Post by: Great Order on October 08, 2022, 08:54:32 am
Two rules so far:
Sports discussion is banned.
Keep things civil!
Yes sports is an important topic with regards to trans rights, but it appears that nobody can keep calm about it. If people start getting heated with one another, the thread will be locked until people cool off. If you keep going at it, I'll start reporting posts to Toady.
Cisgender and heterosexual people are welcome to enter and use the thread, but please be respectful to those of us who are part of the community. Insults, bigotry, Just Asking Questions and such will not be tolerated.
Post by: Magmacube_tr on October 08, 2022, 08:57:11 am
Post by: Great Order on October 08, 2022, 09:09:46 am
https://twitter.com/TheProblem/status/1578414849083654144
Specifically, the comments in the thread. It's like looking at a bunch of illiterate people who think they understand a book reading it out loud. The interview itself... It'd be hilarious if this person was just a random schmuck, that she's a politician makes it depressing.
Post by: Rolan7 on October 08, 2022, 11:25:28 pm
Hi, I'm Rolan. I'm an NB AMAB androphile. AKA: I'm between genders, I lived as a man but now have estrogen, and I like masculinity. Though I'm pansexual, currently with a femme NB.
For this particular topic... Mmn. Jon Stewart has said some shitty things in the past, but I'm not the sort who cancels without overwhelming reason. I thought he does fine in that clip, not perfect but fine for a liberal. Maybe it's even the best presentation for his liberal audience.
Post by: Loud Whispers on October 10, 2022, 05:49:43 am
Post by: Magmacube_tr on October 10, 2022, 06:25:01 am
Eyyy I'm LW I shirk from labels because I think they draw people towards enforcing rigid divisions between genders and sex rather than bring people together, but if I had to say, I'd say I'm a speed-strength-kinaesthetic-spatial main because it's like being a Dex build without being a filthy Dex build. GOD HATES DEX that is all even though dex build is the meta build. We have to show STR builds love otherwise they will lose their pride and become really small.
Lay off the gnomeblight, man.
Post by: Loud Whispers on October 10, 2022, 06:44:56 am
Post by: Grim Portent on October 10, 2022, 02:00:02 pm
Don't tend to keep too much of an eye on the politics side of things, but I'm fortunate enough to live in one of the most pro-LGBTQ places on the planet.
Post by: Magmacube_tr on October 11, 2022, 12:27:34 am
Cis-male Pansexual here, though more attracted to cis-men/trans-men on the whole.
Don't tend to keep too much of an eye on the politics side of things, but I'm fortunate enough to live in one of the most pro-LGBTQ places on the planet.
Oh my gosh. Literally the same.
On that front however... ugh...
Post by: Great Order on October 11, 2022, 02:40:12 am
Post by: Vector on October 11, 2022, 08:47:23 pm
I'm keeping an eye on the politics because, being trans, I'm basically the West's political football at this moment in time. I'm having to sit around and see how the media's depicting me (Because joy of joys, some people think I'm a woman-hating rapist simply for existing) and what the political situation around me is, especially with an increasingly right wing Tory government.
It's not as bad here as it is in England, but I've been doing the same thing. People act like it's not reasonable and I'm jumping at shadows but I'm not convinced.
However, I've stopped watching news recaps of the "here's a lot of bigotry as seen in clips, tweets, and news reports and us debunking it," style because engaging with concentrated transphobic narratives, especially where they're treated as ordinary talking points, has started consistently giving me migraines and/or diarrhea.
Post by: Magmacube_tr on October 12, 2022, 12:30:27 am
You know, my honest opinion about this is...
Spoiler (click to show/hide)
Post by: Great Order on October 12, 2022, 05:40:20 am
Managed to avoid gay rights by realising I was bisexual *after* the issue was settled. Didn't manage to avoid this one however.
Post by: EuchreJack on October 12, 2022, 11:22:25 pm
Gay kaaba is a thing now. Look it up.
You know, my honest opinion about this is...Spoiler (click to show/hide)
I'm not surprised. When fundamental christians rejected gays, the LGBTQ+ community just founded their own churches.
There are signs that mainstream christian churches of at least a couple branches are starting to accept some forms of gay/bisexual relationships, in that those churches that don't want to accept it are the ones having to break off on their own.
Post by: Iris on October 12, 2022, 11:38:35 pm
Probably not going to be posting here much (I am dreadful with treating topics like this delicately).
Post by: Rolan7 on October 13, 2022, 12:56:59 am
Eyyy I'm LW I shirk from labels because I think they draw people towards enforcing rigid divisions between genders and sex rather than bring people together, but if I had to say, I'd say I'm a speed-strength-kinaesthetic-spatial main because it's like being a Dex build without being a filthy Dex build. GOD HATES DEX that is all even though dex build is the meta build. We have to show STR builds love otherwise they will lose their pride and become really small.Sure, that's how I've lived for... most of my life. As unlabeled as possible. Always different, always defining myself by what I wasn't. Indie music, neutral fashion, politically centrist.
Maybe an exceptionally strong person/ego can define themselves without labels, but language shapes thought.
HRT-wise (you didn't ask, but it feels relevant): Taking mine for the first time, I obviously felt a wave of excitement which I expected to die down. It did not - until my HRT stopped working. I was an involuntary detransitioner, and it sucked just as much as my life before had. But then I was prescribed a solution (because I'm a bland centrist who doesn't just avail myself of the many grey-market options) and I am even happier. Also, sadder, but at appropriate times! I think that in my desperation to restore the hormone-balance I prefer, I got a little overcautious with how I take my sublinguals... It's possible I get more of a dose than most would, from my 4mg/day. Every morning, right after drinking some water, first thing.
But then there is still some enby in me. I had a lovely evening with my dad and his SO. He didn't comment on my comfy top (or my 6-month-HRT soft tissue). I even referred to myself in the third person as his son, once, because we were sharing a nice moment in a shared interest, and I wanted to do that for him. Maybe the middle ground isn't always bad, if it's *my* middle ground.
(my dreams strongly disagree, but nowadays they advise not terrorize)
Post by: Iris on October 13, 2022, 01:59:27 am
I suppose I identify as female, but there's a lot of baggage there - I've often struggled with whether I'm 'really' female, just a very confused cis man, or something else entirely (I identified as a demigirl for a fair bit). I've changed my username, I've changed my pronouns, but is it an improvement? I don't know. I really don't know. I'm afraid to buy female clothes, or try hormones, or really much of anything else besides what I've already done.
Sometimes I feel like I'm stuck in limbo, unable to happily be a man, but unable to happily be a woman either. I just hope it gets better eventually.
At least I can be confident that I'm (mostly) attracted to women, right?
Right?
Labels are hard. I'm Iris. Just Iris. Nothing else.
Post by: Great Order on October 13, 2022, 03:24:34 am
I said to my psychiatrist that it's a bit difficult to work out if I feel like a girl on account of the fact I've only had one experience, ie being me. The situation's closer to a best guess than a definite "I am a woman because I know what the difference between being a man and being a woman is", I just feel like I'd be happier as a woman.
Besides, the whole situation's not a race. Nobody's out there recording how long it takes you to work out if you're trans or not and putting it on a leaderboard (I hope, if they are you have other issues) so you can take as long as you need. There's only one way of failing at it, and that's arriving at the wrong conclusion because that's what you want rather than how you feel, and even then you can transition later or detransition, both have been done plenty of times. Heck, there's been people who have transitioned, detransitioned, then retransitioned.
Post by: Vector on October 13, 2022, 11:38:48 am
I really strongly recommend trying to find a trans person to talk to on a personal level IRL. 98% of the trans people you encounter will be supportive and helpful with your situation.
If you live anywhere near a major city in the west, there will be LGBT-safe hangouts where you can get coffee and talk to your friend about things.
Post by: alway on October 13, 2022, 11:01:57 pm
Yeah, what Vector said. Realized I was trans nearly 5 years ago, waited nearly a year from then to actually meet up with local trans folks, and what a waste of time that wait was tbh. After the first one or two local meetups, I had a trans friend group, board game group and shortly thereafter, a hell of a lot more self confidence. Highly recommend it; the monthly meetups felt like a battery recharge. Meetups are like, the one time a month you get to talk to normal people instead of cis people.
Post by: Doomblade187 on October 13, 2022, 11:14:04 pm
Post by: Magmacube_tr on October 14, 2022, 05:26:03 am
Meetups are like, the one time a month you get to talk to normal people instead of cis people.
but i cri
Post by: Vector on October 14, 2022, 10:36:34 am
Post by: Great Order on October 14, 2022, 05:53:34 pm
That's called being a human. Sometimes you feel funny and then spring a leak. The where determines whether that's crying, urination, or a stomach bug.Meetups are like, the one time a month you get to talk to normal people instead of cis people.
but i cri
Post by: Grim Portent on October 14, 2022, 06:07:32 pm
Post by: voliol on October 14, 2022, 06:40:18 pm
As for another thought on LGBTQIA+ issues, I feel it's important to try to accept people even when you're not able to understand them. Being pan, I for one can't understand monosexuality, be it of the hetero- or homosexual kind. I can try, but the closest I get is interpreting it as kinks or preferences, and I know it's more than that for people. There's just something I can't grasp, and I'm pretty sure I never will, and that's okay. And that applies to everybody in different ways, we have to listen to others and try to trust them, perhaps especially in cases where you can't understand them, weirdly enough... Maybe the most cookie cutter take in history, I dunno.
Post by: alway on October 14, 2022, 07:37:30 pm
There's also this fascinating interaction between perception of age and hormones, where doing a late second puberty makes you look younger? Turns out the fountain of youth is real and it's just HRT. I look younger than I did 5 years ago. It's wild looking around me at people I worked with close to a decade ago, and seeing how much older they look now, vs looking at my own selfies and seeing how at most I look the same age now.
