0:55:100]
[CASTE:HUMAN]
[NAME:human:humans:human]
[TILE:'U'][COLOR:3:0:0]
[GENPOWER:3]
[INTELLIGENT]
[CANOPENDOORS]
[BENIGN]
[PREFSTRING:stature]
[BODY:HUMANOID:2EYES:2EARS:NOSE:2LUNGS:HEART:GUTS:ORGANS:HUMANOID_JOINTS:THROAT:NECK:SPINE:BRAIN:5FINGERS:5TOES:MOUTH]
[SIZE:7]
[MAXAGE:60:120]
[ATTACK:MAIN:BYTYPE:GRASP:punch:punches:1:2:BLUDGEON][ATTACKFLAG_WITH]
[ATTACK:SECOND:BYTYPE:MOUTH:bite:bites:1:1:GORE][ATTACKFLAG_CANLATCH]
[CHILD:12][BABY:1][MULTIPLE_LITTER_RARE]
[FAT:3]
[EQUIPS]
[DIURNAL]
[SPEECH_MALE:human_male.txt]
[STANDARD_FLESH]
[HOMEOTHERM:10067]
[LAYERING:10]
[SWIMS_LEARNED][SWIM_SPEED:2500]
[MUNDANE]
[CASTE:ELF]
[NAME:elf:elves:elven]
[TILE:'E'][COLOR:3:0:0]
[SPEED:700][GRASSTRAMPLE:0]
[GENPOWER:3]
[INTELLIGENT]
[CANOPENDOORS]
[PREFSTRING:grace]
[BODY:HUMANOID:2EYES:2EARS:NOSE:2LUNGS:HEART:GUTS:ORGANS:HUMANOID_JOINTS:THROAT:NECK:SPINE:BRAIN:5FINGERS:5TOES:MOUTH]
[NARROW]
[DAMBLOCK:-1]
[SIZE:7]
[ATTACK:MAIN:BYTYPE:GRASP:punch:punches:1:2:BLUDGEON][ATTACKFLAG_WITH]
[ATTACK:SECOND:BYTYPE:MOUTH:bite:bites:1:1:GORE][ATTACKFLAG_CANLATCH]
[CHILD:12][BABY:1][MULTIPLE_LITTER_RARE]
[FAT:1]
[EQUIPS]
[DIURNAL]
[SPEECH:elf.txt]
[STANDARD_FLESH]
[HOMEOTHERM:10067]
[SWIMS_LEARNED][SWIM_SPEED:2500]
[PERSONALITY:IMAGINATION:0:55:100]
[PERSONALITY:ARTISTIC_INTEREST:0:60:100]
[PERSONALITY:INTELLECTUAL_CURIOSITY:0:55:100]
[PERSONALITY:SELF_DISCIPLINE:0:45:100]
[PERSONALITY:ACTIVITY_LEVEL:0:40:100]
[CASTE:GOBLIN]
[NAME:goblin:goblins:goblin]
[TILE:'g'][COLOR:7:0:0]
[GLOWTILE:'"'][GLOWCOLOR:4:0:1]
[GENPOWER:2]
[EVIL]
[INTELLIGENT][LIKES_FIGHTING]
[BONECARN]
[CANOPENDOORS]
[PREFSTRING:terrifying features]
[BODY:HUMANOID:2EYES:2EARS:NOSE:2LUNGS:HEART:GUTS:ORGANS:HUMANOID_JOINTS:THROAT:NECK:SPINE:BRAIN:5FINGERS:5TOES:MOUTH]
[ATTACK:MAIN:BYTYPE:GRASP:punch:punches:1:2:BLUDGEON][ATTACKFLAG_WITH]
[ATTACK:SECOND:BYTYPE:MOUTH:bite:bites:1:2:GORE][ATTACKFLAG_CANLATCH]
[CHILD:12][BABY:1][MULTIPLE_LITTER_RARE]
[SIZE:6]
[FAT:2]
[EQUIPS]
[NOCTURNAL]
[STANDARD_FLESH]
[HOMEOTHERM:10067]
[LAYERING:10]
[SWIMS_LEARNED][SWIM_SPEED:2500]
[PERSONALITY:ANGER:25:75:100]
[PERSONALITY:IMMODERATION:50:75:100]
[PERSONALITY:EXCITEMENT_SEEKING:0:60:100]
[PERSONALITY:CHEERFULNESS:0:40:90]
[PERSONALITY:ALTRUISM:0:25:50]
[PERSONALITY:MODESTY:0:40:90]
[PERSONALITY:SYMPATHY:0:25:50]
Ps: sorry for my language, I don't dare to think how this post appear to a english speaker. :-XActually you write English much better than many natives I know.
Here You Go:
Here You Go:
Have we figured out yet what determines the caste of a child? Could the child of two Human-caste Hybrids be a goblin? If a Human-caste mates with an Elf-caste, is the child the caste of the mother? Is it randomly decided? I don't think Toady has shown us the raws for caste succession, if he has even gotten around to actually coding it yet.
^^^ No, nothing dynamic about it. It's simply distinct "forms" of a single species -- think of ant polymorphism (http://en.wikipedia.org/wiki/Ant#Polymorphism), which seems to be the target for this release's implementation of castes.So basically... makes them all in the Humonoid species, and thus able to mate and create hybrids?
hmmm not sure how this would be done... layers that only cover the back. Is this possible?So no more one-shoting dragons with wooden spears. ;DYou forget about the soft underbelly
Also, more obsessing on blood: Sand is better bleeding out of mummies than time men... ;)
With all of the new material properties, will it be possible for the bones and leather of different creatures to have different properties when used as items? Would dragon hide armor be better than steel? Would certain creatures' bones make better bolts?
So to make sure from people who thought about it more-
We can make an antman species with four castes: Queens who are all female, born rarely, live a long time, and are fatter than normal; Males who are male (natch), are tiny, and die quickly; and Workers and Soldiers who are no_gender.
If this is true, awesome. If not, why not?
So to make sure from people who thought about it more-
We can make an antman species with four castes: Queens who are all female, born rarely, live a long time, and are fatter than normal; Males who are male (natch), are tiny, and die quickly; and Workers and Soldiers who are no_gender.
If this is true, awesome. If not, why not?
Oh no! I just remembered that this won't really be possible unless something is done about the assumed monogamy of species. In the ant colony, the queen would mate with one ant male, then the male would die and that's how it'd be until a new queen was born. This must be changed!
So to make sure from people who thought about it more-
We can make an antman species with four castes: Queens who are all female, born rarely, live a long time, and are fatter than normal; Males who are male (natch), are tiny, and die quickly; and Workers and Soldiers who are no_gender.
If this is true, awesome. If not, why not?
Oh no! I just remembered that this won't really be possible unless something is done about the assumed monogamy of species. In the ant colony, the queen would mate with one ant male, then the male would die and that's how it'd be until a new queen was born. This must be changed!
Oh yeah, ironclad, universal monogamy. Well then, instead of the RL appropriate boytoy drones, their function will be replaced with a more... survivable caste. Ant King - they're gonna rock.
Oh no! I just remembered that this won't really be possible unless something is done about the assumed monogamy of species. In the ant colony, the queen would mate with one ant male, then the male would die and that's how it'd be until a new queen was born. This must be changed!
That's true. We'll need some way to specify litter size beyond the current system of MULTIPLE_RARE and the implied MULTIPLE_COMMON.
will a dissolution be implemented in any way?
QuoteSo we'll also have armor acting like a pseudo tissue layer for purposes of transmitting bludgeoning damage and so forth?QuoteIf an iron sword strikes some steel plate armour and fails to penetrate it, and the damage is converted to bludgeoning (AKA the force of the blow is spread out over the plate), will bludgeoning damage be inflicted to the creature beneath the armour?QuoteAdditionally, if we're talking about a steel-skinned creature (Giant Magma Ants?) instead of a steel-armoured creature, is the force transfer handled differently?
but how will all the layers of tissue for each bodypart be presented? Will there be a gigantic/massive list of "2th outer tissue layer for right finger #2", "Flesh layer #1 for right knee" and so on listed like the parts are currently done, or will there be some kind of damage indicator next to the body parts?
Because having blood that is of a temperature higher than it's boiling point but kept liquid by the pressure in the veins would be cool- ish.
Obviously, from what you've said, it will be difficult to cut through, say, steel with iron. But HOW difficult?
will that mean that armor will start to act like a layer of metal around your character that needs to be breached and torn to do damage to the soft creature inside
this post reminds me, are you ever going to include magnetism in DF ?
More generally, the next version will have all the things that are wrote in the dev_next page, or only the yellow ones?
"release the Berzerker!" debug-button is going to stay in for the final release. And that hopefully what generates can be edited.
Do Siege weapons actually damage enemies or do they simply die if struck?
Wouldn't it be as simple as having a [BLOOD] token to be placed on some layer? Or even [BLOOD:_material_] to simplify if we're going to have many layers of blood.
Oh, and if we have fluid layers that do not fill the requirements of blood, can those be sprayed around when the creature is wounded enough to pierce that layer also, despite that it will do very little to adversely affect the creatures health?
Armour quality and material strength: Will they work as they currently do, as a multiplier of x1 to x2 (or whatever) to the strength? Maybe there could be something more interesting
Where presumably the numbers following the ARGs are the relative thicknesses. How does this interact with RELATIVE_THICKNESS in the tissue definitions?
Does any of this work regarding bodies effect vermin? What do you have planned for them?
How do the strength values for metals interact with their effectiveness as weapons and armor?
So, we are just wondering about the possible differences between the castes. Is it possible that a caste has totally different creature tokes than other castes?
Ok then, the hybrid thing from earlier must've confused me
Hmmm, how does all of this translate as far as weapon and armor quality goes? Will they still have the same effects as before?
Also, how is this going to effect things like training bolts? How is the game going to decide what is good for training with and what isn't?
With all of the new material properties, will it be possible for the bones and leather of different creatures to have different properties when used as items?
In the ant colony, the queen would mate with one ant male, then the male would die and that's how it'd be until a new queen was born.
If it works we could even see them being allowed for different uses. Dragon fang/walrus tusk spears, anyone?
Would it be possible if struck hard enough for a hard inner layer to pass through a soft outer layer?
QuoteDoes any of this work regarding bodies effect vermin? What do you have planned for them?
There are a few countdown things here and there that touch on that, but it's mostly an undecided issue. They'll need materials for things like milking and so on, as well as probably at least one 'structural' material at the minimum like plants to give them properties, but ideally they'd have full bodies (that don't get added to individual vermin, but just something to refer to as needed).
QuoteSo, we are just wondering about the possible differences between the castes. Is it possible that a caste has totally different creature tokes than other castes?
Yeah, most of the tokens work that way. A few that interact with populations (like biome tokens and frequency) are still creature tokens.
QuoteArmour quality and material strength: Will they work as they currently do, as a multiplier of x1 to x2 (or whatever) to the strength? Maybe there could be something more interesting
Right now, armor skill gives an increase to a deflection roll, and armor quality boosts the deflection roll, and a good deflection roll lowers the effective force of the strike. Until armor damage goes in, there probably won't be anything more complicated. The toughness attribute, which used to decrease damage directly, now does a similar deflection roll for strikes to tissues.QuoteHmmm, how does all of this translate as far as weapon and armor quality goes? Will they still have the same effects as before?
I think I did armor quality somewhere in this post. For weapons, it currently increases the chance to score a hit at all as usual, and it'll also make edged weapons start sharper.
Quick Question!
Willl there be castes in Entities?
Quick Question!
Willl there be castes in Entities?
Erm...entities = races, right? So the answer is yes in that case. :)
Quick Question!
Willl there be castes in Entities?
Erm...entities = races, right? So the answer is yes in that case. :)
I think he's talking about the Civilization entries, not the creature entries. I may have missed something from Toady, but has there been any information on how Castes are going to work with Civs? Do all castes for a species automatically show up for that civ? Are there ways to restrict jobs to a particular caste?
QuoteIf it works we could even see them being allowed for different uses. Dragon fang/walrus tusk spears, anyone?
I guess this is an ideal time to strike a cautious note -- depending on what I have time for, workshops possibilities might not be expanded in certain ways initially. For instance, bone is generally the realm of the craftsdwarf, but the craftshop doesn't do weapons aside from the sharpenable stone ones. There are lots of different things to handle, so I could miss quite a bit (or not even attempt lots of them as I'm pressed for time for this release). We can patch things up after that, but it's something to be aware of. This goes for knocking out some gigantic tooth or horn and making floodgate out of it or whatever as well. The new corpse piece would make it one step away from being the floodgate through an appropriate job, but those need to be added to the interface for you to get at them. It probably is best done with some sort of complete reworking of how shops function and which jobs are available, which sticks me between instant and delayed gratification yet again.
On the castes dealy: How can I be the only one thinking of creating a Tyranid race?
I'd laugh like mad if we had a world with say... 150 different races from all kinds of genres, films, games, etc. and after 9000 years, the only thing left alive were kobolds.
Inspired by these raws, I wrote a program to translate from the old style plant matgloss files to the new plant raws (hoping to eventually extend it to translate everything - though creatures may be a bit much to ask for)
In testing, I noticed the following differences not attributable to flaws in my program:
dwarven sugar and dwarven syrup will be edible raw
some seeds have changed colors. prickle berry seeds are dark green and sun berry seeds are bright red (both were formerly dark grey)
some powders have a color that is a color token. redroot dye is BROWN, others match their dye color. dwarven sugar and flour and longland flour are WHITE. whip vine flour is AZURE.
whip vine flour's ordinary color has changed from white to cyan.
Oh damn now i can see discussion in my minds eye that evolve around "Chuck Norris" as Megabeast and head of the civilations of "texas rangers". The next points in this discusion will be how to mod bowman with education from the "imperial marksmanship Acadamy", if the 150 Pokemons from the first game are enought and if an pokemon race can support more then 600 castes. Oh and who said terrans didnt get Nukes and Phyrexians are to overpowered. Not to mention short sidediscussions like if McGyver schould serve as God for dwarfs or the elves.
[sarcasm]Thank you.[/Sarcasm]
:D Dont take me serious ok? I am joking naturally.
So what will you be working on now Toady? As I see it only things need working on are filling up the creature raws and finalizing the wound system and I could see a nice Wound release by the beginning of next month or a bit later.
Squat Fortress! Prep da melta cannons an let da swarm come, we'll be ready fur dem!Stop likening squats to real dwarves. If they had been dwarfy enough, they would have survived and would now be sitting as supreme rulers of the damn galaxy. For Armok's sake, even the bloody elves outlived them.
I'd laugh like mad if we had a world with say... 150 different races from all kinds of genres, films, games, etc. and after 9000 years, the only thing left alive were kobolds.If they were Tucker's Kobolds (D&D reference, for the uninitiated), yeah... I could see that. A billion traps, corridors like an endless shooting gallery, flaming rolling logs and lines of pitch that suck the very oxygen out of the air when ignited, narrow passages larger creatures can't get through, five billion types of poison coating everything...
Great idea too. The Ultimate Showdown Supermod!So... will Mister Rodgers with a machete be the last non-kobold standing?
Squat Fortress! Prep da melta cannons an let da swarm come, we'll be ready fur dem!Stop likening squats to real dwarves. If they had been dwarfy enough, they would have survived and would now be sitting as supreme rulers of the damn galaxy. For Armok's sake, even the bloody elves outlived them.
Disgraceful.
Great idea too. The Ultimate Showdown Supermod!So... will Mister Rodgers with a machete be the last non-kobold standing?
Don't worry. I went through 14 years thinking a duck's quack doesn't echo.Thats because the ducks quack IS the echo.
Damn... and I would have been bloody thrilled if Mister Rodgers actually was a badass.
*cue the theme music from 'Highlander'*
Damn... and I would have been bloody thrilled if Mister Rodgers actually was a badass.
*cue the theme music from 'Highlander'*
You and me both. Oh well, there's always Wojtek the Soldier Bear.
Um...yer thinking of the Ratlings. The only reason the bugs killed the Squats was due to GDubya realizing the sales weren't cutting it. And even then they still are technically about in the Imperium, albeit mainly as techies-for-hire rather than having any worlds of their own. Additionally, there are the Demiurg, whom gave the Tau Ion Cannon technology.
1. What is protected with an iron cap vs. an iron helm?
In my mind, a cap will protect the skull while a helm would protect the entire head. (i.e. a copper bolt hits the iron helm, head is bruised, an eye possibly blackened. But the same bolt hits an iron cap wielder and pokes an eye out)
2. What do gauntlets protect?
I've never really known this one. I figured the gauntlets would protect hands, possibly the lower arm. I'm not sure what protects the upper arms.
3. I take it chainmail won't be effective against piercing attacks like bolts?
This is a simple one, and I think it might have already been answered.
4. Can armor break and become less useful?
Quote1. What is protected with an iron cap vs. an iron helm?
In my mind, a cap will protect the skull while a helm would protect the entire head. (i.e. a copper bolt hits the iron helm, head is bruised, an eye possibly blackened. But the same bolt hits an iron cap wielder and pokes an eye out)
2. What do gauntlets protect?
I've never really known this one. I figured the gauntlets would protect hands, possibly the lower arm. I'm not sure what protects the upper arms.
3. I take it chainmail won't be effective against piercing attacks like bolts?
This is a simple one, and I think it might have already been answered.
4. Can armor break and become less useful?
1. Helm provides more defense and is also heavier. Helms also cannot layer so you can wear a cap and helmet.
2. Hands
3. NOTHING is good against piercing attacks! They will go through platemail like butter! Ignoring that, Chainmail is just a lighter, less defensive, version of platemail that can layer. Even if Peircing attacks were balanced it has peircing defense no greater or less then any other armor of the same defense.
-Also Chainmail... Proper chainmail... Is good against Peircing attacks historically speaking. Though this is apperantly up for debate.
--Also this is subject to change. Currently piercing weapons are very elite weapons... The reason Spears arn't downright destroyers of all is due to their tendency to get stuck very easily. (Crossbows, which are rapid fire in Dwarf Fortress, don't have to worry about that)... That AND ranged weapons, if I can remember correctly, cannot be dodged and can barely be defended against.
---Note: Reading the Wiki I see that its block is segregated between two values... One COULD be for range... OR another area of the body. Hardly matters since even Artifact armor can have trouble blocking crossbows/Arrows/darts/tacks/pointysticks
4. currently no. This is as I said... subject to change.
: Your weapon needs an certain force and crossection if you want to break throught thick plating. An Platebreaker ("Panzerbrecher"/"Panzerstecher"/"Miséricorde") the ancestor of the latter Stillet had an triangular or sometime rectangular crossection and to get through think plates you had to use both hands.
This weapons were wonderfull against normal Chainmail to cause they were pionty as an needle and could by this lodge into one ring and break it from the inside while being pressed deeper in the flesh of an victim. They were poor cutting weapons on the other hand which was an mayor problemm against unarmored troops like light infantary.
Just like to note that ranged attacks CAN be dodged, I've done it before with high skill wrestlers in adventure mode against crossbows, and my sig proves it can be done with thrown objects.
"What makes you think chainmail will or won't be good against piercing attacks? You seem awfully confident about that, especially considering how different the next version will actually be. Just because piercing attacks are/might be too strong now doesn't necessarily mean they will be in the next version"
The only thing is that even average crossbow users fire so rapidly
I hear that shields are also very effective against crossbows
Not quite... You heard equipping 20 shields in one hand and getting to "Legendary" shield user is effective against crossbows... Or something along those lines. They arn't reliable enough to be what Id consider to be "Effective"
Not quite... You heard equipping 20 shields in one hand and getting to "Legendary" shield user is effective against crossbows... Or something along those lines. They arn't reliable enough to be what Id consider to be "Effective"
Getting to legendary in Shields, even without 20 of them, is enough to block most incoming missiles. On the other hand, I once had a legendary shield user get his eye shot out in fortress mode, so it isn't a sure thing.
Not quite... You heard equipping 20 shields in one hand and getting to "Legendary" shield user is effective against crossbows... Or something along those lines. They arn't reliable enough to be what Id consider to be "Effective"
Getting to legendary in Shields, even without 20 of them, is enough to block most incoming missiles. On the other hand, I once had a legendary shield user get his eye shot out in fortress mode, so it isn't a sure thing.
I once had two legendary sheild using dwarves (With Wrestling skillz!) shot to death... so... It isn't a sure thing... they didn't really survive past the second volly.
You see Platemail was efective aigainst crossbows and if you still dont believe me here an Picture of an platemeil wich got tested against an crossbow:
"of course there must be a chance [this should be based on the skill with the given weapon perhaps] that they hit an unarmored part of the body with the arrow/bolt"
That's rather oversimplified, though. You can certainly cut a "stronger" material with a "weaker" one. It depends on a lot of things, like sharpness, thickness, how the force is applied, and whatever else.
For instance, here's a rather extreme example to illustrate the point: A 50-pound copper axe blade, sharpened extremely fine, should be able to penetrate a millimeter of good steel. I know that's ridiculous to use as an example, but it's just to show that there are more factors involved than a direct comparison of the materials, and saying "that's impossible!" just because one material is less inherently "strong" than the other.
You could handle it in the item interaction rather than a workshop option. Basically you could have a dragon corpse and interact with it through the k menu. In that menu you choose the corpse and open its item page. On its item page you get a list of what parts are still attached to the corpse. You can choose each part and have options to sever it or perform some gruesome task otherwise.QuoteIf it works we could even see them being allowed for different uses. Dragon fang/walrus tusk spears, anyone?
I guess this is an ideal time to strike a cautious note -- depending on what I have time for, workshops possibilities might not be expanded in certain ways initially. For instance, bone is generally the realm of the craftsdwarf, but the craftshop doesn't do weapons aside from the sharpenable stone ones. There are lots of different things to handle, so I could miss quite a bit (or not even attempt lots of them as I'm pressed for time for this release). We can patch things up after that, but it's something to be aware of. This goes for knocking out some gigantic tooth or horn and making floodgate out of it or whatever as well. The new corpse piece would make it one step away from being the floodgate through an appropriate job, but those need to be added to the interface for you to get at them. It probably is best done with some sort of complete reworking of how shops function and which jobs are available, which sticks me between instant and delayed gratification yet again.
...a "Weaponize Corpse Piece" task...Which is probably amoungst the best combination of words ever.
...a "Weaponize Corpse Piece" task...Which is probably amoungst the best combination of words ever.
...a "Weaponize Corpse Piece" task...Which is probably amoungst the best combination of words ever.
I need more room in my signature.
Yeah, exploding gas-ball creature thingies are quite popular.
Pokemon as a creature with a multitude of castes...
Come to think of it... I should erase my signature... I doubt I am going to be playing Spore that much in the future (Dang constant glitches)... and if I do I can always put it back.
In the games they do. In the cartoon...
Mind you I have not seen them all, but I would imagine it would be a very emotional episode where the damn thing explodes. Then again, it seems death is only for drama and not for, you know, death.
Only Voltorbs and the other ones can do that.
when I read "removing a tissue layer while still alive" shearing sheep was the least thing that came into my mindAdmittedly, that holds true for me as well.
oooooh good point... Hair should grow out of the skin and grow back even if it's all cut off, but only if the skin is still there. Removed skin should allow hair growth. (Scars as well!)
Shearing sheep, anyone?
I would rather add this as a job at the loom.
Furriers vs leatherworkers?If you get a pelt, you either make fur, or leather, not both.
furs vs tanned hides?
Fur coats vs leather cloaks?
Fur is also thick and has been known to be hard.
Of course there is a third class of Skin armors... but that only comes from creatures with I guess is better called "Plate Leather" but I have no idea how effective it could be. (Rhinos and some Crocs)
Fur is also thick and has been known to be hard.
Of course there is a third class of Skin armors... but that only comes from creatures with I guess is better called "Plate Leather" but I have no idea how effective it could be. (Rhinos and some Crocs)
A Costumes skill would work for that, especially if we ever get dwarven theatre.
A Costumes skill would work for that, especially if we ever get dwarven theatre.
Theatre? That would be a bit too much imo, this isn't Dwarf "The Sims" Fortress you know. :D
I don't know, the thought of dwarves doing reenactions of historic events for entertainment, and accidentally killing the protagonist is highly amusing. :)
Hey guys... when the next version comes out (as in when the count reaches 0)... Lets have another Future of the Fortress
Do you think this room will last that long? this is rather bloated
Why the spleen? That doesn't make a lick o' sense.
Also, I've noticed Toady's been updating the log a good 5 hours earlier, which is good.
There's really no need to start a new thread, the argument that it's 'bloated' doesn't really make much sense. It's easy enough to just go to the last couple of pages
Why the spleen? That doesn't make a lick o' sense.
I'm highly disappointed there isn't more hypothetical mods at the modding forum concerning the new version.Probably because they can't test their mods.
Question for Toady: If I make a creature with steel skin and kill it, then make some high boots out of its leather, will they be just as good as regular steel high boots?
Toady also stated that it is very likely that the templates will change untill the release so its a bit of wasted time to make Hypthtical mods now if the Templatecode changes anyway to 50%.Hypothetical mods are hypothetical.
Question for Toady: If I make a creature with steel skin and kill it, then make some high boots out of its leather, will they be just as good as regular steel high boots?
If you make a creature with steel skin, its skin will probably go to the smelter instead of the tanners workshop when you butcher it (assuming you can kill it)
Why would it do that? It would have the properties of steel, but it would still be leather. The game doesn't allocate which materials should be sent to where based on its inherent properties, only by the tags you allocate it by. Thus, if you tagged the steel-skin material in the raws to be skin, it would be tanned in a tanner's workshop.
Unless you think me and penguinofhonor is the same person.... my answer to your statement is: ???
Also I umiman who cannot tell a lie state that Neonivek is the greatest person I ever known.
Huh, well, at least now I know where the massive snowstorm that hit Idaho came from.
I have a question that's been bothering me for a while.
Will chain mail use the same strength value that plate mail does?
i.e. Shear strength for piercing and slashing, impact strength for blunt.
I imagine that the rings that make up a mail sheet would behave differently than a steel plate. Piercing attacks on mail would likely exert tensile strain as it pries the rings open. A slashing attack would likely be converted into an impact. Blunt attacks probably wouldn't damage the mail at all, but it wouldn't absorb much of the attack, either.
Latest dev notes highlight: a dwarf with boiling gold blood. I really can't wait to see how THAT turns out!
Any experiment designed to kill a dwarf that successfully kills a dwarf is a successful experiment, that ended well, regardless of any other unfortunate side effects.Latest dev notes highlight: a dwarf with boiling gold blood. I really can't wait to see how THAT turns out!