I was a ball of anxiety about it at the time I started, but like, honestly it was the best decision I ever made. And had it gone otherwise, what was the worst that could've happened? I end up as a queer cis guy with a nice pair of tits? On the scale of genders, I'd definitely rank that above where I was at beforehand. And where I'm at now is just wonderful and far beyond what I ever dared hope for.
Out of all of the transitioning stuff, my favorite part is that, if you are visibly trans, the coolest, cutest, queerest people in any given room gravitate towards you and chat like old friends. While all the awful conservatives who otherwise enjoy sharing Opinions About Who Should Be Allowed To Exist give me the side-eye and maintain the desirable distance of Far Away From Me. Like, did you know there were pills that could do that?? It's great! Worth it all on its own honestly, even apart from things like being comfortable with my own body. (Okay, honestly that's mostly just my rad outfits doing the heavy lifting, but still)
Post by: Telgin on October 14, 2022, 09:24:12 pm
I have to wonder if being on Tumblr and Bay 12 Forums both, and now especially this thread, will make my intuition of how common trans people are really estranged from the statistics of humanity as a whole. Like, I think I know most of the people I meet in real life aren't trans, but the internet places I frequent has my mind going "oh, it has to be at least a fifth of the population, everywhere, right?". Hoping this observation doesn't come off as weird.
I've wondered the same, actually. I remember reading more than a few years ago that estimates put somewhere around 10% of the population as being homosexual, but I honestly don't know if they were including anything else like trans people in that number. There was also almost certainly a bias in the results since they were self-reported, which would be impossible to remove entirely.
I'm guessing that on the internet you're more likely to find groups of people who identify that way and actually talk about it, while in person people are more likely to keep it private. Maybe it is more than 10% in reality.
Quote
As for another thought on LGBTQIA+ issues, I feel it's important to try to accept people even when you're not able to understand them.
Agreed. I'm about as normal and vanilla as it comes on these matters, aside from being debatably somewhat asexual, but I can respect people and their personal lives even if they're different from me.
Post by: MrRoboto75 on October 14, 2022, 10:20:50 pm
Post by: Great Order on October 15, 2022, 05:54:38 am
Post by: Magmacube_tr on October 15, 2022, 05:59:39 am
I've heard that neurodivergent people are more likely than average to be LGBTQ+
Would explain the Bay12 venn diagram I saw a while back.
Post by: StrawBarrel on October 15, 2022, 03:43:25 pm
Eyyy I'm LW I shirk from labels because I think they draw people towards enforcing rigid divisions between genders and sex rather than bring people together, but if I had to say, I'd say I'm a speed-strength-kinaesthetic-spatial main because it's like being a Dex build without being a filthy Dex build. GOD HATES DEX that is all even though dex build is the meta build. We have to show STR builds love otherwise they will lose their pride and become really small.
I think labels are fine. Creating classifications is a normal thing to do. We classify different dogs into bull dogs, golden retrievers, chihuahuas, beagles, and so on. It's an objective fact that there is diversity within sexuality, gender, and sex. We ought to be able to classify masculinity, femininity, androgyny; endosex (I had to look this one up), intersex; binary, non-binary; cis, trans. Less labels would limit our language.
I also do not believe that different gender and sex identities will create more division. It should make society stronger.
Quote from: https://en.wikipedia.org/wiki/Multiculturalism#Support
As this history shows, multiculturalism in Western countries was seen to combat racism, to protect minority communities of all types, and to undo policies that had prevented minorities from having full access to the opportunities for freedom and equality promised by the liberalism that has been the hallmark of Western societies since the Age of Enlightenment. The contact hypothesis in sociology is a well-documented phenomenon in which cooperative interactions with those from a different group than one's own reduce prejudice and inter-group hostility.Contact with different people will reduce division and increase togetherness.
Post by: Great Order on October 16, 2022, 03:22:41 pm
It seems like a load of bollocks, I think people are confusing understanding and support, or assuming that you can't support something without understanding it.
Post by: Vector on October 16, 2022, 03:33:18 pm
Cis people seem generally incapable of Truly Getting It is a different message than Cis people cannot be supportive, though. I think the first piece may be true and believe the second piece is false.
Oh, on another note one of my trans friends said she found that every "ally" she had ever met eventually came out as queer. This friendship is rapidly deteriorating but I think some people do believe this statement to be true. I'm like 85% sure that it's false. If everyone who is homophobic is gay and everyone who is an ally is gay you end up with everyone is gay, which is a nonsensical idea.
Post by: Rolan7 on October 16, 2022, 03:54:57 pm
tldr; Cis HRT doctor accidentally doses self with extra estrogen, feels dysphoria for a couple days.
Kidding aside, I do wish it was easier and normalized for people to explore safe levels of HRT. Obviously that would have been... unthinkably nice for a younger *me*, but I feel like cis people might gain some insight into gender and sex from it. Kinda like how some people experiment with homosexuality and verify that they're straight! It's all valid, and nobody should have to try, but the option ought to be more accessible.
I like to think I've known several cis allies, but I also understand why a lot of trans people are most comfortable in relationships with other trans people. Stuff's complicated.
...I wonder if that's particularly the case for people undergoing second puberty, when things can be particularly confusing and developing.
Post by: Great Order on October 16, 2022, 05:01:08 pm
Oh, on another note one of my trans friends said she found that every "ally" she had ever met eventually came out as queer. This friendship is rapidly deteriorating but I think some people do believe this statement to be true. I'm like 85% sure that it's false. If everyone who is homophobic is gay and everyone who is an ally is gay you end up with everyone is gay, which is a nonsensical idea.There's also a slight issue in that it would mean, at a minimum, 50% of my friends and acquaintances. are queer in some way or another.
Now, there's a number of people among them who admit they're bisexual (And one who's pan), but as far as I'm aware the vast majority are still straight, and I don't think I've got anyone who's exclusively gay/lesbian in my circles. I know a few people who are, but I'd consider them acquaintances instead.
Post by: alway on October 16, 2022, 06:26:57 pm
Secondly, folks tend to hang out with people similar to themselves; those who gravitate towards being in groups of queer folks are much more likely to be queer, if even they themselves haven't realized it yet. Among the social circles I've observed/been in, queer groups have also tended to be relatively neurodivergent, and accepting of such, and as a result, people who enter and stay in the groups are queer and/or neurodivergent. This results in groups consisting of a bunch of queer folks, many of whom are neurodivergent, and a few who aren't particularly queer but love that they found a group of people who enjoy listening to their fascinating special interest rants (some may even be in the otherwise queer polycules that often form from these). A good number of these often also end up as queer at a later time, but generally not all.
People can also be supportive without being in these sort of circles. The problem is, it's not all that common even among people who think they are supportive, just because their idea of 'supportive' is divorced from the reality of actual people they believe themselves supportive of. Most people falling into this pattern of 'support' just want to be patted on the back and applauded for quietly saying 'genocide is wrong' to themselves in a locked room, instead of taking actual actions like looking up #transcrowdfund on twitter and saving a life with some of their leisure budget, or even just educating themselves and putting in enough effort to actively make trans people comfortable in spaces they are in while making transphobes too uncomfortable to stick around. Thoughts and Prayers are neither support nor supportive, in spite of the weird cultural belief that they are. Tbh, people who are actually providing material support in some way but are neither queer, nor in queer circles, nor materially obligated to do so, are a minority about as small as trans people. This is a pattern which extends beyond LGBT stuff and into the realm of other minorities as well.
Post by: MaxTheFox on October 16, 2022, 10:52:15 pm
Post by: Iris on October 16, 2022, 11:41:31 pm
Ninja edit: Perhaps "condition" isn't the right word? More like... the zeitgeist? I meant "the emotional response to the state of being trans" but "condition", uh, does not have the best implications in this context.
Post by: Loud Whispers on October 17, 2022, 10:41:17 am
I think labels are fine. Creating classifications is a normal thing to do. We classify different dogs into bull dogs, golden retrievers, chihuahuas, beagles, and so on. It's an objective fact that there is diversity within sexuality, gender, and sex. We ought to be able to classify masculinity, femininity, androgyny; endosex (I had to look this one up), intersex; binary, non-binary; cis, trans. Less labels would limit our language.You'll have to forgive me, but my perspective is vastly different. I've never been limited in language when it comes to describing anything, but these labels have limited me. As a rule I cannot talk about sex or gender or whatever IRL because it always devolves into people trying to pin me down into roles Idgaf about and I've had it up to my neck with people talking about where I'm from or where I'm really from or gushing over my "mixed blood" or "hybrid" like I'm a fucking beagle or labrador. Leave the classifications to the taxonomists and let the infinite vaguaries of human existence be not confined to a finite vocabulary only a select educated few stand a possible chance of innately recognising. Headaches upon headaches ;-;
I also do not believe that different gender and sex identities will create more division. It should make society stronger.I'm not feeling the contact hypothesis loveQuote from: https://en.wikipedia.org/wiki/Multiculturalism#SupportAs this history shows, multiculturalism in Western countries was seen to combat racism, to protect minority communities of all types, and to undo policies that had prevented minorities from having full access to the opportunities for freedom and equality promised by the liberalism that has been the hallmark of Western societies since the Age of Enlightenment. The contact hypothesis in sociology is a well-documented phenomenon in which cooperative interactions with those from a different group than one's own reduce prejudice and inter-group hostility.Contact with different people will reduce division and increase togetherness.
To be fair I'm reasonably certain I'm trans these days and even I don't understand The Trans Condition.The trans experience? Because that has more implication of condition as the human condition, rather than condition as like medical condition
Ninja edit: Perhaps "condition" isn't the right word? More like... the zeitgeist? I meant "the emotional response to the state of being trans" but "condition", uh, does not have the best implications in this context.
Post by: Magmacube_tr on October 17, 2022, 10:52:46 am
If this goes on...