That experiment won't end well [I am thinking about the poor dwarf's lifespan to be more specific] I guess... ;D
Question for Toady: Will any of these body changes (other then poisons) have any effect on Vermin? Or are they going to stay pretty much unchanged?It's been mentioned that he wants to allow for more complex vermin bodies, but doesn't want to get to the point of having to track wounds for individual vermin (IE, vermin remain simple things without individual parts that can be wounded, but they do get different properties depending on their construction - so an Iron Rat might be immune to the weak attacks from a kitten, for example, but it would still insta-gib from an attack that could hurt it).
Another way of phrasing that is: Will vermin get more specific body definitions with this release, or are they going to stay very simplistic? Right now the difference between a bluejay and a fire snake is pretty minimal.
Gaseous gold is more likely to become a fine golden powder than solid gold - but yeah, since a "powder" is just a large amount of tiny solid gold specks, you can count it as a solid.
Wow. So the next version will contain a luxury creature that, during certain expensive parties, will be detonated to shower the room with gold?
Dammit Toady you silly man! It's ridiculous enough that beings have gold in a constant liquid state that functions as their circulatory system! Now once that liquid gold is violently released, instead of returning to its solid state as nature intended (which you insist is an error that needs to be rectified), it further heats into gas?One would assume the transfer to a solid state isn't instantaneous.
WHAT IS WRONG WITH YOU :P
Dammit Toady you silly man! It's ridiculous enough that beings have gold in a constant liquid state that functions as their circulatory system! Now once that liquid gold is violently released, instead of returning to its solid state as nature intended (which you insist is an error that needs to be rectified), it further heats into gas?
WHAT IS WRONG WITH YOU :P
The boiling gold blood came out as gold dust first, because I forgot to transfer the states between creature morphs properly, but after that it came out as a cloud of gold gas properly. I'll have to do it again once I've updated temperature damage.
Any idea at this point how much of an effect this is going to have on combat? For example, will Masterwork armor suddenly become more important then the metal?
does this mean that a Masterwork sword gets a bigger boost then a Masterwork Hammer?
Will we see more preview creature raws as you get creatures other than dwarves implemented?
If items become damaged and less effective, would there be:
Settings to make military squads prefer a certain quality?
A new profession//metalworking option for Item Repair?
A refuse option to include broken metal items, along with an auto-melt tag on broken metal items?
Quote from: Pure_WWilll there be castes in Entities?Quote from: Mephhas there been any information on how Castes are going to work with Civs? Do all castes for a species automatically show up for that civ? Are there ways to restrict jobs to a particular caste?
What's the word on blood drinks?
what are the plans concerning distances, weight, etc. Now a square holds anything from a butterfly to a tree or colossus - how far do you intend to go in sticking to a specific size for squares, with all the implications for large creatures, mass conservation etc. ?
Will clothing help protect creatures from cold and/or heat? If it acts kind of like a tissue layer like you said armor would, would that do it? But then there's the whole deal of having poorly-dressed dwarves on embark and making more coats, jackets, and so on..
Will we be able to smelt creatures in the smelter (or any other workshop) in this release?
Quote from: yougiedeggsWhat is protected with an iron cap vs. an iron helm?
What do gauntlets protect?
I take it chainmail won't be effective against piercing attacks like bolts?
Can armor break and become less useful?Quote from: TechheadWill chain mail use the same strength value that plate mail does?
i.e. Shear strength for piercing and slashing, impact strength for blunt.
I imagine that the rings that make up a mail sheet would behave differently than a steel plate. Piercing attacks on mail would likely exert tensile strain as it pries the rings open. A slashing attack would likely be converted into an impact. Blunt attacks probably wouldn't damage the mail at all, but it wouldn't absorb much of the attack, either.
Toady, with the new tissue layers, will it be possible to 'flay' creatures?
Can severed parts be regenerated under the new system?
I assume the subordinate-ness is just implied by the tissue layering order.
I really want giant sloths to be in the vanilla game.
I can't wait to slice open a guy's back with a sword, then jam my fist into his torso like a mad puppeteer.
Must have gotten linked up to the game's spleen somehow. So every time he stabs a spleen in game he's actually stabbing the game's spleen and it goes "Arg! My spleen!" and goes unconscious.
Quote from: MephansterasQuestion for Toady: Will any of these body changes (other then poisons) have any effect on Vermin? Or are they going to stay pretty much unchanged?It's been mentioned that he wants to allow for more complex vermin bodies, but doesn't want to get to the point of having to track wounds for individual vermin (IE, vermin remain simple things without individual parts that can be wounded, but they do get different properties depending on their construction - so an Iron Rat might be immune to the weak attacks from a kitten, for example, but it would still insta-gib from an attack that could hurt it).
Another way of phrasing that is: Will vermin get more specific body definitions with this release, or are they going to stay very simplistic? Right now the difference between a bluejay and a fire snake is pretty minimal.
Standard "If I understood it correctly" disclaimer.
^^^ I couldn't tell if he meant "I'll have to redo the code" or "I'll have to redo the test so that when I slash open the gold-blooded dwarf, I get toasted by the gold vapor."
With the new changes to squad equipment orders, will this also effect hunters? I really don't need my hunter running around with my one stack of masterwork adamantine bolts to go kill groundhogs. I'd much prefer that he grab the lame base quality iron ones we have lying around.
Will gold gas condense into molten gold? Or scatter into gold powder?
Can gold powder be melted into gold bars
I definitely like the chance to create Shambling Steamers, giant iron, wood, stone, and magma titans with steam blood.
Yeah that's gonna be fun. :D
Toady, I have a question regarding this. I suppose blood will act like an object in the next version, or in the future. What if magma blood will hit a dwarf for example? "Realistically" [even tho it's weird to say that in this situation] it should damage the dwarf or it's armors/weapons [That should depend on the material of the armor/weapon of course].
Will gold gas condense into molten gold? Or scatter into gold powder?
Anything that can evaporate does it
Just point out wood. Carbon doesn't have a liquid state, so you can burn the crap out of a log all you want, you'll never get molten wood. Just vaporized carbon. Of course, there's a ridiculous number of people who believe that all glass is liquid, so whatever.
e: in retrospect you were probably joking
01/06/2008: 904. I went through and did the first pass on the projectile revision. I think the new agility is being counted too much, as the skill-free test dwarf didn't have trouble hitting me ten times in a row, but I'll have that sorted out when I run the numbers. I also did wounds from falling and the transfer of wound and appearance data to corpses and severed parts. The wound transfer should be key to sorting out issues like exactly where a hydra's heads are and whether or not the skulls have been removed and so on.
Carbon does have a liquid state... under sufficient pressure.
Also, many substances combust when heated in the presence of oxygen, and many compounds break down. THAT is the reason you will never get molten wood.
Yeah that's gonna be fun. :D
Toady, I have a question regarding this. I suppose blood will act like an object in the next version, or in the future. What if magma blood will hit a dwarf for example? "Realistically" [even tho it's weird to say that in this situation] it should damage the dwarf or it's armors/weapons [That should depend on the material of the armor/weapon of course].
# Req359, CONTAMINANT TEMPERATURE EFFECTS, (Future): Most importantly, metals that melt over creatures should have an effect, but the temperature of contaminants isn't currently stored.
Hopefully that one makes it in.
If it is possible to have metal creatures spew molten metal and cover dwarves. Then I think there should be a way to store molten metal, or at least channel it. This way you can make metalfalls and have pools of metal, in which with a pully system, you can dip items into the pool to coat them (or goblins. then melt the goblins >.> 4th ore baby).
If it is possible to have metal creatures spew molten metal and cover dwarves. Then I think there should be a way to store molten metal, or at least channel it. This way you can make metalfalls and have pools of metal, in which with a pully system, you can dip items into the pool to coat them (or goblins. then melt the goblins >.> 4th ore baby).
Could also be a way to create cheaper metal furniture too. Make a bleh Calcite Throne, dip it in aluminum (assumingly taking 1 bar, or 1 water/magma/molten level)
Only problems I see is the metal cooling down into giant metal blocks that need to be mined out. But hey, could always take the easier way and just make it a workshop :<
Does this mean that hydras won't die if you chop off one of their heads?
Would it be possible to make hydras bleed heads then?
Neither do they regrow the heads to match the Mythical Hydra ... well not yet. We can still hope for another day and update.
Neither do they regrow the heads to match the Mythical Hydra ... well not yet. We can still hope for another day and update.
Course, were it to match a mythical hydra we would need cauterization implemented, or it would survive a great deal longer.
Neither do they regrow the heads to match the Mythical Hydra ... well not yet. We can still hope for another day and update.
Beat a hydra to death with its own skull. "This doesn't seem physically possible!!"
I've got the Mac up and running, so I should be able to put up the updated Mac version along with the others next time.Yes! I can finally have an FPS counter again!
Beat a hydra to death with its own skull. "This doesn't seem physically possible!!"
Yeah, that's what he said.
I can't remember the next line, though.
Neither do they regrow the heads to match the Mythical Hydra ... well not yet. We can still hope for another day and update.
Course, were it to match a mythical hydra we would need cauterization implemented, or it would survive a great deal longer.
The obvious solution is to recruit a bunch of wrestler meat-shields and have each of them latch onto a throat.
Is Toady still in line for a Feb release date?
Is Toady still in line for a Feb release date?
I doubt it. He's still got like 500 dev items to go before he's even finished the new body and wound systems.
Is Toady still in line for a Feb release date?
I doubt it. He's still got like 500 dev items to go before he's even finished the new body and wound systems.
Was a Feb release date ever the plan? I thought I'd always heard April.
One day Dwarf Fortress will be detailed enough so as to allow scientists to extrapolate the future.
Of course, the simulation would involve the DF simulation, ad infinitum, causing the computer to explode.
Aww, it isn't showing to me now too, but yeah :)
http://www.giantitp.com/comics/oots0325.html
http://www.giantitp.com/comics/oots0326.html
Aww, it isn't showing to me now too, but yeah :)
http://www.giantitp.com/comics/oots0325.html
http://www.giantitp.com/comics/oots0326.html
A finite blood supply is even already implemented... but implementing a loss of blood pressure without a corresponding loss of blood isn't.
Alright so we got 4
1) Blood loss
2) Destruction of the Head, Neck, Spine, Brain, or body
3) Suffication/Drowning
4) Falling into a Chasm
5) Starvation/Thirst
There the five known immediate causes of death.
I assume burning is counted in the destruction one?
What about poison and illness? Since I think Toady is adding sickness in to the next release, we may need to consider that one. Although depending on how it's done those should probably just cause major organ failures, which would then lead to death.
I suspect that another DF cause-of-death is when heat makes your material undergo a phase change... Dunno. I know dwarves can be on fire, and that's probably classed as blood loss, but surely dunked in magma is a different thing?
I wonder if non-native inhabitants of your fort still no longer need to eat, drink or sleep.
Well i think an boozeplosion is instant death too and maybe steam if it ever comes back as deadly variant. Frozzen to death is possible too i think on very cold environments.
You can get crushed by falling rock. You can stateshift if the temperature is high enough
If anyone tells me you can find an Adventurer who is "Giving into Hunger" alive... Then Ill take it off the list.
I look forward to chopping down a tree right in front of an elf in adventure mode.Are you sure that would make them cry?
Then I'll build a phallicly-suggestive statue to make them cry.
It would if it's carved out of wood.I look forward to chopping down a tree right in front of an elf in adventure mode.Are you sure that would make them cry?
Then I'll build a phallicly-suggestive statue to make them cry.
Anyways I can't to be have more skills in adv mode, looking forward to mining most of all.
They would probably cry harder if it were carved into something abstract. The phallus is a shape found often in nature. A masterwork bed in the shape of a hexagon is not generally found in nature.It would if it's carved out of wood.I look forward to chopping down a tree right in front of an elf in adventure mode.Are you sure that would make them cry?
Then I'll build a phallicly-suggestive statue to make them cry.
Anyways I can't to be have more skills in adv mode, looking forward to mining most of all.
"The more relevant applications might be mods involving water creatures that could freeze or boil during regular game conditions. So, not sure if I'll get to that this time around."
Individual tissue layers on body parts can sluff off or boil now,
Or creatures whose outermost layer bursts into flame at room temperature, but everything beyond that is completely fireproof, and the creature feels no pain and can't suffocate. The result would be a walking torch.Or a creature with FIRE//MAGMA skin.
Or creatures whose outermost layer bursts into flame at room temperature, but everything beyond that is completely fireproof, and the creature feels no pain and can't suffocate. The result would be a walking torch.
If something is combusting at a sustainable rate, its fire. Some substances can burn at a temperature that's safe to touch, is all.
Zeus made Urist MCurist pregnant.
Urist MCurist did give Birth to a boy.
Hercules MCurist strangles the snake.
The gods died of old age?? :D
"Toady One has arisen as creator of the Universe" - Bay12The gods died of old age?? :D
"God is dead" - Nietzsche
"Nietzsche is dead" - Toady One
Quote"The more relevant applications might be mods involving water creatures that could freeze or boil during regular game conditions. So, not sure if I'll get to that this time around."
Ice creatures, that only show up and attack in the winter in cold areas (or most of the time in freezing areas), or they melt. Or is it possible for an ice creature to melt into a water creature, and still be alive(or animated or whatever)? Survive a phase transition? :)
Every few generations, a dwarf is born with a beard like pure gold--and these dwarves are said to have legendary strength and a fierce temper to match?
I will be sure to mod in 2 extra castes of dwarves. If I can make sure that only golden bearded dwarves can be king/queen, then I will be extremely happy.
Toady from the devlog
Right now it'll do dominant-recessive stuff with the color variables, and it can also do that with the appearance variables or do averaging. It's pretty simple at this point, but what's there now could be used to, say, breed your dogs toward certain colors and body dimensions, as well as whatever facial features there end up being (though the colors and patterns would be limited to whatever is in the raws). Of course, the process might involve a lot of culls as there aren't a lot of controls on which animals breed.
The Asen never aged to death cause they were immortal like the Albs and Darkalbs iirc. All dead among them was done violently. Mostly by loki and his family.
Not to forget the Wanen which were immortal but not unkillable
Freyja would be pretty popular with the dwarves, methinks. if you get what I mean.
Woah hey, breeding. This will inevitably lead to players allowing only the largest, fittest dwarfs to breed.
With the new changes to squad equipment orders, will this also effect hunters?
Shouldn't you be asleep Toady?
Quote from: AqizzarWill gold gas condense into molten gold? Or scatter into gold powder?
Can gold powder be melted into gold bars
Will molten gold cool into usable gold? (Bar? Ore? Lump?)Quote from: NeonivekThen there is the question of if the Gold will turn into a lump of molten gold or coat the walls and floor with gold.
Maybe the liquid state needs a "mist" sub-state
Metal boils at extremely high temperatures, and when it does, it goes away almost instantly. Does this work properly in the game, or does gold vapor hang around like steam?
Quote from: HephWhat about poisonous aerosols? Sarin as Blood for example? Can an dwarf poisoned by inhaling it? Toady how will poisons work? I mean the kind of poison that for example that attacks nerves. Will it damage and destroy them leading to Paralysis? And do we get airborne Poisons? What about the raws for poisons anyways? IIRC there was an template but how does that get extended? How get for example materials handlet that are for Dwarfs poisonous but for elves not?Quote from: FootkerchiefI'm really curious how the sickness stuff will be handled. <list of stuff>Quote from: TormyToady, the poison system in DF will be similar to the Armok I. system? (links post from 2001! with smilies!)
Quote from: TormyI suppose blood will act like an object in the next version, or in the future. What if magma blood will hit a dwarf for example?Quote from: Footkerchief# Req359, CONTAMINANT TEMPERATURE EFFECTS, (Future): Most importantly, metals that melt over creatures should have an effect, but the temperature of contaminants isn't currently stored.
Hopefully that one makes it in.
Any word on poisoned weapons this time around?
Will there be a way to actually view corpse wounds? Will corpses be able to receive more wounds?
Does this mean that hydras won't die if you chop off one of their heads?
IIRC Toady has mentioned something about regrowing body parts a while ago, so yeah, we gonna have this feature in the future hopefully.
Also, Toady....what does this means exactly?
"01/07/2009. Some more unit information for corpses"
Is Toady still in line for a Feb release date?
Has it been indicated in this version whether reactions will be able to both use and create things that are inside barrels or vials or the like, such as alcohol or other extracts/powders/seeds?
I think I saw that the raws have the density of the layers making up creatures. (I could be wrong.) If this is the case, will the weight of creatures depend on how big each layer is? Also, do body parts have layers and layer thicknesses defined individually? (They probably do, just checking.)
What I really want to know is if we can not only have a creature that's a water blob and turns into a living ice boulder when freezing, but having it turn into a living cloud of steam if the temperature is high.
Quote from: SoweluSo! Genetics!
How customizable will this stuff be? Can we specify that a certain trait is, say, recessive... or linked to another certain trait...or make a trait that skips generations...or that is tied to non-appearance features, like personality, or physical ability?
Every few generations, a dwarf is born with a beard like pure gold--and these dwarves are said to have legendary strength and a fierce temper to match?
I'm guessing these are all "very no" for now, but I have hope for the future!Quote from: NeonivekI am glad that Toady also included variables we can set ourselves and all that...Quote from: MephansterasI wonder if Toady will take the next step and add in some type of speciation into some later release.Quote from: HephNow if you could track the genetical mix in populations and subpopulations during worldgen we could get some diverse animal familys.
(Re: golden-bearded monarchs) All this should be doable in the next release.
what would happen if a cast were given both the MALE and FEMALE tags?
eugenics stuff
Quote from: AqizzarShouldn't you be asleep Toady?
I don't even know anymore.
Re: The Golden Bearded Monarchs:
I wanted to have my dwarven kings have beards made of ACTUAL gold. Like the metal. It just sounded like I wanted to have my kings have blonde beards because I was responding to other comments about genetics.
One question though: What happens if the Civ leader position does not have any possible candidates? So, taking my mad scheme, what happens if there aren't any Dwarves with Beards of Gold when the last king dies?
Yeah, I'm quite mindful that when I mentioned people can breed dogs now, of course the enterprising player is going to be doing all sorts of whatever who knows. The timeframe is probably a bit grueling to get anything like that started with dwarves though, as you'd need something like a 12 year fortress to even get started, but the only restrictions I think I'm planning to put in place (in a future release) are having creatures notice when they are being selected against -- it's sort of a tricky problem, but if the last ten dwarves to die all had red beards, I think the other red-bearded dwarves might start to notice and either flee or take action against their leaders, and that's certainly easy enough to code, though applying it outside of a controlled environment like the player's fortress is more difficult. I'm vaguely worried about how much untoward player experiments will crap up the forum with flamewars and racism, but I don't think it'll be so much that it can't be handled properly.Sounds great, I just hope random aquamarine eyebrow rebellions won't pop all over the place.
I just realized an implication of creatures that can explode if wounded.
Draco Vulgaris "Swamp Dragons" Small dragons (~2ft long) that can fly, breathe fire, and have a tendency to explode. Especially if they feel threatened, wounded, excited, or come down with a case of hiccups.
...so it can track the precise amounts up to a point, at which an item is created. This could also allow snow/mud depth effects later on, although that might be merged with items/flows depending on how it works out. It's not a question for the next version in any case...
...And then breed the kittens for greater reservoirs of gold blood.
Who else wants to make kittens have molten gold blood, then drop them down into pits where it will collect into smeltable blobs?
I see we're all on the same page here....And then breed the kittens for greater reservoirs of gold blood.
Who else wants to make kittens have molten gold blood, then drop them down into pits where it will collect into smeltable blobs?
I wonder if Toady realized the kind of psycos that would play his games when he set about developing them...Considering he made Slaves to Armok, I'm going to say yes. Remember, all that depraved stuff in the Pits was Toady's doing.
No, I'm doing platinum blood.I see we're all on the same page here....And then breed the kittens for greater reservoirs of gold blood.
Who else wants to make kittens have molten gold blood, then drop them down into pits where it will collect into smeltable blobs?
DF=DF ; Dwarf -=- Dwarf - Species
BR=GD ; Brown -=- Gold - Hair
BL=BL ; Blue -=- Blue - Eyes
...etc...
A newly found obsession in me. I've read eight of his books in the last month or so. Out of any serious order though, mainly due to availibility at the local public library. Half-way through my ninth read, Men at Arms.I just realized an implication of creatures that can explode if wounded.
Draco Vulgaris "Swamp Dragons" Small dragons (~2ft long) that can fly, breathe fire, and have a tendency to explode. Especially if they feel threatened, wounded, excited, or come down with a case of hiccups.
Woohoo! Another Pratchett fan!
I wonder if varying heights and weights between creatures will lead to the necessity for Toady to invent a dwarven system of weights and measures.
My plan for this release:
1. Create two new materials: spaghetti and meatball
2. Create a megabeast with new materials and [CAN_FLY]
3. ?????
4. Profit!
I'm fairly certain we're not able to cross breed different species, yet.
I just wondered a very specific thought.This seems like a 50/50 thing. Hard to initialize but easy to code. You could take the system we have now for creatures and change it.
Is Toady actually just coding details and then having them pass on, or is he making a DNA substitute for Dwarf Fortress? I know the RAWS apparently don't seem to have anything apparently confusing in them, but the way the game interprets them...Code: [Select]DF=DF ; Dwarf -=- Dwarf - Species
BR=GD ; Brown -=- Gold - Hair
BL=BL ; Blue -=- Blue - Eyes
...etc...
It could pose some very... interesting offspring when modded//hacked, like Half Dwarf/Half Magmaman.
Of course any result from having such a complicated system for values would only be way way way further down the line of development
HUMANOID:2EYES:2EARS:NOSE:2LUNGS:HEART:GUTS:ORGANS:HUMANOID_JOINTS:THROAT:NECK:SPINE:BRAIN:5FINGERS:5TOES:MOUTHA simple genetic code setup could beX:X;DF:DF;BLU:Grn;LRG:sml;HK:but;CLN:CLN;STR:STR;low:HIGH;stf:stf;DMB:smt;AGL:clm With caps as dominate, lower case as recessive and split is shared dominate. Of course you would have to code the genetic order into the creature so that the line would have the proper context and everything, but once the framework is created it shouldn't be to hard.
I have a feeling that the raws will be simplified into this:
ATCGTAGTAACACATGTGCATGGATVAVATCAGTCAGCTATTAGGCGATAATCGCGCGCGCTAATCGATCTTAACTGTTTAGGGCTATATATCTATATTGATTACA
That being the raw code for pointed ears.
What about mutations?
That is mostly the reason I don't think the game should EXACTLY follow genetics.
It allows for much more interesting offspring and greater changes over time.
Also, nerve damage. I guess so you can roleplay that one Bond villain who couldn't feel pain.
And if you really want to mess with genes, try crossbreeding ants in It Came From The Desert
Greater changes over time? I guess the worldgen must run for thousands of years if we would like to see "greater changes". It's not impossible of course, even with the current worldgen it shouldn't be problematic.
Also, nerve damage. I guess so you can roleplay that one Bond villain who couldn't feel pain.Or Thomas Covenant.
Now that is a movie I expect to see on the Scifi Channel.And if you really want to mess with genes, try crossbreeding ants in It Came From The DesertThis is what I read first time round ...
Greater changes over time? I guess the worldgen must run for thousands of years if we would like to see "greater changes". It's not impossible of course, even with the current worldgen it shouldn't be problematic.
Why? Mutation rate is variable. Right now, Earth (http://en.wikipedia.org/wiki/Mutation_rate) has something like 10^-4 to 10^-6 mutations per base pair per generation (people have 23 pairs)
There's not reason not to up it to 1% chance of mutation per 'gene' per generation, although you'd have to define mutation... Color would be easy (RG or B value * .75-1.25 on mutation)
I would love a biological evolution simulator. ::)
Spore
I am ashamed to have bought that game. What I meant in my criticism was to question the necessity of coding actual genes, instead of just, say, 50/50 parental inheritance? Simple Mendelian models. Nothing to the degree of third limbs or body beards coming from 1000+ years of history.
(http://i21.photobucket.com/albums/b257/Kishmond/untitled.png)That's DeviantArt's icon... might be a glitch in your browser.
oh well
(http://i21.photobucket.com/albums/b257/Kishmond/untitled.png)It means you've been looking at too much porn.
oh well
There are games like Evolution: A Game of Intelligent Life (I think that's the full title).
It means you've been looking at too much porn.Can such a thing actually exist?
Just how naughty must a tentacle be to count as unusually naughty?
Just how naughty must a tentacle be to count as unusually naughty?
01/16/2009: 837. Added nails (this will be most apparent once I get the raws back in for things like the big cats, as it'll need to get at the claw material to do damage properly)
Toady, I am wondering...will it be possible to define tooth material also?
I think blood fountains might actually be a reality soon.
^^^ speaking of, does that mean that there are multiple attacks, or one simultaneous attack with two parts, or are there two separate attacks that can come simultaneously? Or am I just over thinking things?
Does this mean my craftsdwarf will be busy crafting +platinum toenail trimmers+ with wild abandon?
Some things just worry me.
I am sure you dont need to trim nails this would be a bit much micromanagement and i am sure Dwarfs and animals will do it themselfs to some extend. Imagine your pettigers scharpening theyr claws on an birch support that holds the entire fort in place.spelling aside, the way tissue growth has been said to not include regrowth- if a dwarf is shorn of beard once grown fully, it's not coming back.
Ranged attacks:
As far as fantasy creatures, both porcupines and manticores are widely stated to be able to shoot spikes, and Pliny (who wrote about any crazy shit anyone told him, like giant ants who dig for gold in iran) mentions a rhinocerous that can shoot fireballs with a range of a mile.
Out of its ass.
Nay.Right up there with making toothbrushes out of actual teeth, using a bonesaw made from a dwarf's right legbones to cut off the same dwarf's left leg, skullcaps made out of skulls, nailing zombie-fish (specifically bass) to the wall and teaching them to sing, and other such abominations. And booze-axes. Axes forged out of magically frozen alcohol that render any non-dwarven enemy struck intoxicated. May be eaten.
Toetail toetail clippers. We do it because we can.