Post by: Iris on October 17, 2022, 12:33:58 pm
I am terrible with words when talking about these things and it has offended people in the past, which is why I don't really like talking about them.
Post by: alway on October 17, 2022, 02:16:55 pm
I'd like to have you know that there is an ever increasing amount of anti-LGBTQ+ protests throught the world, and their sentiments are getting more and more violent.ngl, wargame it out in your head based on what is plausible, rather than based on worst-case imagined scenarios only useful for spawning more anxiety and apathy. Have contingency plans and build the capabilities and relationships you need to follow them through. In the US, at the federal level, this means working out and accounting for how Obergefell, Lawrence, and Griswold being overturned could affect you in the next 5 years. At the state level, it means modifying this accounting for how these interact with state level politics to make places that are more safe and less safe; as well as at the local level. On the personal level: do you have the folks around you that you need to keep you safe in the environment you live in? How likely is it that you're actually personally exposed to these things? When it comes down to it, you won't be able to count on any cops to have your back, ever. Make sure you have people who do.
If this goes on...
Here in Texas, I was hearing about most loving families of trans youth with resources to do so fleeing the state around a year and a half ago. A little under a year ago, the state criminalized transition related care for transgender youth, and told child protective services to open investigations into all families of transgender children. This and similar has since spread to several states controlled by fascists, forcibly detransitioning transgender people within those state. Since then, they've increasingly been talking about raising it to include adults under 25. In Florida, the state declared trans healthcare, despite nearly a century of use, to be 'experimental' and thus not covered under medicaid. Private insurance companies in the state are likely to follow suit. This will likely spread to other fascist controlled states as well over the next year or so, as they fundamentally do not believe trans people should be allowed to exist. On top of this, the state government has shown a desire to reinstate the laws criminalizing "homosexual behavior" if the Supreme Court overturns Lawrence. In part as a result of these open attempts at genocide, every trans person in my local social group independently decided they were aiming to move out of Texas within the next year; because changes in the near future have at least a double-digit percentage odds of affecting us in strongly negative ways.
But the US is also Balkanzing to some extent; you can see it here, as well as things like the recent state sponsored human trafficking. Some states spell out protections in legislation ensuring your rights. There's even the recent sanctuary bills in places like New York for those facing prosecution for being LGBT elsewhere in the US. This is also something to take into account when making plans and contingencies and generally wargaming out what you personally will do.
Anyway, some final reading material I recommend, from nearly a half century ago, on queer communal life: Find a PDF somewhere of the 1977 book "The Faggots & Their Friends Between Revolutions." Do note that it is NSFW, with some explicit depictions of gay communal living from someone who did so at the time. It is feels remarkably still relevant, aside from a bit of outdated terminology (such as 'queer' having more or less inverted its meaning since Act Up)
Post by: Vector on October 17, 2022, 03:41:04 pm
If people are thinking about moving and they have options I recommend the East coast over us, especially NYC, because we're "blushing" more than I'd like. You won't be legally detransitioned here but people will absolutely harass you on the regular with zero consequence to them.
Post by: alway on October 17, 2022, 04:16:48 pm
Massachusetts is where I'm headed; the place with supposedly good free healthcare for those without an income, and thus pretty ideal for a polycule where normal health insurance plans don't cover everybody.
Post by: Loud Whispers on October 17, 2022, 04:44:46 pm
Yes, that's what I meant. The trans experience.It's all right, as long as you keep communicating and you have good intent, you can always build a better relationship with others after you all come to a mutual understanding over why you accidentally offended the other and that it was an accident. A lot of magnanimity goes a long way for both sides ;D
I am terrible with words when talking about these things and it has offended people in the past, which is why I don't really like talking about them.
Post by: Iris on October 17, 2022, 07:16:03 pm
Post by: Vector on October 17, 2022, 09:07:40 pm
There's in-jokes, lingo, and preferences, too, which trans people are much more likely to know than cis people. Such as what "cracking your egg" is. Much as you're likelier to know what an otter or a bear is if your social circles are gay male adjacent, or to know what a uhauler or gold star lesbian is if your social circles are lesbian-adjacent.
Post by: alway on October 18, 2022, 12:28:53 am
You see similar patterns in other contexts as well; with misogyny for example, men are viewed as superior, and thus, women aiming to enact masculinity are viewed as misguided, misled, or confused, but ultimately understandable as they are aspiring to become superior. Whereas men aiming to enact femininity are viewed as deviant, and morally repugnant, as they are aspiring to debase themselves into the inferior group.
The intersection of this with transphobia becomes transmisogyny, where transphobia interprets people into these categories, and misogyny does the rest. This is also why, in most media today, you see trans women depicted as predatory, morally suspect, and criminal. And why you see trans men depicted as confused, misled, and infantilized such that they aren't allowed agency over their own decisions. They also don't really care whether these categories are particularly accurate, and will slot in nonbinary people, or just anyone, into whichever side of this binary system they find most convenient to interpret them as through the lens of transphobia.
Heteronormativity is similar: This underlying belief in society that to be heterosexual is Normal and Good and Desirable, and that The Gays should attempt to emulate it as closely as possible, and assimilate into straight cultural norms in order to be accepted within society.
To really Get It, those normative beliefs need to be jettisoned. Not only are cisheteronormative systems not what should be considered 'normal' or something to aspire to and look up to constantly, but that going beyond them and annihilating them is what should really be aspired to, as they are actively evil and actively making the world a worse place, both for those considered normal and those considered abnormal. They are a giant set of invisible chains binding every person in society to useless expectations.
Break those chains and understand it's not "this trans person may some day live a normal life if given enough assistance to become normal" but rather "this trans person has been doing intense self-examination for the past 4 years and has crafted their very being into an intentional work of beauty to which everyone around them should aspire, and whose existence outshines dozens of others put together." There's like, this slogan y'all have probably heard, "Love is Love," which constantly gets mocked in many of the queer spaces I'm in, specifically because of the implication that normative straight love is the gold standard by which all others are measured. But why should it be? Aspire to be better tbh; look at the failings of cisheteronormativity, learn from them, and build something better in its place.
Post by: Loud Whispers on October 18, 2022, 06:52:09 am
I suppose I may as well just ask. I know that references were made to cishet people not "Truly Getting It", and I wonder, what is "It" in this instance? It doesn't square with what I know about human nature - namely that people are individuals and no two are the same. This seems to imply there is one Trans Experience, that you either understand or don't understand, but talking to other people beforehand about this issue has brought me to the conclusion that it is a highly personal journey. I don't quite understand what was meant by this. Is it that there are common threads between all trans journies, or...?In the words of Nujabes 'you either get it or you don't though, the choice is yours!'
There'll be a lot of things that are hard to "get" if you haven't lived "it." Same ways you can empathise with someone who's been struck by lightning, won the olympics or lived with wolves, you can even understand it and relate to it. But you won't know what it really was like - and take that and amplify it by a lifetime. Lots of people have lived lives where although there is no singular experience, there are things - usually common sufferings, jokes and joys - that only some peoples will get. There's a reason why there are 5,000 years of recorded history of sailors complaining that land-dwellers don't 'get' them on that fundamental level. Because no matter what nation or life they lived, every sailor knows what the sea's like in a way no one on land believes
Post by: Imic on October 18, 2022, 03:54:46 pm
However. I do still find some people... Aesthetically appealing? Attractive? Hot? I'm not sure, but I'm 99% sure it has something to do with femboys. I think that femboys are cute, and I'd love it if I had the confidence to wear big stompy goth boots and a choker and become the goth femboy I've always quietly dreamed of being. Okay, that got a little tangential, but um... so, a bit gay at the very least. Girls are cool too but I'm pretty sure I have a preference for guys.
Okay so this is diving about as deep into my internal workings as I'm comfortable going, so Imma stop typing now.
Post by: Loud Whispers on October 18, 2022, 03:58:07 pm
Post by: Magmacube_tr on October 18, 2022, 04:11:25 pm
What the hell is going on?! I am just constantly confused!
I think I understand how sex-repulsed asexuals feel when in my down days, kinda. And I am pan; we are supposed to be opposites.
Post by: Imic on October 18, 2022, 04:29:10 pm
Post by: voliol on October 18, 2022, 04:31:42 pm
Pan- doesn't imply more sexuality than mono- or bisexuality, just that there is less discrimination in terms of gender. And at some extreme point of the asexuality spectrum (not meaning it's uncommon, I have no idea how people are distributed on that spectrum) there is no attraction to people of any gender, and so this discrimination is lacking there as well. Of course, you may be mostly ace but with strong monosexual (and/or -romantic) preferences as well, in terms of the attractions you do have, but the point is it's more than 1-dimensional. You can be both ace-y and pan-ey, and if trying to make sense of it doesn't work, then it's fine to just give up and go with the flow. You are who you are, and you feel how you feel at the moment.
fake-edit: aarhg, ninja'd by Imic
Post by: Grim Portent on October 18, 2022, 05:17:38 pm
*For example, I would not say homo is the opposite of hetero, rather each is a seperate sliding scale at which the opposite end is asexual. Or two sliding scales each if we divide sexual and romantic attraction. Potentially more depending on what criteria we want to use to define things.
Post by: Great Order on October 18, 2022, 05:47:02 pm
I've heard some people say that bisexual means you're only attracted to binary genders, but they've then been told it's not the case.
Post by: voliol on October 18, 2022, 06:03:20 pm
Though be that as it may, I've also heard rumors of people who use "bisexual" intentionally, and not just because they are
Post by: MrRoboto75 on October 18, 2022, 06:33:19 pm
Frankly it depends on who you asked and what day it is. Part if it seems like bi has a lot of baggage/stereotypes people don't want to deal with, part of it is gender got more complicated and "binary" doesn't entirely make sense anymore.