Like Purple Tentacle? That one was naughty in the other sense, and pretty unusual too.
after this next release will I be able to mod in Mosquitomen who kill victims by draining their blood instead of by doing physical damage
after this next release will I be able to mod in Mosquitomen who kill victims by draining their blood instead of by doing physical damage
I did partial fractures today and did some more with healing breaks and scarring, did some changes to permanent deformation wounds (bends/dents on metal creatures for example), handled how heavy bruising and miscellaneous damage causes function loss, did permanent bleeding for wounds like heart bifurcation/throat removal, and refined the contents under pressure characteristics for guts; the ability to grab the exposed guts, attack or sever the exposed guts, the guts getting dirty when they drag on the ground and other such things all came basically for free. There are some dev items on that I guess... you can't yet strangle people with the exposed guts, though I suppose that's now within reach (grabbing the guts now would only open up a pinching attack I think, which would be the least of your adversary's problems). All very disgusting.:o
01/16/2009: 837. Added nails (this will be most apparent once I get the raws back in for things like the big cats, as it'll need to get at the claw material to do damage properly)
Toady, I am wondering...will it be possible to define tooth material also?
The raw files posted last month have a tooth material that's used for the entire tooth BP. So yes. The tissue system would also let you precisely layer enamel and dentin and pulp, if you wanted.
e: does "redefined natural attacks to allow multiple parts (mainly for claws and biting) though it's limited in some ways" mean that attacks can have multiple damage types now too?
^^^ The size of the body part and the relative thickness of the bone tissue play a part, too. And if you wanted to model hollowness directly, you could put an "air" tissue inside the bone and adjust the relative thicknesses so the bone is mostly empty space.
One thing that this makes me worry about is that the sheer complexity of the dwarven body will provide that many more ways for things to go horribly, horribly wrong. After ten years or so years I don't know if I will have any non-crippled citizens in my fortress.
Not that this makes Toady's innovations any less awesome.
Since when dwarves randomly dropping dead from sudden internal organ explosion became not awesome? It makes the game fun. And challenging. You just need a hundred starting dwarves, so that they can survive until the next immigrant wave comes and brings a hundred more.
How about a bad crop of plump helmets causing the ale to become poisonous (well, more poisonous, by human standards) and make half your fortress into bedridden sufferdwarves?
He never did have one for centaurs, it was just a fancy? fancible? some kind of fantastic creature that wasn't present in any form but engravings.
Looking at the dev_now, it seems that Colossi will be in need of a pannelbeaters after a while. While this will lead to having the occasional battered one showing up outside of the fort, does this mean metallic items can get dented now too?
I never figured Collosi to be clockwork. I always thought of them as living statues, like this guy (http://en.wikipedia.org/wiki/File:Harryhausen_Talos.jpg) from Jason and the Argonauts. They just need weak ankles and lava for blood.
I've heard that the human brain is - in many respects, at least - a better processor than a computer. Are you considering a port to a brain anytime soon?
Couldn't it just allow [ I ] -> Gain posession of small intestine, then [ A ] -> Grab neck with small intestine?
'cause that'd be flippin' sweet.
Couldn't it just allow [ I ] -> Gain posession of small intestine, then [ A ] -> Grab neck with small intestine?
'cause that'd be flippin' sweet.
Wrestle -> Gain possession of Right hand
Wrestle -> Punch Head with Right hand
Stop hitting yourself! Stop hitting yourself!
I always pictured the colossi as something like this:
(http://www.wired.com/news/images/full/colossus03_f.jpg)
Except maybe with metal armor, or something. I dunno.
Needless to say, Shadow of the Colossus is amazing.
01/18/2009: 832. Updated about a third of the creatures, including all of the gibbons. I'm not doing anything super accurate with color/patterns for them this time around, as that would take too long.
Quote from: Toady One01/18/2009: 832. Updated about a third of the creatures, including all of the gibbons. I'm not doing anything super accurate with color/patterns for them this time around, as that would take too long.
Huh. I had actually thought about making a proposal that the community could help out with that. Nothing about source-code or programming help, just opening up the raws, which would be opened soon enough anyway, to save Toady the trouble of updating all the fish and trees and birds and gibbons to the new structure.
Huh. I had actually thought about making a proposal that the community could help out with that. Nothing about source-code or programming help, just opening up the raws, which would be opened soon enough anyway, to save Toady the trouble of updating all the fish and trees and birds and gibbons to the new structure.
Huh. I had actually thought about making a proposal that the community could help out with that. Nothing about source-code or programming help, just opening up the raws, which would be opened soon enough anyway, to save Toady the trouble of updating all the fish and trees and birds and gibbons to the new structure.
Yeah, but then the community would have to reach some sort of consensus about style and values. Who wants us to be bickering about the shear strength of bird feathers (primaries, not down! no! it's the coverts!) and how it should differ from species to species so that THIS one needs a type that's slightly stronger or if we don't agree with it then I'll just make my OWN kind!
I think it would be great and I'd love to help Toady out any way I can, but it would add a lot of irritating problems anyway.
Q - can internal parts have a [grasp] option? like, say, a "chestburster", that if you cut the guy open, he suddenly has a bunch of tentacles pop out that each can wrestle you? (until he bleeds out and dies, that is). Cuz that would be beautiful (in a really gross sort of sense).
Didn't someone already do that in a mod? Also, I vaguely remember someone modding in hearts that would bite opponents.
Question for future creature polymorphism. Will it be capable of changing the morph of a creature at a given trigger?
For example, every X in game days?
Yeah, but then the community would have to reach some sort of consensus about style and values. Who wants us to be bickering about the shear strength of bird feathers (primaries, not down! no! it's the coverts!) and how it should differ from species to species so that THIS one needs a type that's slightly stronger or if we don't agree with it then I'll just make my OWN kind!On any other forum, I would agree that this is exactly the sort of thing that would happen. But this is DF: we have a hierarchy among posters that should help settle disputes. I, for example, know damn well that I am a second class forum stooge compared to the hardcore sonsofbitches among us who have beards growing out of their beards in an infinite recursive tree of dwarflyness. I am at best a humble petitioner before their intoxicated might. But, with all seriousness, I think most forumgoers recognize those who aren't talking out of their unwashed, wrinkle-shrouded asses.
I think it would be great and I'd love to help Toady out any way I can, but it would add a lot of irritating problems anyway.
Toady already set up so that it is possible to have an outer Liquid layer that doesn't fall appart right?
Like Slugs and Snails would have right?
Now if only we could find a way to embark on a rock salt mountain with slugmen and have the obvious result happen...
Arguments about the strength of cardinal feathers will probably break down into one poster giving what seems to them like a decent set of numbers, a second poster asking if that was loadbearing feathers or down, the first saying loadbearing but then giving what he thinks would work for down, a third comparing said numbers with the strengths for known materials and suggesting corrections, and a fourth (this one a hardcore rawmonkey) picks the winners and craps out everything in raw forms. This isn't like the arguments on the magic system and other such hullabaloo that we keep seeing gangrape the suggestion board... its really rather straightforward.
Aren't warthogs in there? I just updated them, so they are in some version of the raws.
Aren't warthogs in there? I just updated them, so they are in some version of the raws.
This is completely subjective of course, but I've never seen one, along with quite a few other creatures that should be present. Warthogs, mudmen, worms, treants, satyrs, and most of the gibbons, if they show up at all, are so vanishingly rare that I've never seen an example other than in the 2D versions.
This is completely subjective of course, but I've never seen one, along with quite a few other creatures that should be present. Warthogs, mudmen, worms, treants, satyrs, and most of the gibbons, if they show up at all, are so vanishingly rare that I've never seen an example other than in the 2D versions.
Where do Mudmen live?
Where do Mudmen live?... in the mud?
Where do Mudmen live?
Subterranean water, apparently.
Are you sure they arent just an engraving thing like Centaurs and Wizzards?
I always disliked seeing 'run fast' and 'shoot well' being combined, and dexterity is also important for crafting stuff.
So... who are the hardcore sonsofbitches among us who have beards growing out of their beards in an infinite recursive tree of dwarflyness?Of the posters I regularly see, Footkerchief and Aqizzar exude the rank aroma of dwarfliness to the point of firehazard. Their pits are actually thinly disguised air-fuel bombs. I wish to bear their manbabies.
So... who are the hardcore sonsofbitches among us who have beards growing out of their beards in an infinite recursive tree of dwarflyness?Of the posters I regularly see, Footkerchief and Aqizzar exude the rank aroma of dwarfliness to the point of firehazard. Their pits are actually thinly disguised air-fuel bombs. I wish to bear their manbabies.
Infinitely recursive beards made out of flagellating masses of meter long sperm driving them eternally forward into ever greater awesomeness through their writhing.
When in doubt, either abstract horror, or heartfelt gratitude tend to work. There are, of course, a few emotions in between these two. That does not mean you should feel them however.Infinitely recursive beards made out of flagellating masses of meter long sperm driving them eternally forward into ever greater awesomeness through their writhing.
I really don't know how to feel about this.
First job when this new stuff comes out: ALCHEMY MOD.Can't you do that now?
For all the good it'll do. Lead -> Gold, maybe something useful like Microcline -> ??
Definitions and words aside, I don't see any way to distinguish the concept "physically good at fine manipulation with hands" in the new attributes.
What happens if the Civ leader position does not have any possible candidates? So, taking my mad scheme, what happens if there aren't any Dwarves with Beards of Gold when the last king dies?
Toady, will these new genetics changes mean that the dwarves/elves/etc. will select among the populations without any player interaction? I.e. will a dwarf who likes brown be more likely to marry/friend/etc dwarves with brown hair and eyes, without the need for the player to lock the two in a tower together?
If so, how far would this selection go (just friendships, or anything up to potential wars)?
I am curious about how the game tracks 'fear'. I know small critters like groundhogs, etc. will flee from an adventurer, but just about anything larger will attack you. Is there an actual mechanism for determining when even a weak creature will attack you? So, if you're lying down bleeding to death, creatures that normally would avoid you will come out and finish you off?
Toady, i know i am a bit nitpicky about that but please dont forget that some genes for traits can only be found on X or the Y chromosom rendering some at an woman rezessiv genes at an male as dominant. If such an Gene is on the Y Chromosom it only affects male breedinglines. Also there are intermediate and kodominant effects on genes that affect the traits of an individual.
Quote from: Footkerchiefdoes "redefined natural attacks to allow multiple parts (mainly for claws and biting) though it's limited in some ways" mean that attacks can have multiple damage types now too?Quote from: bjlongdoes that mean that there are multiple attacks, or one simultaneous attack with two parts, or are there two separate attacks that can come simultaneously? Or am I just over thinking things?
So will we be able to slice open people's torsos and rip out their hearts?
Couldn't it just allow [ I ] -> Gain posession of small intestine, then [ A ] -> Grab neck with small intestine?
Toady are you doing different kinds of bone Fractures? Like debris Fracture hairfractures etc. maybe even with spliters ricocheing throught the surrounding tissues?
What changes (if any) are you planning for the fighting AI (what there is) to account for the new bodies and all the new ways to kill things?
Hmm...speaking of wrestling, will the new squad equipment orders make wrestlers put back on all the cloths that they take off each other eventually?
Question for future creature polymorphism. Will it be capable of changing the morph of a creature at a given trigger?
Toady with new raws and all do we get the chance to set things on fire? I mean on will and without firebreath, Fire-imp-remains or magma.
Also ,since i am at fire, i didnt check with the raws but do we have an "Thermal conductivity" for materials?
agility
Are we able to see the genetic informations on the legends screens?
Also do you have anything on the list noone would guess you have on the List (new HFS etc.)?
[The equipment] system will work like what I've suggested? Can you post some details about your plans regarding the equipping method/system?
If i have several castes of different sizes, some size 4, some size 9, and some size 10. How will armor and clothing be handled? What sizes will be considered small, large, and narrow? Will i be able to specify a specific size when i am making it?
Quote from: HephToady with new raws and all do we get the chance to set things on fire? I mean on will and without firebreath, Fire-imp-remains or magma.
Also ,since i am at fire, i didnt check with the raws but do we have an "Thermal conductivity" for materials?
I don't understand the first part. You can set an ignition point.
Quote from: Tormy[The equipment] system will work like what I've suggested? Can you post some details about your plans regarding the equipping method/system?
I don't have details yet. I don't think assigning each dwarf a specific item is the way to go necessarily, as it's irritating and also invades on their autonomy somewhat. I'm not strictly against it though, as you should be expected to be able to intrude on them a bit when it comes to military matters. Certainly just saying "axe + chain" for each dwarf can be improved to some squad level + material settings, with options for individuals to override them, but it's not completely settled at this point. It'll also have to merge in with the familiarity stuff on the list, which will somewhat replace not having settings for the elite ones at all.
Also, for questions specifically about the list... they'll probably work better over there. I'm not sure how I'm going to handle having two threads like this, since there's already some answering that needs to be double posted or something.
Wow. Lots of fun stuff here. Thanks again for posting the answers to all these questions.Second'd! This next release is going to be more incredible than the transition to 3D!
On subject of giving us nifty genetic stuff from the legends screen, any chance you could also add in a legends text dump option at this point? Doesn't have to be fancy, just some way for those of us who REALLY want to dig through everything to do so.
Basically, I'd like to be able to write a parser for the Legends data so I can grab out information I want. Things like everything about a particular war, or every war that X civ has been in, or whatnot. I know you said it's a huge file, which is why I'm suggesting that it be a specific option that people have to hit in the legends screen.
XML would probably be best, but really I'm fine if it's a basic text file like the site/population files currently dumped out at world gen.
They arent in the game i think but they seem much like Demons. Just apply the right spheres and they should work thought they would be treated like an power and not as servants iirc.