I've heard pan basically disreguards gender entirely when it comes to potential relationships, whereas a bi person might favor masculine over feminine (or vice-versa). So I'm leaning to bi since I prefer feminine people. Although I know of a youtuber with similar preferences that identifies as pan so ¯\_(ツ)_/¯
Post by: Grim Portent on October 18, 2022, 07:03:29 pm
There can be a distinction draw with proper bisexuals, for whom non-binary people just aren't interesting, romantically or sexually. Someone attracted to specific quality combinations, physical and personal, that are generally associated with men or women and where being a man or woman is a part of that quality group.
I've actually known a couple of them, guys who liked masculine men but also feminine women, and had no interest in feminine men, masculine women or non-binaries. They just didn't appeal to them in any sense. I imagine there's a lot of variations of them, much like with anything to do with attraction and identity.
Post by: Imic on October 19, 2022, 02:10:49 am
Post by: Vector on October 19, 2022, 04:06:55 pm
I wish I could be changed for someone else, too.
Post by: Great Order on October 20, 2022, 08:31:11 am
I used to find hanging out with girls a lot easier than boys when I was a kid.
I wonder if that was related.
Post by: Magmacube_tr on October 21, 2022, 06:29:48 am
Ugh, I am still here folks. I was there before and after you did the first one in September. I am still here before this one. And, guess what? I will still be here after this one ends too.
Erdoğan knows he is gonna lose. So he is trying to shift the peoples attention away from the soaring food prices and the state of the economy in a bid to try and raise his already abysmall chance of winning.
And yes, this ideology stems directly from Islam. Which is a branch of Judaism.
ABRAHAMIIIIICS!!!
Post by: MaxTheFox on October 21, 2022, 10:15:20 am
I've been wondering that myself, as recently I've been thinking I actually fall into one of those. Not sure if I'm fully committed to identifying as either though. Anyway consider this speaking as an outsider.Yeah, this. I call myself bi because I like females more. Guys are hot too but not as much.
Frankly it depends on who you asked and what day it is. Part if it seems like bi has a lot of baggage/stereotypes people don't want to deal with, part of it is gender got more complicated and "binary" doesn't entirely make sense anymore.
I've heard pan basically disreguards gender entirely when it comes to potential relationships, whereas a bi person might favor masculine over feminine (or vice-versa). So I'm leaning to bi since I prefer feminine people. Although I know of a youtuber with similar preferences that identifies as pan so ¯\_(ツ)_/¯also bi has a better flag
Post by: DogsRNice on October 21, 2022, 11:28:37 pm
But dang, knowing if I feel romantic attraction to people or not is confusing. I'm pretty sure I'm pan (it feels like it fits best I guess) though I heavily lean female. But knowing if what I'm feeling is just a strong platonic attachment or romantic attraction is hard, I guess any advice for sorting that out would be good.
Post by: alway on October 22, 2022, 01:10:34 am
Post by: Egan_BW on October 22, 2022, 01:19:11 am
Post by: EuchreJack on October 22, 2022, 01:55:59 am
Quote
Quote deleted, just in caseI'm a white male (sexuality is always assumed to be whatever people want to see, but it is heterosexual), so I rarely get fired due to initial or long-standing bias.
But I still get fired by folks. And I still wish I could be someone else. And I've been able to win over people that weren't initially thrilled with me. And I've had folks get pissed at me, then manage to "fix it". And I've gotten fired by folks that I had thought were quite happy with me. Sometimes, it's just them. Mostly, it's their loss. Usually, I'm happy to be rid of them.
Post by: Rose on October 22, 2022, 02:24:57 am
Hello, trans lesbian here, just gonna settle in a corner and watch things.
It's been fun watching bay12 become more and more queer over time, myself included.
(Just in case there's anybody from years and years ago that doesn't recognize me, I use to go by
Spoiler (click to show/hide)
Post by: Loud Whispers on October 22, 2022, 06:26:14 am
I'm a white male (sexuality is always assumed to be whatever people want to see, but it is heterosexual), so I rarely get fired due to initial or long-standing bias.Yeah life's too short to worry much too much about people who don't communicate their emotions honestly. I get tired of dealing with people who are all smiles 24/7 then they complain to me that a mutual friend's been driving them up the wall for years over a problem they could've fixed with 1 convo. Oh btw don't direct quote Vec as they like keeping a low digital footprint for safety's sakes
But I still get fired by folks. And I still wish I could be someone else. And I've been able to win over people that weren't initially thrilled with me. And I've had folks get pissed at me, then manage to "fix it". And I've gotten fired by folks that I had thought were quite happy with me. Sometimes, it's just them. Mostly, it's their loss. Usually, I'm happy to be rid of them.
I have a sexuality. Will report back if I discover I have a gender as well.Tempting to revive the "shit let's be xyz thread" to have a gender polling
Post by: MrRoboto75 on October 22, 2022, 08:21:36 am
I have a sexuality.
hey, me too
Post by: Magmacube_tr on October 22, 2022, 08:24:46 am
I have a sexuality.
hey, me too
I though I was the only one!
Post by: Loud Whispers on October 22, 2022, 03:35:36 pm
Spoiler (click to show/hide)
Post by: Great Order on October 22, 2022, 05:10:05 pm
Post by: Magmacube_tr on October 22, 2022, 05:12:26 pm
Post by: MrRoboto75 on October 22, 2022, 06:17:05 pm
Post by: Vector on October 22, 2022, 07:07:46 pm
Yeah, this student has also been using the wrong pronoun in conversations with the lead instructor for the course and persists while being corrected over and over and over again.
I'm working on moving past it but I had so many negative interactions over the past couple of weeks that finally being discarded was a bridge too far.
Post by: EuchreJack on October 22, 2022, 07:29:55 pm
Yay, they're gone from your direct responsibility! You'll see them, of course, but now it's Someone Else's Problem.
They should move up, on, or out in a couple years, and they'll be gone for good.
It's best for you not to speculate, but I'll say they're probably not moving towards great success.
Remember what employers want. (https://www.youtube.com/watch?v=QP3zRBtgvJo) If they're not following instruction in school, they're not looking like an ideal employee either.
Post by: Iris on October 22, 2022, 08:07:34 pm
Post by: KittyTac on October 22, 2022, 11:15:21 pm
Post by: Rolan7 on October 22, 2022, 11:40:10 pm
It was a pretty long dream of wandering through an impossibly large convention center trying to let my guard down enough for heroes to notice me. You'd think the mask and iconic form-fitting outfit would be enough, but I think it was too much... I think several minor heroes did recognize me, and pretended not to for their own safety. As if I had any intention of hurting them.
Eventually I overheard radio chatter from a heroine who was different. Not only was she competently compiling reports of my location, she seemed excited to meet me. Like she might actually heed my warnings about the *real* threat. She was operating out of a video game arcade, very classic except that the machines were hanging from the ceiling. I made a batman-style entrance and she played along, pretending to be surprised.
But it was she who surprised me. She was asking all the right questions, and for some reason I could barely answer. She wasn't treating me like a villain. She took her mask off and she looked so familiar somehow, tired, a couple days of stubble framing kind eyes. She *knew* me and, incomprehensibly, she aspired to be like me. She was asking what I needed and all I could do was ask, beg, to keep my mask on. It didn't hide me from *her*, but I couldn't reveal my identity to everyone else. Not just yet. I felt like I was letting her down, but she didn't agree.
Post by: Rolan7 on November 02, 2022, 09:58:52 pm
I did enjoy this bit of satire, though, which points out how ridiculous the "issue" is: https://www.mcsweeneys.net/articles/guys-i-swear-im-only-transitioning-so-i-can-cheat-at-girls-sports
Kinda just nice, too.
Post by: Vector on November 02, 2022, 10:26:56 pm
Post by: Great Order on November 02, 2022, 11:57:46 pm
It occurs to me that I have, for the most part, just been assuming I like women. But looking at the pattern of my crushes, that's probably not actually the case. Homoflexible? Pan with a strong female preference? God only knows.I put myself as bi with a heavy preference towards women after over two decades of thinking I was straight.
It's hardly an unknown situation. Kinsey scale is 0-6, being from exclusively heterosexual to exclusively homosexual. You could be sat at 5
Post by: Magmacube_tr on November 03, 2022, 12:14:07 am
Post by: Great Order on November 03, 2022, 12:45:29 pm
Post by: nenjin on November 03, 2022, 06:46:49 pm
I detest even thinking about the sports issue, since it's almost entirely an artificial front the right to scaremonger.
I did enjoy this bit of satire, though, which points out how ridiculous the "issue" is: https://www.mcsweeneys.net/articles/guys-i-swear-im-only-transitioning-so-i-can-cheat-at-girls-sports
Kinda just nice, too.
I get the satire, but from the LGBTQ side the "I changed sex just to win at sports" is their straw man so they don't have to have a real discussion about the intersection of gender transitioning and sports performance.
The point is not the .0001% that claim to be transitioning actually just to win at sports (they're doing it ironically to prove a point.) The actual point is someone who legitimately wants to transition, does and then wants to perform in the gender group they identify with. (Let's also not overlook that now, suddenly, someone is gate keeping the concept of "who is really transitioning and who isn't." Something that if it was said to an "actual trans person" would be heinously offensive.)
The example I go to is Laurel Hubbard. While she didn't even place in the Olympics against the top performing female power lifters, domestically in much lower ranks they did much better.
Being into fitness, I can't overlook the biological differences in muscle mass and bone density living as a man for your entire teenage and most of your adult life has versus someone who was born biologically female. That muscle doesn't simple disappear overnight, the bone mass doesn't return to any level because as far as the body is concerned, you developed with male levels of hormones and that's what it should be. If someone has trained their whole life as a man, the differences magnify. If they trained their whole life as a man and used Performance Enhancing Drugs, the advantage magnifies even more.
A life-long male in their early 30s who is untrained will, statistically, be stronger in most metrics that matter to professional sports than an untrained woman of the same age. So if they transition to female with no hormone therapy, then they will by the numbers have strength and performance above the female standard. It's why we even have gender separated sports in the first place.
I don't have an answer for what to do that makes everyone happy. But I resent people acting like someone's chosen identity > biological reality. It doesn't. If someone transitioned to female, they will never give birth. That's just a biological reality. They can simulate it but they can't actually physically do it. From there it becomes a gray scale of what you constitute as biological reality. And the stats on male vs. female performance are very clear. The presence (or absence) of testosterone over a life time and its long-term effect on physical development is well mapped. And I feel like that needs to be acknowledged in the discussion of who competes where and under what conditions.
I hate the sports issue too but it cuts to the quick of how we define gender. The question of "should I respect what you choose to identify as" isn't up for debate among sane, reasonable people. You just do. But now the question extends to "to what degree do I respect or should society contribute to your self-identity" when you start talking about things like sports. Or hiring practices around job requirements. Put another way, you be you. But when it has to intersect with the rest of society, "always yes" isn't a measured response. It's one that doesn't even want to address the complexities for fear they won't get what they're seeking.
Post by: Great Order on November 03, 2022, 07:06:20 pm
Of course, as soon as one transwoman does do well, it's screaming about them doing well competitively and needing to be banned. See Lia Thomas, which was actually kind of bollocks. The oft used figure of something like ~350th placing up to 1st only really works when you take into account she got 350th while on hormones but still competing with men. Before that she was generally doing a pretty solid job.
Post by: Doomblade187 on November 03, 2022, 08:54:12 pm
Meanwhile, terfs here in the states have been very depressing, and it just sucks. I know acceptance is relatively high, but that shit can backslide and laws don't give a shit.
Post by: Great Order on November 03, 2022, 09:34:09 pm
Post by: Vector on November 03, 2022, 11:38:39 pm
Post by: Rolan7 on November 04, 2022, 12:12:29 am
But sure there is bone density which like, okay. In a sport where it's beneficial to have femme muscles on a male-heavy frame, the meta will be disrupted. I hope we can keep that sport alive.
I could get further into it but I really, REALLY didn't want to do that. I was mostly just impressed by the "She's me fr but I'm still cis" memories the parody reminded me of.
Like yeah, "transitioning to win at women sports" is a strawman. It's a strawman my dad interrogated me over while we watched over his mom in the hospital. It's a strawman that's heavily broadcasted and liberals fall for it.
I'm not going to jump on the much more reasonable version shared here, even though I disagree with it. Feminizing HRT makes people less stronk- that's why taking a bunch of testosterone is considered performance enhancing.
Post by: Vector on November 04, 2022, 01:57:40 am
Here's the upshot: the standards by which we judge transgender athletes after hormonal intervention, were developed in the first place for intersex athletes. It turned out that you couldn't predict a person's athletic performance that readily just based on how things looked in their pants so just a secondary sex characteristic check wasn't enough. They decided on lines based on hormonal levels to define what it meant to compete as "male" or "female." And these days, with these guidelines updated for transgender athletes, the line of separation is decided sport by sport.
(This whole business about dickering over hormone levels reminds me of nothing so much as the stereotype of parents looking at their active male infants and proudly saying that the boy is surging with testosterone. He is not. That is a baby and yes, he probably has an "outie," but hormonally it's more or less indistinguishable from a girl. You are looking at literally exactly the same behavior between male and female infants and saying that it's because of "hormonal manliness" in the one but not the other.
But I digressed...)
It also turned out that Olympic athletes overwhelmingly were blessed with modifications of specific genes, male AND female, one of which improved muscle definition and tone from a very young age (visible on photographs of toddlers) and another of which improved blood oxygenation.
But not all gold medalists had these two biological markers, which was also curious. The IOC considered banning athletes with those genetic markers and other "supergenes" but haven't so far.
I get angry about this topic because every single last rule which is intended to remove transgender athletes from competition ALSO removes "legitimate" female athletes from competition, whether it's about height, hormones, suspicious secondary sex characteristics, musculature, facial and body hair, or what have you. Recently the primary attacks have been on African women, but before, there were plenty of prominent cases with white cisgender women.
If you want to ban transgender athletes, fine. How do you find them? No, just not the obvious ones. How do you know you have found ALL of them? How do you make sure that you remove ONLY transgender athletes and zero athletes who have, as far as the paperwork has always shown, been cisgender females?
There are only two options on the average birth certificate: Male, and Female. Lots of intersex people have been lumped into the umbrellas of Male, and Female. They have what you might call "visibly mixed" characteristics from the day of their birth, but their socialization has historically only been one of two options: Male, or Female. And they have historically had the right to participate with their assigned sex, despite having blended physical qualities of Male and Female from day zero--including hormone makeups that don't suit their gendered socialization, in many cases.
My point is not "it is unfair that intersex people have better treatment than transgender people." Coercively assigning intersex people into particular roles, often through the intervention of surgery, is not really helpful, and can cause both gender dysphoria and a lot of physical pain.
(For those who want to complain about surgeons cutting into healthy organs in late adolescents or adults: first let them stop cutting infants. I'll wait.)
My point IS, however, that the more people circle the wagons on "protecting girls' sports," the more you are going to find cisgender people with intersex characteristics who are negatively affected by this, and the more you are going to find that the ones who the rules claim to protect are a scrutinized and over-scrutinized class. The paragons of cisgender womanhood often have their own embarrassing little secrets. They don't actually need to be revealed just to make sure you weed out every transgender person. Create a line at which transgender people can participate and if transgender people start to win everything, then you can change the rules ... IF that happens.
And finally, I'm angry about all of this because it sounds like the bar for success is that an exceptional transgender woman must never appear, and perhaps worse, that an exceptional cisgender woman must never appear. Anyone who ever approaches a male level of excellence and breaks all barriers must have been cheating, and when she appears, the rules of the game must change to eliminate her from the field.
Post by: Egan_BW on November 04, 2022, 08:34:23 am
Post by: Doomblade187 on November 04, 2022, 10:55:17 am
Post by: nenjin on November 04, 2022, 11:08:39 am
For the record, I hate the idea of testing people's hormones to decide whether they can participate in the gendered sport they identify with. I think it's invasive and does lead to the hair splitting you're talking about.
I support testing people's hormones for drug abuse. Unfortunately, there's the intersection of PEDs and HRT and it muddies the waters. Guys pump themselves full of extra testosterone to try and further their competitive advantage, and so do some cis women. For men, testosterone replacement therapy isn't currently considered "cheating." But for women, it can be.
Quote
And finally, I'm angry about all of this because it sounds like the bar for success is that an exceptional transgender woman must never appear, and perhaps worse, that an exceptional cisgender woman must never appear. Anyone who ever approaches a male level of excellence and breaks all barriers must have been cheating, and when she appears, the rules of the game must change to eliminate her from the field.
I just don't know how to fairly square "wasn't exceptional identifying as male but is exceptional identifying as female" so that cis women don't end up having their performance metrics skewed.
Because even though it is a strawman, what do we do when someone arbitrarily says they now identify as female? Who gets to make that decision on whether it's valid or not? What if a really swole dude who grinded out years in the gym really does one day decide they identify as female and they won't do HRT? Is their transition less valid? Is it still fair to the gender they now identify as? Does every sporting organization and body get to have their own standard of reasonableness? ("Must "live" as the gender they identify with.")
Also I feel like the counter evidence, of a trans man doing HRT out performing cis men in sports, only reinforces the idea that hormones really do matter in the short and long term. Vector, in your studies, have you found many if any examples of trans men performing well in sports?
Post by: Vector on November 04, 2022, 11:32:19 am
So politically speaking, the story is: "Those fake men get handed spots on sports teams by woke coaches, taking positions that could be given to people who actually qualify. They won't help us win, so why are they there?"
That's the narrative. Are trans men actually that bad at sports? Or as the Republicans like to say, "weak" people who wouldn't have won the war? Unclear to me, but before we had this trans female sports panic, there was a little itty-bitty one about transgender men which seems to have resolved for now.
(I counter with Deborah Sampson, Joan of Arc, and Catalina de Erauso.)
I just don't know how to fairly square "wasn't exceptional identifying as male but is exceptional identifying as female" so that cis women don't end up having their performance metrics skewed.
The same way you square "sucked as an ice skater but turned out to be really good at long jump" or any other such change of sporting targets. We wouldn't be having this conversation about trans women in gymnastics and ice skating, by the way.
Because even though it is a strawman, what do we do when someone arbitrarily says they now identify as female? Who gets to make that decision on whether it's valid or not? What if a really swole dude who grinded out years in the gym really does one day decide they identify as female and they won't do HRT? Is their transition less valid? Is it still fair to the gender they now identify as? Does every sporting organization and body get to have their own standard of reasonableness? ("Must "live" as the gender they identify with.")
Well, because the standard for "women's" and "men's" Olympics is not actually based on the gender identity of the participants, it doesn't matter. If you are a cisgender woman who doesn't make the hormonal/etc. standards, you don't get to play as a woman, and that's it. There is no olympics for nonbinary-identified athletes and that doesn't mean that they don't participate. They participate based on hormone makeup.
Is it arbitrary? Yeah. There is no way to do this and have "male" and "female" sports that isn't arbitrary. There simply isn't.
There are cisgender women who produce too much testosterone by IOC standards, without intervention, all by themselves.
Post by: nenjin on November 04, 2022, 11:56:33 am
Quote
The same way you square "sucked as an ice skater but turned out to be really good at long jump" or any other such change of sporting targets. We wouldn't be having this conversation about trans women in gymnastics and ice skating, by the way.
Not sure I agree 100%. Ice skating is more about balance and muscle control, where raw strength potential doesn't matter as much. Heavier, stronger, less flexible people probably perform worse at ice skating due to the power/weight ratio, stamina and a few other factors.