The regional forces might end up looking like minor gods. Spirits of fire and some of the other element-men are a lot like elementals. But if you mean something like planar beings in the D&D sense, I suspect that'll have to wait until we actually have other planes (which are in the dev notes, but only as a far-future thing).
Psssh, anyone who cares if crows and ravens are different. They taste and look the same on a dinner plate.
Psssh, anyone who cares if crows and ravens are different. They taste and look the same on a dinner plate.
The regional forces might end up looking like minor gods. Spirits of fire and some of the other element-men are a lot like elementals. But if you mean something like planar beings in the D&D sense, I suspect that'll have to wait until we actually have other planes (which are in the dev notes, but only as a far-future thing).
Well Planar beings perhaps, that is one great way to do it.
But more or less I am refering to supernatural beings and entities of various power with the motivation of furthering their patron diety's goals and possibly getting them worship.
Or perhaps Non-civ natural beings. (Afterall I believe Odin had Crows)
I thought crows were a murder.
I thought crows were a murder.I wasn't using the "technical" terms, I was describing how they act.
A quick question, in the event of civilized species with more castes than a simple male/female gender with noticeable differences, will new adventurers be able to pick between them?You already can. I forget where, but while creating an adventurer, you can press 'g' to change gender.
A quick question, in the event of civilized species with more castes than a simple male/female gender with noticeable differences, will new adventurers be able to pick between them?You already can. I forget where, but while creating an adventurer, you can press 'g' to change gender.
A quick question, in the event of civilized species with more castes than a simple male/female gender with noticeable differences, will new adventurers be able to pick between them?You already can. I forget where, but while creating an adventurer, you can press 'g' to change gender.
Of course, this question deals with castes and species that suffer from an excess of genders. How would that be supported? Just using the g key to alternate between worker ants and the queen?
A quick question, in the event of civilized species with more castes than a simple male/female gender with noticeable differences, will new adventurers be able to pick between them?You already can. I forget where, but while creating an adventurer, you can press 'g' to change gender.
Of course, this question deals with castes and species that suffer from an excess of genders. How would that be supported? Just using the g key to alternate between worker ants and the queen?
It could be reworked to where the "g" key cycles between adventure-capable castes.
A quick question, in the event of civilized species with more castes than a simple male/female gender with noticeable differences, will new adventurers be able to pick between them?You already can. I forget where, but while creating an adventurer, you can press 'g' to change gender.
Of course, this question deals with castes and species that suffer from an excess of genders. How would that be supported? Just using the g key to alternate between worker ants and the queen?
It could be reworked to where the "g" key cycles between adventure-capable castes.
Which would be grand. We just need confirmation from the toadster.
On that note, would you need a distinct [NOT_ADVENTURE] tag or somesuch to prevent players from playing as Antmen queens?
Psssh, anyone who cares if crows and ravens are different. They taste and look the same on a dinner plate.
phah. crows are mobs. ravens are packs.
Misbehaving Crows are a nuisance, 'misbehaving' ravens are a menace.
A job you could queue up- you can deconstruct and construct the queen elsewhere.That... just doesn't sound right. In fact, it sounds so not right that I fully expect a fully illustrated crack-fic showing just that will show up on 4chan's /b/ any day now. Lovely.
phah. crows are mobs. ravens are packs.
Misbehaving Crows are a nuisance, 'misbehaving' ravens are a menace.
Actually, a group of crows is a murder (as already covered), and a group of ravens is an unkindness. On a somewhat related note, a group of turtles is a bale, a group of foxes is a skulk and a group of jellyfish is called a smack. Oh yeah, and it's kangaroos that group in mobs.
Yeah, animal group names get pretty silly.
Even better, a group of ferrets is a 'business'. What kind of business ferrets are in I am not sure, loansharking maybe. Which gives rise to another idea, ferrets as a pet choice. Ferrets have been kept, much like cats, to keep dwellings and stores clear of vermin historically, and being burrowing critters might be a better match for the subterranean dwarves.
Yes very horrible by the way if you dont bath them as often as you bath yourself.
Even better, a group of ferrets is a 'business'. What kind of business ferrets are in I am not sure...If you ever kept ferrets, you'd know, because you'd be knee deep in their 'business'
Psssh, anyone who cares if crows and ravens are different. They taste and look the same on a dinner plate.
phah. crows are mobs. ravens are packs.
Misbehaving Crows are a nuisance, 'misbehaving' ravens are a menace.
Actually, a group of crows is a murder (as already covered), and a group of ravens is an unkindness. On a somewhat related note, a group of turtles is a bale, a group of foxes is a skulk and a group of jellyfish is called a smack. Oh yeah, and it's kangaroos that group in mobs.
Yeah, animal group names get pretty silly.
Ferrets also love shiny objects and can break the sound barrier if fed sufficient quantities of raw sugar.Techhead here has obviously been archive-trawling Sluggy Freelance lately. Kudos.
After being prodded with a squid-on-a-stick they can breathe fire.
Yes I have. If by "Archive Trolling" you mean read 11.5 years of a daily strip in a week and a half.
Fun stuff.
This thread since it veered off course, for example.
Sorry, I was "Archive Binging" and I mistyped/Freudian-slipped trawling.
On the subject of archive binging, I just finished El Goonish Shive, including the fillers and NPs. I am a webcomic addict...
I've read all of the following, in no particular order. Quality may vary, and some of these no longer update.Spoiler (click to show/hide)
Sorry, I was "Archive Binging" and I mistyped/Freudian-slipped trawling.
On the subject of archive binging, I just finished El Goonish Shive, including the fillers and NPs. I am a webcomic addict...
I've read all of the following, in no particular order. Quality may vary, and some of these no longer update.Spoiler (click to show/hide)
His arch enemy would be the rich, smart, handsome kid with the incredible social life and is loved by all.
There's also Mr. Society, The Parents Duo, and Lord Censorship.
legend dump chat
I meant starting an Bushfire, making an little campfire out of logs, burning down an Barn, burn away some worn out clothes as form of garbage disposal and things like this.
As long as most things are getting updated, would there be a possibility of allowing "Special" attacks to be applied in Adventure mode? Webs and stings and the like.
chat about various powers and their servants and things
Since embedded weapons now cause bleeding to remove, does that mean we can have barbed arrows, spears, and javelins that cause more bleeding to pull out in some later version?
castes in adv mode
Quotelegend dump chat
Yeah, it'll be a reasonably large file, but the real problem is that because the text is not stored but generated when you look at them, it'll also take forever for it to run through on a decently-populated world (as it often has to pull up and grab critter names from id numbers and so on). I'm not sure quite how long forever, but I'll consider doing something with it this time around if it won't take too long to set up (can't commit, as it is set up to generate the stories for display not in plain text but in my silly ass text viewer format).
DittoQuotelegend dump chat
Yeah, it'll be a reasonably large file, but the real problem is that because the text is not stored but generated when you look at them, it'll also take forever for it to run through on a decently-populated world (as it often has to pull up and grab critter names from id numbers and so on). I'm not sure quite how long forever, but I'll consider doing something with it this time around if it won't take too long to set up (can't commit, as it is set up to generate the stories for display not in plain text but in my silly ass text viewer format).
Ah, I guess that does make it a little bit harder to implement. Still, I'm ok with my computer sitting and churning out a massive file for a few hours if you manage to get the code hooks in to do it.
Thanks as always for the responses!
I am rather excited about the wound updates... but things like gangrene scare me.
Not that I don't want to play with them eventually, but I'm worried they'd be a barrier to me figuring out the other stuff in the new release, I think.
Will disease be turn-off-able in the init file like invasions and cave-ins?
that and shops will start selling peg legs, hook hands and eye patches.
...also, pennecillin.
Well we have an healthcare ability and herbalism. So i would advice you to hire an Doc for your party or get some own knowledge.
Also its not like that you get the Black death at every second corner. DF isnt an Siera point and click adventure.
I mean heck... You die... By swimming in Water that freezes over you instantly! If that ISN'T a Seirra death I don't know what is.
I eventually want to be able to start as a naked adventurer just outside a human village, slowly build my way up in the community, and then help fend off an elf invasion. Then when an army starts gathering, join up with it, and march through the wilderness to the elven retreat. Then the night before battle the elven hunters find the camp, and begin shooting into the troops. I get hit in the arm with an arrow, but I manage to dodge the rest of them as they massacre the army. I wonder around for days in the wilderness, thankfully avoiding predators, but with the wound slowly being infected. Then die alone, and unknown in a bog imagining Crowmen coming for my body as the fever dreams grip me.
I eventually want to be able to start as a naked adventurer just outside a human village, slowly build my way up in the community, and then help fend off an elf invasion. Then when an army starts gathering, join up with it, and march through the wilderness to the elven retreat. Then the night before battle the elven hunters find the camp, and begin shooting into the troops. I get hit in the arm with an arrow, but I manage to dodge the rest of them as they massacre the army. I wonder around for days in the wilderness, thankfully avoiding predators, but with the wound slowly being infected. Then die alone, and unknown in a bog imagining Crowmen coming for my body as the fever dreams grip me.
That right there is the epitome of the slogan Losing is fun!
Or an example of how insane your average DF player is. Either way.
Medicines would finally convince me to crank out the glass vials for an alchemist. Especially painkillers. Especially if my military can dope themselves up in advance, and then keep fighting with no legs and a dozen bolts in their gut.
Medicines would finally convince me to crank out the glass vials for an alchemist. Especially painkillers. Especially if my military can dope themselves up in advance, and then keep fighting with no legs and a dozen bolts in their gut.The goblin swordsman strikes Urist Hammermurders in the lower body!
I don't want to see that.
--except maybe from zombies. Grahgh!
I mean, how would a severed head attack? Wait for the enemy to put his foot i your mouth? By then, you're dead.
Well... I figure if your dwarf is that frenzied and incapable of fear or pain he should be able to live at least a couple of seconds without a lower body. For god sakes the disembodied head from a victim of decapitation should be have one last chance to latch onto the neck (or ankle) of an adjacent creature when severed.
Tell me you don't want to see that.
Reading Toady's latest stuff, I'm all of a sudden really hoping that goblins start turning up with poison arrows. I don't know why.
This warrants a question. How will poisons/weapon coatings operate in dwarf mode?
Will there be a Poison Weapon job at the Alchemy workshop?
I'm thinking the soldiers would do it themselves. They would go to the local poison stockpile and dip their weapon in it. Or smear it over the weapon, whatever.
seems like a Y/N on the unit screen. 'Dwarf Poisons Weapon?'Considering we could have them smear their weapons with antibiotics, anaesthetics or even healing salves, sparring could be less dangerous.
How much fun will this be with sparring?
Adventure mode characters had better be able to smear things on their weapons too. I can see a new contest: The adventurer with the greatest variety of poison, blood, ichor and vomit encrusted onto their axe wins!...Mud, strange white goo, goo, molten stones, molten metals, ash, rain, etc...
Since a "Coat weapons with what?" would be difficult to use when sorting through every single dippable, assign a barrel/vat/chest-o-vials per squadron. Squad goes over, coats their weapons, then continues on their merry way.
Since a "Coat weapons with what?" would be difficult to use when sorting through every single dippable, assign a barrel/vat/chest-o-vials per squadron. Squad goes over, coats their weapons, then continues on their merry way.
That could work. Simple and logical idea.
Since a "Coat weapons with what?" would be difficult to use when sorting through every single dippable, assign a barrel/vat/chest-o-vials per squadron. Squad goes over, coats their weapons, then continues on their merry way.
That could work. Simple and logical idea.
Seriously... Nice
You missed 'the tears of an orphan child'. No bonus points for you.Adventure mode characters had better be able to smear things on their weapons too. I can see a new contest: The adventurer with the greatest variety of poison, blood, ichor and vomit encrusted onto their axe wins!...Mud, strange white goo, goo, molten stones, molten metals, ash, rain, etc...
The one request I have for this next release is that cliffs that are steep enough don't have ramps all over them.
Yeah we had those, but it lead to not being able to get places a lot of the time so the world gets smoothed before play. Proper cliffs will be back in with climbing.
Actually, speaking of climbing: Is that coming up in the near future? Because I thought about it today and chasms are never really going to be menacing again until things can actually climb out of them
climbing and SPAWNING in caverns are both important.
I want to reenact Pitch Black with a handful dwarven colonists disturbing the ground and unleashing a bajillion evil beasties of darkness.
well, in the Pitch Black case the entire world (practically) is hollow and there is an entire Underdark going on (from which seas of evil bat things, flying sharks and hulking blind beasties all emerge "once every ___ years during the eclipse of all 4 suns." or something to that effect.)... so they all live down there and crawl up into "higher" tunnels when disturbed by folks digging (be it diggin wells, or caves). I know this infringes on the HFS thing, but for cave beasties coming out of caverns it kind of makes sense, after all, they extend down farther than you can dig.
my point was that bottomless pits and the fissures-in-the-earth are a good place to start for spawning cave creatures because they extend off the bottom of the map.
Will disease be turn-off-able in the init file like invasions and cave-ins?
This warrants a question. How will poisons/weapon coatings operate in dwarf mode?
Actually, speaking of climbing: Is that coming up in the near future?
Quote from: Warlord255This warrants a question. How will poisons/weapon coatings operate in dwarf mode?