Gymnastics though...it kind of uses everything. Power/weight ratio, muscle coordination and balance all matter but raw strength potential matters too for various applications in gymnastics. I'd point to the fact that male gymnasts are fuckin' ripped by and large. So how high you can fling yourself off the bars is part strength, and part power/weight ratio. I guess I can see a trans woman in gymnastics skewing things depending on what we're talking about.
Quote
There are cisgender women who produce too much testosterone by IOC standards, without intervention, all by themselves.
Fair point and well taken. I think it's unfair that someone AFAB who identifies as female but genetically produces more testosterone on average are excluded. That's literally the genetic lottery they won as far as sports go and they're being deprived of their chance to utilize it.
Post by: Starver on November 04, 2022, 11:58:52 am
Though I've been reading here, I'm at best a fringe consumer of of the thread (in the "LGBT+", I'm more in the "+", specifically one or other of the "A"s), so not wanted to wade in beyond my remit, but it is indeed much that to be a superiorTrans athlete you generally have to start by being a superior athlete, and that's before you put the positives and negatives of carrying through the process of the transition. (Someone with general motivation, dedication and perserverence would be more representative of those making the journey than not, on top of innate aptitude.)
I can also report of a transitioned person, of my acquaintance, who was not a top competitor before (far from it!) and remained not a top competitor afterwards (not better, by any measure!), but of course she'd never be in the Olympic-level spotlight in the first place - this is amateur-level competition (as indeed should be the Olympics, but you know what I mean...) that I'm talking about.
But it's in issue with probably far more side-issues than reliable datapoints.
And I'd err towards the view that trans individuals are proportionately more disdadvantaged (in all kinds of ways) by being forced to remain in birth-gender circumstancss, than non-trans ones are from being forced to accept transitioned(ing) ones. But with heavy caveats, and doubtless still heavier controversy, I know. And I don't think the answer is para-sport-like subclass labels to reduce competition to like-vs-like (or a reweighted result for near-vs-near), for both practical and social reasons. ("And in lane three, we have the recently incumbant MtF4 champion who is now in the MtF5 category, making this the first time she's had to directly compete on a par with the long-standing superstar of this class, in lane four, who is...")
Anyway, didn't want to perpetuate this(/these) argument(s). As a token "something else to talk about", I saw that the Bishop Of Oxford (https://www.bbc.co.uk/news/uk-england-oxfordshire-63502725) has been saying conciliatory things that might ultimately help those both in this community and within his ministry.
Post by: nenjin on November 04, 2022, 12:07:09 pm
Post by: Starver on November 04, 2022, 12:32:01 pm
But I can't see much room for furthering a resolution to the debate, either. Absolutists (either way) won't stop being absolutists, and those with wriggle-room are probably going to be as wriggly after listening to pros/cons as before, only with a slightly different subset of nuances. Debate away, I just don't expect us to collectively put the world to rights, in a mutually acceptable manner across all current positions being held.. ;)
So I was giving my stance, and offered up a different tangent to 'argue'/discuss. And at least I'm now officially PTWed, whether I have anything else I think anyone wants/needs to hear. :P
Post by: Vector on November 04, 2022, 09:30:21 pm
I'd point to the fact that male gymnasts are fuckin' ripped by and large. So how high you can fling yourself off the bars is part strength, and part power/weight ratio. I guess I can see a trans woman in gymnastics skewing things depending on what we're talking about.
See, what you would know if you follow women's Olympic gymnastics to any degree (:P) is a couple of things.
1. Most female gymnasts are also extremely ripped, but more importantly
2. Female and male gymnasts are scored on different tasks and even have different events using different equipment. Men's gymnastics does not include many moves that women's gymnastics does include and even requires for successful performance, so going from being a high-scoring male gymnast to a high-scoring female gymnast would require a fuckton of work.
The moves and routines which are scorable for "Female" and "Male" gymnastics are partly designed so that women's gymnastics "looks feminine" and male gymnastics "looks masculine." Female gymnastics includes many tasks it is believed that men are simply biologically incapable of, and many of the moves which men could even in theory do with their equipment setups are not on the list of allowed moves for which they could receive points. This is supposedly in part due to a desire to keep "effeminate" moves out of men's gymnastics. But, if you set all of that aside, by far the most important point is that
3. Olympic-level female gymnasts are overwhelmingly around 5 feet tall.
There are age restrictions on female Olympic gymnasts because if you look at who your most successful gymnast is going to be WITHOUT those restrictions, that person is going to have the critical combination of being 1. short with 2. almost no body fat so that 3. they're just a little lean muscle rocket. The people who best fit this description are prepubescent girls with a maximum age of about twelve or thirteen.
In strength-based tasks, an adult woman is going to perform a child almost all the time. But for women's gymnastics, that's not the goal! You don't need strength. You need flexibility, to be small, and to have no extras.
The age limits for women's gymnastics are because gymnastics is dangerous and it's not actually that healthy as a society to have a bunch of prepubescent or barely-pubescent girls risking their literal necks.
Now, the reason why I know all of this is partly because the only Olympic sports I watch are women's figure skating and gymnastics, and the only one I'm really interested in is the latter. I have read a non-zero number of books on these sports.
But it's also because before Simone Biles came through and started sweeping everything, there was a massive scandal one year regarding the Chinese women's gymnastics team. The scandal was not about doping. It was that they won every last medal because their women's team was underage.
So, no. Unless you're literally built like Vegeta from DBZ, i.e. 5'4" with spiky hair included, going through male puberty is going to give you nothing but handicaps when it comes to women's gymnastics--starting with the "puberty of any kind" part.
(https://img1.wikia.nocookie.net/__cb20120202063055/dragonball/images/6/6e/Vegeta_dance.gif)
Post by: nenjin on November 05, 2022, 01:56:57 am
Post by: Tiruin on November 05, 2022, 11:57:15 am
Just skimmed the last page and it's nice seeing a bunch of comfy folks. (Wooo Vector! Always saw the sports 'debate' as a huge distraction given...the current since near a decade ago)
Post by: Doomblade187 on November 05, 2022, 04:18:18 pm
Post by: Great Order on November 06, 2022, 12:18:39 am
It's super effective!
Tiruin fainted.
Got ₽158
Sent ₽79 to mom
Post by: None on November 06, 2022, 10:59:31 am
Anyways, posting to show solidarity! I'm still not comfortable enough in my own skin to definitively consider myself bi (or find out to the contrary), but I'll stand by you any day.
Post by: Rolan7 on November 06, 2022, 11:24:00 am
GSC is still my favorite too! I like to plug the Crystal Clear romhack when I can. It makes all pokemon catcheable, gym leaders re-challengeable, and has a ton of aesthetic and QoL improvements. The legendaries like Celebi or Mew have scripted quests. And the Pokedex!! You don't have to use a guide because the Pokedex will tell you how to get something once you've spotted it!
Rechallenging Bugsy or Falkner with 15 badges is fuuun~ There's sometimes "environmental storytelling" there, like what Morty gets IIRC.
Anyway the hack's discord is very LGBTQ+ friendly, and the mod freely lets you be male/female/neither with any of like a dozen portraits (or splice in a custom one), so yeah :D
oh wow I very nearly forgot my "antidepressants" this morning, DST's throwing me off. I'm glad I finally got this pill case, particularly with me going on a trip this week!!
When I get back I'm having my 6 month bloodwork done. It was really strange switching to daily sublingual rather than weekly subQ. I enjoyed the hormone peaks, and the troughs weren't so bad after my first prescription adjustment. But it's probably healthier having it at a smooth background rate. My chest stopped hurting which made me worried that it wasn't working, but apparently that was just the growth of buds. Biology is so coooool!! And while they're still invisible in my usual baggy shirts, I measured 2.5" band-to-bust last night which scientifically means that I am, in fact, making progress :D
like, that's actually more than a lot of people grow without assistance, particularly at my weight level.
Post by: Great Order on November 06, 2022, 01:06:54 pm
Post by: Grim Portent on November 06, 2022, 02:29:36 pm
It's wild knowing that you're programmed to be both a boy and a girl, and it's just a matter of a single hormone that determines which set of genes is active.
Take a look sequential hermaphrodites. Mostly a fish and amphibian thing, mostly because genitalia get more complicated and energy intensive to keep and adjust when you leave the water, but very interesting when you think about the implications it has for vertebrate biology in general.
Easiest example to work with is clownfish, like Nemo. All clownfish hatch male, they only become female through a shift in hormones that occurs when there is no female in the area, such as after a barracuda attack. Like Nemo. :P
It's a one way transition, and only the biggest most dominant male does it, becoming the new alpha female of the school. When she dies, the next male takes their turn becoming a female and the new boss.
IIRC it's also common among wrasse, which can be pretty big depending on species, and there's evidence of it in frogs, but that can be hard to find among the reports of frogs being turned into hermaphrodites when exposed to pesticides.
Post by: Great Order on November 06, 2022, 02:46:58 pm
Post by: Egan_BW on November 06, 2022, 03:02:54 pm
Post by: Great Order on November 06, 2022, 03:03:59 pm
Post by: Egan_BW on November 06, 2022, 03:04:39 pm
Post by: Rolan7 on November 06, 2022, 03:10:54 pm
Post by: Grim Portent on November 06, 2022, 04:04:44 pm
Oh yeah, loads of animals do sequential hermaphroditism. Although I have to say my favourite thing is aquatic flatworms. They're just full hermaphrodites, so they do penis fencing and whoever gets impregnated first becomes the mother and the father swims off.
Personal favorite simultaneous hermaphrodite is land snails. Granted it's because of a trait all land snails have, including the non-hermaphroditic ones.
Love darts.
I find it absolutely hilarious that snails have to shoot each other in the head with what is essentially a bone spear they grow next to their penis in order to successfully mate.
On the idea of making a healthy male/female clone/offspring with just your own DNA, technically possible, biologically unwise. That said parthenogenetic reproduction works for some animals, and that's the same idea.
Post by: Starver on November 06, 2022, 08:01:20 pm
X/Y tends to strand you in XX-only totally female lineage, if you crack the virgin-birth bit.
But X/Y is basically a mammalian thing. W/Z is in many other things (crustaceans, etc), then there's haplodiploidal systems like XO and ZO (one X, or Z is one gender, two of that is the other; it may depend upon fertilisation to provide the bonus copy) or ignore all that and activate the desired sexual dimorphism by the temperature range the eggs is subjected to or other environmental factors.
(Or, indeed, the post-developmental switching from the default "born as" to whatever your species finds works best to fill in the gaps, there being both MtF and FtM lifecycles (for the oldest/largest creature, or maybe just the first to detect a paucity of the endgame-gender so unsuppresses the necessary hormones) as well as fully bidirectionally genderfluid in the ways already described.)
But not sure how close we could be to Usula le Guin's version of humanity (or subset of it) in LHoD.
Perhaps we could hope for merely an "it does not socially matter what gender you are, c.f. Ann Leckie's set of Ancillary books. The imperial Radchaai, at least... The society in Provenance merely delay setting a person's assigned gender in stone until they make a choice to be 'adult', IIRC, but are still not hung up on things that much. And, the fictional universe references all kinds of variations between ostensibly-human societies (never mind the Presgers).
...right, so a bit of obscure RL biology and a bit of an obscure book reviewing (or at least recounting, but I would in general recommend Leckie's works[1]). Hopefully you don't mind my sticking those two oars in again. Looks like a bit of a diversion, but meant it all to be informatvely relevent.
[1] At least for people who don't froth at the mouth at suggestions of genderfluidity... basically SF books with an interesting societal backstory to the setting, nothing 'lewd' and direct (relationships seem to be Discworld Dwarven in nature, and progeny clearly happen but might well be adopted if necessary, or similar) but you know how some people might decide to take offence at the mere idea. Not the kind of people who would calmly participate in this thread, however, so probably no worries there.
Post by: Great Order on November 06, 2022, 11:27:02 pm
On the idea of making a healthy male/female clone/offspring with just your own DNA, technically possible, biologically unwise. That said parthenogenetic reproduction works for some animals, and that's the same idea.It's unwise long-term because of diseases exploiting any flaws you have in your immune system. There could be some recessive diseases that'd crop up due to the way meiosis works* if you're a carrier, but if not you'd be fine in the short run.
But we're in a situation with a trans man and a trans woman, so reproduction's hardly an issue.
*Not only is the chromosome in the gamete randomly selected, the genes will swap across from one chromosome to the other. If one chromosome had the genes that controlled hair colour and eye colour, and you had one chromosome programming ginger hair and blue eyes and another programming blonde hair and green eyes, your hypothetical hyper-inbreeding child could wing up having ginger hair and green eyes despite neither chromosome coding for that combination.
Post by: Loud Whispers on November 07, 2022, 10:27:50 am
JOCKEYS RISE UP (https://www.youtube.com/watch?v=NVt6EvaUN6A)
Post by: nenjin on November 07, 2022, 07:36:56 pm
"Unless you're built like Vegeta"
JOCKEYS RISE UP (https://www.youtube.com/watch?v=NVt6EvaUN6A)
Let me just get THAT right out of my Youtube history.....
Post by: TD1 on November 07, 2022, 08:38:30 pm
They're at their best when used as a springboard for understanding your self better.
All too often they're simply used as a ready-made formula of selfhood.
Words are wind. Transition does not change self. Perhaps it makes the performance of self more comfortable. But One remains One.
Unless One is pregnant I guess. Or about to get married, depending on religion.
Post by: Great Order on November 07, 2022, 10:21:53 pm
People are just way too difficult to quantify because we're ever-shifting in myriad small ways.
Post by: TD1 on November 08, 2022, 09:11:15 am
At worst, it's a means of accruing new labels and definitions which, through performance and conscious adherence, serve to cloud the self.
I knew someone who was hesitant to give diagnoses to people, such as those with ADHD, whose symptoms were just integrated comfortably into their normal life. All too often, she said, a diagnosis caused them to perform - or not attempt to address - negative symptoms.
Random illustrative example. Providing someone with a label caused them to enact an entire category of meaning, not the individual or personal.
Post by: Rose on November 08, 2022, 11:06:07 am
I only came into existence once transition started, and the person who owned this body before doesn't meaningfully exist anymore. Even if I have access to all his memories.
Post by: Loud Whispers on November 08, 2022, 11:18:29 am
Let me just get THAT right out of my Youtube history.....You mean these? My adsense recommends? My super-duper personalised marketing profile? You mean my ultra-specific demographic-oriented native content deployment stream? You mean my economy-driving shareholder arousing generic family-friendly commercialistic ultra plus oneTM targeted content relevising AI optimising course of personal history-perverting terms of conditions ignoring permissions?
Also regarding the self; I'm with the Buddha on this one, in the sense that it is true there is no 'self' distinct from the rest of the universe or the rest of time. The brain and soul is really the universe looking in on itself, and the 'self,' is just what it's seeing. So when we're content, that's the cosmos's way of knowing it is grateful for what it sees
Post by: nenjin on November 08, 2022, 11:58:51 am
Quote
You mean these? My adsense recommends? My super-duper personalised marketing profile? You mean my ultra-specific demographic-oriented native content deployment stream? You mean my economy-driving shareholder arousing generic family-friendly commercialistic ultra plus oneTM targeted content relevising AI optimising course of personal history-perverting terms of conditions ignoring permissions?
Yeah, that.
Post by: Vector on November 08, 2022, 12:13:33 pm
QuoteYou mean these? My adsense recommends? My super-duper personalised marketing profile? You mean my ultra-specific demographic-oriented native content deployment stream? You mean my economy-driving shareholder arousing generic family-friendly commercialistic ultra plus oneTM targeted content relevising AI optimising course of personal history-perverting terms of conditions ignoring permissions?
Yeah, that.
Magnificent.
At worst, it's a means of accruing new labels and definitions which, through performance and conscious adherence, serve to cloud the self.
Ah yes, like (checks notes) one's assigned gender at birth clouding the self pre-transition, and making people who interact with you treat you like a broken [assigned gender], as opposed to a healthy transgender person.
Post by: Loud Whispers on November 08, 2022, 03:21:28 pm
Post by: Imic on November 08, 2022, 05:16:34 pm
Post by: Grim Portent on November 08, 2022, 06:40:38 pm
dressing like a vampire every day.
The world needs more capes.
Post by: LadyBrassroast on November 08, 2022, 11:49:29 pm
along with a full suit of armor and visored helm, and the resulting inability to be perceived would do wonders for my autism and my gender
Post by: Vector on November 09, 2022, 12:15:38 am
Post by: LadyBrassroast on November 09, 2022, 12:18:17 am
Post by: Great Order on November 09, 2022, 01:47:45 am
I keep seeing names I don't recognise and then they say "Oh yeah, I used to be [username]". Like I remember Cinder, turns out they swapped their name to Hops.
Post by: LadyBrassroast on November 09, 2022, 02:28:23 am
Post by: TD1 on November 09, 2022, 05:04:18 am
; the consequences of the French revolution upon gendered fashion for example have been a disaster to the human race
Ohh, tell me more
Post by: Magmacube_tr on November 09, 2022, 05:35:31 am
Yeah I'm also realizing a large number of people who were here five or ten years back turned out trans, so that's cool
Yeah, people of transing their genders is a common theme here in Bay12. I wonder why?
Post by: nenjin on November 09, 2022, 10:35:17 am
Despite my earlier position, I think this one is pretty much horseshit. Like a afab woman has never given a concussion to another afab woman who took a solid spike to the face. There's also the usual muttering about the trans athlete making other women in the locker room feel uncomfortable.
Post by: None on November 09, 2022, 10:50:47 am
Post by: Frumple on November 09, 2022, 10:53:07 am
Post by: Tiruin on November 09, 2022, 11:58:46 am
Because trans people exist :v and the only thing that changed is either others knowing or the lessening of oppression to actually acknowledge that via others' personhood.Yeah I'm also realizing a large number of people who were here five or ten years back turned out trans, so that's cool
Yeah, people of transing their genders is a common theme here in Bay12. I wonder why?
https://nypost.com/2022/10/22/north-carolina-school-district-votes-to-forfeit-games-against-rival-after-transgender-athlete-injures-player/It's assimilation culture and the weird thing is it's a proactive driven thing very obvious in the US; they've been running these since years ago to saturate and push beliefs as distractions or conclusions to take up that mental load.
Despite my earlier position, I think this one is pretty much horseshit. Like a afab woman has never given a concussion to another afab woman who took a solid spike to the face. There's also the usual muttering about the trans athlete making other women in the locker room feel uncomfortable.
So of course it's rubbish but it's paid, proactive, and organized rubbish. I don't know why there's a position against trans people in sports when the whole thing is a fabrication.
Post by: Great Order on November 09, 2022, 12:16:26 pm
By trans men.
Post by: nenjin on November 09, 2022, 12:43:55 pm
Post by: Great Order on November 09, 2022, 01:56:06 pm
At this point it's trans people's turn on the anger treadmill. Used to be Muslims, LGB, non-whites, non-Christians, so on and so forth back through the ages. Nowadays we have to deal with the othering being industrialised.
Post by: LadyBrassroast on November 09, 2022, 01:56:33 pm
Post by: Great Order on November 09, 2022, 01:58:12 pm
Of course, if they do it's doubtful they'll change track to a different type of messaging but rather go after another group instead.