I'm not going to allow that until the ethical framework and repercussions are in place. Dwarves with poison weapons seem strange to me, so I'd like to do that stuff first before I worry about the interface, jobs and storage. That is, you'd be allowed to make that decision, but it would cause quite a fuss in general.
Anything off the edge of the map is fair game for spawning. So: River edges, underground river edges, chasms at the edge of the map, chasms at the bottom of the map, magma tube bottoms... and the top layer of the sky.
Imagine eldritch horrors descending from the heavens. Mwahaha.
Why do the words "Geneva Convention" pop into my head? :D
[...] Once there, all dwarfs found to bear axes or axe bears will be arrested and eaten as is only just and fair."
[...] Once there, all dwarfs found to bear axes or axe bears will be arrested and eaten as is only just and fair."
Bwahahaha. I wonder what the Elves care about axing undead things.
[Quote from: Warlord255This warrants a question. How will poisons/weapon coatings operate in dwarf mode?
I'm not going to allow that until the ethical framework and repercussions are in place. Dwarves with poison weapons seem strange to me, so I'd like to do that stuff first before I worry about the interface, jobs and storage. That is, you'd be allowed to make that decision, but it would cause quite a fuss in general.
I wonder if they'll still eat them.
I wonder if they'll still eat them.
A better question: Will elves eat undead megabeasts during worldgen?
I wonder if they'll still eat them.
A better question: Will elves eat undead megabeasts during worldgen?
Ha I can trump that, will elves eat undead megabeasts composed of the undead bodies of elf children.
and lets put one of those beefy arms on the back of his neck for good measure.Reminder that dwarves admire sea serpents (http://www.dwarffortresswiki.net/index.php/Sea_serpent) (depicted as an S) for their Majesty.
Quoteand lets put one of those beefy arms on the back of his neck for good measure.Reminder that dwarves admire sea serpents (http://www.dwarffortresswiki.net/index.php/Sea_serpent) (depicted as an S) for their Majesty.
Ha! YES! Shave off their beard as a punishment! I seriously want this implemented for minor offences (ignored noble mandates mainly).
No, not the philospher!! Do the duke or something.This is a well-crafted glare. It menaces with spikes of menace. On it is an image of Toonyman in light. Toonyman is eating his words.
Then there is Dwarf Manager. Useful as hell.
Nano Fortress would be sweet. They really force you to take advantage of every level. That is, unless a massive magma pipe is in the way or something. That REALLY teaches you how to manage your z-levels.
Then there is Dwarf Manager. Useful as hell.
But yes, awesome stuff. Now I can find how brutally my hunters die to the nearest giant lion attack.Can't you do this already, by counting the severed body parts?
But then you can't see how the hunter feebly swats at the lions back as it viciously mauls him.But yes, awesome stuff. Now I can find how brutally my hunters die to the nearest giant lion attack.Can't you do this already, by counting the severed body parts?
What is this nonsense?What are you doing here chicken? This is a forum. Chickens do not belong on forums. You can't even type.
It makes no sense whatsoever!
Hey look, a chicken!
What is this nonsense?What are you doing here chicken? This is a forum. Chickens do not belong on forums. You can't even type.
It makes no sense whatsoever!
Hey look, a chicken!
I fixed the brain problem. As expected, it was flipping all of the relations so that the brain was around the skull, and the lungs and heart surrounded the ribs like ribs, that sort of thing.
This once venerable thread hasn't had an actual devlog related entry in like a week.Quote from: DevlogI fixed the brain problem. As expected, it was flipping all of the relations so that the brain was around the skull, and the lungs and heart surrounded the ribs like ribs, that sort of thing.
Aw, we all expected some worldbreaking screw up like this, but we didn't get to see it ourselves. And I have this awesome image of a dwarf with brain smeared all over his head and lungs popping out of his shirt.
Hmm... Aren't they already composed of beard? Though I guess all those organs have to come from somewhere.
I'm totally making beard golems as some kind of superdwarves.
I fixed the brain problem. As expected, it was flipping all of the relations so that the brain was around the skull, and the lungs and heart surrounded the ribs like ribs, that sort of thing.
Toady:
Have you considered the possibility that it would be better (easier and maybe even cheaper) to run two desktops rather than the hassles of dual partitions?
Toady, please let us see the first test of the appearance descriptions! Especially if you're going to change the dwarves' appearances before release. I have to see these trainwreck fugly zeroth edition dwarves.
Toady, please let us see the first test of the appearance descriptions! Especially if you're going to change the dwarves' appearances before release. I have to see these trainwreck fugly zeroth edition dwarves.lol, thirded
There was a dwarf with one eye bugged out and one eye sunken in with colorless irises and one quadrant worth of teeth ten times as long as the others and the nose shrunken down to nothing. He was also a little shorter than the average dwarf, and beardless, because it grew out those teeth instead.
^ Ahah, I just wanted to post about this latest devlog. I lol'ed at the "He was also a little shorter than the average dwarf, and beardless, because it grew out those teeth instead." part. ;DI wouldn't call myself "Talented" (more like proficient), and I'm not sure this one fits, but here you go:
Yeah, seriously....some talented fella needs to draw this indeed. :D
...various index misalignments caused certain asymmetries to arise. The problems were too serious for the text to cope -- it was expecting symmetry, so it just wouldn't display the worst problems (I've been working from numeric outputs, and I don't yet have the screenshots some people wanted). There was a dwarf with one eye bugged out and one eye sunken in with colorless irises and one quadrant worth of teeth ten times as long as the others and the nose shrunken down to nothing. He was also a little shorter than the average dwarf, and beardless, because it grew out those teeth instead.
^ Ahah, I just wanted to post about this latest devlog. I lol'ed at the "He was also a little shorter than the average dwarf, and beardless, because it grew out those teeth instead." part. ;DI wouldn't call myself "Talented" (more like proficient), and I'm not sure this one fits, but here you go:
Yeah, seriously....some talented fella needs to draw this indeed. :D
(http://i42.tinypic.com/2s13vns.png)
Three Kingdoms. I'd read through all but the final of four volumes of it.Not much of an issue if you're an elf.
It taught me that the singular most important feature for defeating your opponent in battle: supply lines. I imagine that'll be a brilliant part of the army arc. How do you keep your soldier's fed?
Three Kingdoms. I'd read through all but the final of four volumes of it.Not much of an issue if you're an elf.
It taught me that the singular most important feature for defeating your opponent in battle: supply lines. I imagine that'll be a brilliant part of the army arc. How do you keep your soldier's fed?
it's almost as if you'd have to have a temporary fortress type set up during the army arc. how can your dwarven army perform without a steady supply of booze? forage for prickle berries, now cut down those trees for barrells. dig an underground path to the brook so that we can provide water to the wounded. build fortifications, we need to hold this position until the reinforcements arrive. you there, hauler, you're now the new standard bearer, since the old one took an arrow in the ankle.
it feels like mood spirals could defeat an army in addition to destroy a fort.
so excited!
I was more worried there was something wrong on Toady's end. Like, maybe he got burned down like a Buddhist monk or something.
As you might want to gather and treat the wounded without the benefit of tables or beds (due to resource constraints or otherwise), I went with an activity zone for the hospital. I've added a few options to activity zone placement to make that a little easier (they can overlap now, you can flow them out like rooms, and delete a single zone regardless of overlaps). This'll also be a good test for using zones for things like dynamic workshops (way) later if things go that direction, as hospital zones will need to manage several buildings. It might also be useful for some military applications for this release.
In any case, next up are the specific goings-on at the hospital. Unfortunately for the critters, this means repeated applications of (1) create a hospital zone and staff settings (2) debug-chop a dwarf (3) see how it goes.
The broken-armed dwarf understood that he needed to run off to the hospital zone properly, but care never came, because I'm still working on that. Poor little buddy.
"Come quickly Dr. Urist, his bones need setting!"
"Huh, wuzzat? Sorry, but these trade goods simply must reach the depot."
Can you imagine the medic?
He doesn't care about anything anymore.
...
"Dr. Urist, why are you moving trade goods instead of helping our wounded comrade?"
"Because FUCK YOU!"
Dude, dwarven doctors would probably all be like House.
He's now surrounded by many skilled medical professionals.
Does this mean that medical care will have its own skill now?
The current idea is to allow the chief doctor to be appointed by you. The others are treated like any other profession -- I'm going with the historical model that surgeons/etc. didn't enjoy a special place in society for the time being, so you can just turn the professions off and on. However, I'm considering starting up a notion of "knowledge" as opposed to skill, so that picking some random guy to perform surgery through trial and error might not be the best idea. However, if I don't get to that, then it'll be just like starting up a new blacksmith from scratch (which is equally silly).
"Healthcare" is gone -- there are currently 7 new labor settings, 5 unit types, and 6 skills. I've grouped the entire vpl list into 15 sections to make it easier to mess with (I'm aware of further changes people want there, but I can't do it all now).
The chief doctor wouldn't be necessary but would allow you to get a good overview of your wounded dwarves (as the bookkeeper does with stocks). Other abilities will depend on how it plays out (things like prioritization or whatever).
As for tools, the default would be to handle it like other jobs, which would leave all these concerns about scalpel edges for later. The items surely coming in are things like splints, traction benches, plaster, plaster casts, and then the use of thread/cloth for sutures and bandages. I'm not going to handle restacking right now, but I might do amounts within a single object to handled the medical use of thread/cloth. That might save some headaches versus turning cloth into 10 or 100 bandage items to scatter around, although it implies headaches of its own. Not 100% clear yet. I might do surgical equipment, but it might be early. I kind of want to think about all the other jobs when I do that.
Urist McDoctor cancels Give Water: It's not Lupus.In Dwarf Fortress, Lupus is another word for Lycanthropy.
Just checking here just to be safe (since searching is difficult)
Has it already been suggested to use the Original Armok system where mod-sets (or rather sets of creatures) can be kept in seperate files so that you can chose which ones to generate worlds with?
I am thinking of putting that in the suggestions as well as possible "Theme" tags.
Just checking here just to be safe (since searching is difficult)
Has it already been suggested to use the Original Armok system where mod-sets (or rather sets of creatures) can be kept in seperate files so that you can chose which ones to generate worlds with?
I am thinking of putting that in the suggestions as well as possible "Theme" tags.
Yes I think that this has been suggested already.
Yes I think that this has been suggested already.
I searched and wasn't able to find anything aside from Neonivek mentioning it in another thread (http://www.bay12games.com/forum/index.php?topic=32911.msg479548#msg479548).
So I was just looking over the wounds/combat things and I realized that I did not see swelling, does anyone know if this is in? Sprained ankles etc, should certainly be in, in which case toady would probably need to deal with which layer swells....
I think that's just for poisons, though, not wounds.
I think that's just for poisons, though, not wounds.
Are wounds a separate material type? Could we make the wounds poisonous?
I wonder if they'll have amputation as a health-care option. Maybe for severely mangled limbs that are losing a lot of blood, or to stop migrating fatal poison.
I wonder if they'll have amputation as a health-care option. Maybe for severely mangled limbs that are losing a lot of blood, or to stop migrating fatal poison.
Well, the health care list does have:
# Surgery to remove rotten tissue
So if the rotten tissue is a limb, I imagine the result would be more or less an amputation.
There might be even personality patterns for that, "likes to sever bodyparts", or something to that effect.
There won't be amputation of a rotten brain or spinal cord because the patient will die if these parts begin to rot.
I could definitely see the Dorf Doc deciding that Urist needs the excess fluids drained from his/her skull after getting choked while sparring.
peg legs, hook hands, and eye patches!YES! YES! A THOUSAND TIMES YES! Hotness and love.
What about peg faces (http://drmcninja.com/issue2/2p30.gif)?peg legs, hook hands, and eye patches!YES! YES! A THOUSAND TIMES YES! Hotness and love.
periodic attacks and toppled equipment. Up to five varied layers are placed at the intermediate level. It'll need to handle local realizations next.... toppled equipment? What does that mean?
It's official, cats now have [BUILDING_DESTROYER:2].
I wonder if there will be unique creatures defined in the RAWs where only one may exist at a time
QuoteI wonder if there will be unique creatures defined in the RAWs where only one may exist at a time
There are many interesting ways to impliment that. Though I havn't heard much.
However in the future there will be a version of this by the way of "Randomised" creatures as well as "Alligned/Spherical" creatures.
hay TOADy? Will all of these new things happening in the new version, will it be harder to modd the Raws? also, when are we looking at for the next release.
Toady places a bunch of Shortcuts in his codes.
If you look at the RAWs you will often see that Wolves, Bears, Tigers, Humans, Monkeys, Apes and such as almost EXACTLY THE SAME!!!
Of course it'll be ASCII multi-colored lighting. However that works.
am I the only one concerned that these underground layers will mess a bit too much with building a fortress ?
they seem rather exsessive
I personally like them huge as it gives a real possibility of something being down there like cities.
Heck I wouldn't mind them even larger, say... the size of a country.
hay TOADy? Will all of these new things happening in the new version, will it be harder to modd the Raws? also, when are we looking at for the next release.
Well I can safely state that it will require much more time to mod the game. [Take a look at the new creature raws for example...] Harder? I don't think so...as for the release date....who knows...let's hope that it's gonna be released in august-september at latest. :)
Where?
Yeah, Vanilla DF Female dwarves do not have beards. But Toady decided to be nice and make it easy for anyone who wants them to have beards to change it.Not on their faces anyway...
Can't toady bring back the old magma rivers, i miss those guys.
Can't toady bring back the old magma rivers, i miss those guys.
He probably will, once he's got all the current underground issues flattened out.
Can't toady bring back the old magma rivers, i miss those guys.
He probably will, once he's got all the current underground issues flattened out.
# 04/18/2009: I messed around with pillars and passageways today. I haven't taught it about dead-ends at all yet, so everything is still fairly open. Plants and critters next.
layer 107: layer top
layer 106
layer 105
layer 104: most stuff here
layer 103
layer 102
layer 101: layer bottom
Scamps is attacking threetoe? ::)
Threetoes avatar looks like a guinea pig known also as Cavia porcellus (http://en.wikipedia.org/w/index.php?title=Cavia_porcellus&redirect=no).
Threetoes avatar looks like a guinea pig known also as Cavia porcellus (http://en.wikipedia.org/w/index.php?title=Cavia_porcellus&redirect=no).
I have no idea why people pronounce the Guinea Pig as Ginnie pig.
Which is why I don't even attempt to spell it.
Scamps is attacking threetoe? ::)
Threetoe is a rabbit not a Sloth.
Or another animal I cannot spell without embarassing myself.
Today's devlog: Unlimited animalmen attacks with crude weapons, unlimited wildlife. Troglodyte EVERYTHING.
Toady just put up a special sub-entity type thing to let underground animalmen have weapons/clothes without having to track each individual as a historical figure and also possibly without having to have settlements. That's actually something i suggested some time back.
WOO! :D
This paves the way for a similar sub-entity thing for intelligent (semi-)megabeasts. No more titanic nudists, and bronze colossi can get ginormous suits of bronze armor and huge bronze weapons. From what i understand about what he just set up, you can apply it to aboveground creatures without any hitches already, so we can get ogres with clubs and tigermen with spears etc. Awesome.
something that could theoretically be exhausted but wouldn't happen in practice in dwarf mode, as they don't have to send every last critter after you while they breed back up and you can't currently hunt all of them down
I hope that means also demons with adamantine weapons and maybe armor.
When ever I hear something like that, I never believe them. To me, it always sounds like hyperbole. I mean, its pretty awesome, but it doesn't give the same KIND of satisfaction to most people as sex.QuoteToday's devlog: Unlimited animalmen attacks with crude weapons, unlimited wildlife. Troglodyte EVERYTHING.
I came.
Ok then some "demonic Metal" maybe. A firewhip would just fit the Balrog image i have from the Firesprits.
Ok then some "demonic Metal" maybe.
Yeah, while awesome the (massive amounts of underground water) make me really, really, really glad for that 'turn off the damp stone/lava warnings' utility. I just hope the maker updates it for the new version!
# 02/21/2009: The combat/hunting/sparring reports work. You can view adv mode style messages by creature and category (comb/hunt/spar) now and all of the announcements have associated dates. Those that have associated locations are zoomable from the announcement/report screens. I also messed around with the text some more... a work in progress. It's also highlighted some strange issues, like with the brain pretending to be outside and all that. List updated.
# 02/19/2009: Updated another 40 or so announcements -- this time it was all of the ones that cause pausing and recentering. The only pause-recenter that isn't handled is the full invasion, since that full page announcement occurs under a different system. So it's not quite to the point where you could turn off all of the pausing messages, say, and run the game without interruption, but it's much closer. I also finished up the first pass on combat text. Once I get notices up (probably tomorrow), I'll finish that as well.
# 02/18/2009: I've updated the 40 or so peripheral combat messages to the new system and set up the information that is sent in to main strike message creator.
Combat messages in dwarf mode will default to notices -- this means that they aren't displayed at the bottom, but instead give you a little letter notice on the left bar of the screen according to the type of combat message (combat/sparring/hunting). You'll then be able to view the stored combat messages, separated into combat/hunting/sparring lists for each dwarf.
Remaining bits are the strike message's actual text, setting up announcement options by type (appears in a pause box? pauses-recenters? logged with the notices or in the main queue? etc.), setting up the notice screen, and updating the main announcement screen. For any updated announcement that can possibly have associated coordinates, you'll be able to recenter the view from the main announcement screen and from the notices. I won't be updating many of the announcements this time around, but I'll try to catch the ones that I've heard the most about (mineral popups, job cancellations, death announcements, etc.). Announcements that I don't hit will work as usual.
# 02/17/2009: I've been looking over the announcement situation in general, and I think I'll be able to do dwarf mode combat reports as well as put in some announcement zooming/filtering/etc. without much trouble, though there will likely be some restrictions at first (in that I might not update all 500+ announcement types with individual tags at this time). I've put in some of the infrastructure for that, and I've also gotten started on the combat text.
You know what I hope comes with the next version?
Selecting which castes you bring with you on embark. That way, you could, say, add a custom creature to your entity, say a human, and you'd start a fort with 6 dwarves and a human. Would be nice if no humans emigrated, or if there was some sort of option in the entity like [IMMIGRANT:NO] or something. Or you could just have humans and dwarves in a mix or something like that.
Toady just put up a special sub-entity type thing to let underground animalmen have weapons/clothes without having to track each individual as a historical figure and also possibly without having to have settlements. That's actually something i suggested some time back.
WOO! :D
This paves the way for a similar sub-entity thing for intelligent (semi-)megabeasts. No more titanic nudists, and bronze colossi can get ginormous suits of bronze armor and huge bronze weapons. From what i understand about what he just set up, you can apply it to aboveground creatures without any hitches already, so we can get ogres with clubs and tigermen with spears etc. Awesome.
Edit: Also, ThreeToe's avatar is a capybara. Silly forumgoers.
Toady just put up a special sub-entity type thing to let underground animalmen have weapons/clothes without having to track each individual as a historical figure and also possibly without having to have settlements. That's actually something i suggested some time back.
WOO! :D
This paves the way for a similar sub-entity thing for intelligent (semi-)megabeasts. No more titanic nudists, and bronze colossi can get ginormous suits of bronze armor and huge bronze weapons. From what i understand about what he just set up, you can apply it to aboveground creatures without any hitches already, so we can get ogres with clubs and tigermen with spears etc. Awesome.
Edit: Also, ThreeToe's avatar is a capybara. Silly forumgoers.
Huh, for some reason I thought he was a hamster. Capybaras are awesome.
I think Toady meant something other than actual underground entities. I thought it was more akin to "entityless entities", as in "entity-within-a-creature", so that you can define some of the entity-level stuff in a subsection of the creature definition.
the balrogs will have to wait until we get HFS below the HFS
It's official, cats now have [BUILDING_DESTROYER:1.5].Fixed. They would go out of their way to do it, but not use it for pathing. OH NO!
"Toady one" is an anagram of "Donate, Yo"
Oy! Donate!Yeh, only that he's not Scottish.
Not exactly a hipster, either.Oy! Donate!Yeh, only that he's not Scottish.
"Toady One and ThreeToe" anagram into "Donated ear, eye n'tooth!" :)
(also "A donated teeny hooter" XD)
Yeah, let's mod in some Dwarf Fortress into real life. To make it more realistic.
Not to mention the arrows...
I would hope not, with all of the new tissue information.
Not all armor laughs at arrows. In fact, your armor is worthless for someone with luck or amazing accuracy, or a horde of archers. Every type of armor has its weakpoints, and every arrow has a well enough chance of hitting there and wounding you. And back then, every wound would be liable to get you, with diseases and blood loss.
I expect that with the new update the combat will be completely changed. No more arrows of instant death, for example.
I'm not sure if it's been asked, but how was Valve Toady?
on a different note, will some of them be flooded with magma as well?
Toady what are the future plans for the Beastmen in the sense of a social/civilisation structure if I am allowed to ask? Will they be Civilised or as an "Intelligent" creature will they automatically be drawn to form societies?
Quote from: JavisQuestion about the new subterranean entity definition. I thought you could only define it as one creature. I guess it can be multiple creatures in the new build?Quote from: Sean MirrsenI think Toady meant something other than actual underground entities. I thought it was more akin to "entityless entities", as in "entity-within-a-creature", so that you can define some of the entity-level stuff in a subsection of the creature definition.Quote from: AqizzarI asked Toady a while back about how modifiable the new underground scripting stuff would be, and he said basically not at all, since it relies on item-generation code that can't (for some time yet) be moved out into raw files. I might be misunderstanding just what sub-entity definition means.
Threetoe's avatar is his guinea pig Faustus. They have three toes on each back foot. The four in the front may be toes, but they don't count as toes, because they are in the front.
More:
Ideally the intelligent creatures will be able to form structures for their societies themselves -- it's a difficult problem though, so we're going to start that experiment with the goblins, who will not have any pre-defined entity positions.
QuoteMore:
Huh?
You aren't alone. As I was reading that, I was planning on putting it in as my signature, but then I realized that Toady said it, so I can't. I have this thing where I fight the power by not ever sucking up to Toady. I have to try and avoid looking like I am, too. Putting that quote in my signature would simultaneously make me look like a sycophant who was only quoting it because Toady said it, and it would degrade the quote by making people assume that it only got into my signature based on it's author, and not on any merits it might have.Threetoe's avatar is his guinea pig Faustus. They have three toes on each back foot. The four in the front may be toes, but they don't count as toes, because they are in the front.
I find that strangely quotable for some reason. Maybe it's lack of sleep.
It should give the high priest a position name related to their religion, for example...
I'm assuming he translated "divine wind" or whatever was closest, since that's what kamikaze actually means.
Well, not explicitly.Or finding the accent of their language makes invincibility sound like invincibility.
It's true that each meaning is given a defined spelling, and spelling, and presumably pronunciation, does not have to be unique.
However, DF does not recognize this, which would be nice for neat plot twists and quest gizmoes; I.E, questing for the Armor of Invincibility, and finding an Armoire.
Well, not explicitly.
It's true that each meaning is given a defined spelling, and spelling, and presumably pronunciation, does not have to be unique.
However, DF does not recognize this, which would be nice for neat plot twists and quest gizmoes; I.E, questing for the Armor of Invincibility, and finding an Armoire.
Yeah, that's all "divine wind". It may not be the closest comparison, but works for a literal translation. This gave me an idea btw, can anyone with knowledge of Japanese make a language file using romaji? I'd expect it would be pretty fun to read.
Kinyomi and Onyomi would make things difficult and always screwed me up, but it could be fun.
I estimate roughly half of the Japanese language at present is composed of phonetic loanwords from other languages.
You mean, kunyomi right? ;)Yes. Yes, I did. That's how badly they screwed me up.(also, it's been about 2 years since Japanese class.)
You aren't alone. As I was reading that, I was planning on putting it in as my signature, but then I realized that Toady said it, so I can't. I have this thing where I fight the power by not ever sucking up to Toady.Threetoe's avatar is his guinea pig Faustus. They have three toes on each back foot. The four in the front may be toes, but they don't count as toes, because they are in the front.
I find that strangely quotable for some reason. Maybe it's lack of sleep.
So your thing is to avoid toadying up to Toady? ;DOW. That HURT!
You know not of what you speak. That was actually a pretty good one.So your thing is to avoid toadying up to Toady? ;DOW. That HURT!
So your thing is to avoid toadying up to Toady? ;DExactly.
You can also pass up the barony entirely at the cost of forming trade agreements with the homeland
You can also pass up the barony entirely
pass up the barony entirely
then ctrl-alt-del out if I don't get a perfect one =/
then ctrl-alt-del out if I don't get a perfect one =/
Hello, my OCD friend. You don't need to ctrl-alt-del. Press Esc and then abort the game, it'll take you back to the title screen.
Hello, my OCD friend. You don't need to ctrl-alt-del. Press Esc and then abort the game, it'll take you back to the title screen.That doesn't work because then you abandon your fort.
Hello, my OCD friend. You don't need to ctrl-alt-del. Press Esc and then abort the game, it'll take you back to the title screen.That doesn't work because then you abandon your fort.
We're talking about pre-embark setup aren't we?
What about the demons!?
You forgot random critters, usefull breeding, magic, decent social simulation and artefacts of doom. Oh and nice little Poems XD.
You forgot random critters, usefull breeding, magic, decent social simulation and artefacts of doom. Oh and nice little Poems XD.
What about the demons!?
Oddly I have a feeling the most of the work on demons is waiting for Version 2
XD imagine that: Altruistic Demon-lords.
Nobody ever acts to be the bad guy. I highly doubt demons act purely out of malice since that type of personality doesn't make any logical sense. It would mean demons are insane, and I find it hard to believe that an insane being can lead a fortress full of clearly logical and sane creatures.
[snip] Therefore, after this long list of extensive logic, demons must be logical in similar ways to humans. And as such to dwarves.Also,
At the moment, a megabeast is a relatively powerful monster of very limited quantity that lives in caves, attacks towns during worldgen, and will attack your fort when it becomes large enough.
A semimegabeast is similar, only they won't come to your fort in Fortress mode.
Mega beasts seem never to occur in groups (not counting demons to this) therefore semi-megabeasts like GCS come in small groups.
A little late to the party, but embarkanywhere.
Nano Fortress would be sweet. They really force you to take advantage of every level. That is, unless a massive magma pipe is in the way or something. That REALLY teaches you how to manage your z-levels.
Then there is Dwarf Manager. Useful as hell.
Nano Fortress would be really easy to add, and would be good for many purposes; you could, for example, use the 1x1 embarks to scatter little shrines around the world.