Post by: Loud Whispers on November 09, 2022, 02:05:13 pm
Ohh, tell me moreThroughout human history fashion has been incredibly expressive regardless of how many genders a civilisation had or whatever garments, textiles, colours or outlines were associated with whatever gender roles. Throw a dart at a global map and look into traditional clothes of the peoples who lived there, and chances are you'll find an expressive mix of cuts, materials and colours. Doesn't even really matter what time period or wherever you are; the vividness of humanity is reflected in thread and dye.
There's an exception though. Which is that communities dominated by maritime & agrarian labourers tend to produce fashions with far more emphasis on practicality than expression, which also tends to correlate with more defined and distinct gender roles. E.g. in Qing dynasty China, the Han Chinese have lots of variety in colour, cuts and garments for men and women, and in particular women's fashion experiences a lot of experimentation and evolution in styles. You also see the practice of foot binding, as well as government enforced gender-specific fashion laws relating to hairstyles and fashions of men. But compared to the Hakka Chinese in the same period, where they are largely farmers and fishermen, where both genders are expected to contribute to the demands of labour. The fashion is shirt and trousers for both men and women. The outlines are the same, as the focus is on long straight cuts which are easy to sew and easy to fix. Colourful dyes or expensive silks are prohibitively expensive. There's no foot binding practiced because everyone needs to be healthy and fit to work the fields or boats. Fashion follows function, whereas in the city function follows fashion.
Pre-French rev France had a similar distinction between the labourers and the landowners. But post-revolution fashion gets utterly buggered because;
- The concept of a national people having a national folk dress causes people to start viewing fashion as a static feature of national identity, and not something constantly in motion. E.g. kilts are Scottish and drindls are German. Fairly harmless until you see the consequences 200 years later where folk fashion gets put in a museum and stops being a living thing people view as normal, and any attempt at keeping it alive by adapting the fashion is seen as a violation of an "authentic" version. It's especially grating when a piece is actually put in a museum as an "authentic" piece of a culture's fashion, since it reinforces this curious notion of "normal fashion evolves, abnormal foreign fashion is static." Reminds me of the disastrous attempt by Japanese kemono makers to export kemonos to white Americans getting shut down for cultural appropriation, despite being a sincere attempt at cultural exchange.
- The concept of gendered fashion gets kicked up a considerable notch with the end result being men's fashion gets obliterated in terms of diversity and experimentation. Pre-French rev it's completely normal for the total spectrum of men; paragons of masculinity, effete men, androgynous men and all in between, to wear fashions incorporating all garments, colours, cuts and so on. To wear tights, jewelry, high heels, skirts, gowns and so on today is a daring challenge of masculinity, but for Henry VIII it was no challenge at all, nor would it'd have been for any working man. Amongst children too, both boys and girls would be commonly dressed in gowns or dresses, and this was not some epic culture war as it is today, it was just an ordinary fashion which wouldn't even bear remark. Post French-rev one of the lasting attacks on aristocracy was the attack on aristocratic fashion; everything associated with the upper class fashions was derided for being womanly, compared to the manly working man. French fashion became the model for American fashion, and between the European colonial empires and the American 20th century, the Euro-Merrican models of fashion became from Chile to Japan the global idea of "normal" fashion, displacing all other fashions as remarkable expressions and not ordinary expressions. Whereas women's fashion continued to play with outlines, materials and colours, men's fashion reduced in complexity, colour and cuts, even losing the hat and waistcoat until just the trousers, shirt and boots remained acceptable. The practice of raising boys in dresses also died out come the turn of the 20th century, and with it the idea of gender neutral or even masculine fashion became something radical and novel - all because the scars of "lace, silk, heels and the rest are aristocratic," never healed.
The end result is men's fashion is still really hard to push outside of its confines for the world; because you can transgress the confines, but you have to have justifications and be constantly prepared to defend your choices - similar to how a Han Chinese person wearing Hanfu in Beijing is seen as clearly making a "statement," a man wearing anything besides a shirt and trousers is seen as making a "statement." The confines are so well-defined and ingrained that it almost seems like it has always been this way for all eternity, but actually it's itself a young concept in the history of mankind.
That's why I think the end-goal for "gender is a social construct" is not transgender presenting as a radical act, but unfucking the social construct until there is no transgression, and however you present yourself gender-wise becomes an ordinary occurrence, not a revolutionary one. I am also optimistic, in that if fashion can change so rapidly once before, then it can also change rapidly once again. This would also be a change that benefits everyone, since everyone can appreciate more choices, even choices they have no intention of using
Post by: Doomblade187 on November 09, 2022, 06:50:51 pm
Yeah I'm also realizing a large number of people who were here five or ten years back turned out trans, so that's coolPeople unconsciously form communities with people and environments they feel safe and welcome in.
Post by: Mech#4 on November 10, 2022, 02:03:54 am
Ohh, tell me moreThat's why I think the end-goal for "gender is a social construct" is not transgender presenting as a radical act, but unfucking the social construct until there is no transgression, and however you present yourself gender-wise becomes an ordinary occurrence, not a revolutionary one. I am also optimistic, in that if fashion can change so rapidly once before, then it can also change rapidly once again. This would also be a change that benefits everyone, since everyone can appreciate more choices, even choices they have no intention of using
I know I would love there to be more variety in mens clothing. When I go shopping for clothes, part of the long time boredom I had with it growing up was because, for men, basically everything is all the same with different band logos, coloured plaid patterns and other things I would never wear myself. I like wearing boots (Like, dress boots not work boots) over runners/sneakers because my feet don't end up sweating as much, but as you remarked, I feel that even wearing boots sometimes puts me in an odd position of standing out.
Jackets are the same. I like wearing a nice overcoat but if I want something that has anything more going on outside of plain black with no detailing I would have to start looking into womens clothing.
There's not even that big of a difference sometimes between the two. A belt for men and a belt for women often just comes down to the women belts having interesting patterned leather and a larger buckle rather than just being a thin strip as-minimal-as-possible.
You can find nicer, more varied clothes but here at least I would have to go to much more expensive tailors and I don't have that kind of money to spend. I really need to get into modifying my clothes myself to add patterns and stuff.
Post by: Imic on November 10, 2022, 04:39:34 am
... With all that being said, I will admit to having contemplated the possibility of me being trans on more than one occasion, though I don't think it to be the case... probably.
Post by: Tiruin on November 10, 2022, 07:02:39 am
(https://cdn.discordapp.com/attachments/495424271120596992/1001293262876844142/RDT_20220726_0944351951323599629489566.jpg)
Clothing has no gender and it's what people give and bring onto something that adds meaning or value. Go explore! The labels that apply are those you choose. Them stuff with yourself is trying things out, and it's better anyway the more you know because the conclusions come by you first. c:
Post by: TD1 on November 10, 2022, 10:06:32 am
*Snip*
Hrrrm.
I have no doubt that the French Revolution, and a general rebellion against nobility/aristocracy in Europe, was tributary to fashion changes. But I doubt that the French Revolution was the source.
Look at Oscar Wilde, for instance. Dandies were condemned for snobbery and effeminate clothing, but nevertheless there was still a cultural construct capable of maintaining their lifestyle more than a decade after the French revolution.
I'd say we ought to look broader than one event. Revolution is a mindset, not an event, to paraphrase Jim Butcher.
The French revolution, which targeted the trappings of a particular way of life, came at the same time as the Industrial Revolution. Things, including clothes, were made en masse - and capitalists love shaving pennies off the cost of production. Goodbye lace, embroidery, decoration. These were all time consuming, produced by hand and expensive.
Another significant revolution was spiritual. The Reformation, begun in the early sixteenth century, established criticism of ornamentation and boisterous colour. This extended beyond criticism of ornate Catholic cathedrals and into critique of individual dress. Good works defined man, and the rich man could not make it through the gates of heaven. Sobriety and charity were not indicated by boisterous clothing.
The paintings of the Dutch Republic show spiritual men in sombre black.
The third revolution, and I'd argue the most significant, was in travel. Globalism established a mono-culture dominated by colonising powers such as the American and European nations. Mass-production of drab factory clothing would not have mattered were it restricted to a single nation, but it wasn't. Cheap clothing dominated the global market, undercutting clothiers everywhere.
There were more contributory factors, but I've said enough to illustrate that the French revolution was a symptom of broader societal changes which influenced fashion and - besides - that other events and even mentalites contributed to today's bland fashion for men.
Post by: alway on November 10, 2022, 11:36:27 am
What I'd love, absolutely love to do, would be to start wearing goth platform boots. I love boots, I love 'em so much, but I have nowhere near the self confidence to overcome my anxiety and go full goth in public. I'd love to wear a skirt, and tights, and a crop top and- fuck it, a corset too, corsets are cool. But, the idea also terrifies me. Anxiety's a bitch. I guess it just makes me sad that it's socially acceptable for Women to wear Men's clothing but, yeah, the "acceptable" spectrum of Men's clothing starts at plain shirts and ends at shirts with band logos printed on them, with anything outside that spectrum being "alt".I do recommend acting on that; exploring presentation is terrifying, but quite satisfying. Learning to overcome that fear/anxiety of going against the grain of society is something I find quite beneficial in other areas of life as well, and it really is a skill that gets built up over time.
... With all that being said, I will admit to having contemplated the possibility of me being trans on more than one occasion, though I don't think it to be the case... probably.
Half a decade ago, when I was exploring gender and presentation stuff, I picked up some skirts from amazon, thigh high socks from sockdreams, and my favorite dataerase jacket. It was a really interesting experience: I'd get some weird looks from folks on occasion, but at the same time, I started getting frequent compliments on my outfits from strangers while out of the house; which isn't something I'd ever really got before. I came to the conclusion that I liked that (and also that I was a girl; but that part would have been irrelevant to me continuing to wear it on the regular).
Post by: Mech#4 on November 11, 2022, 03:06:02 am
What I'd love, absolutely love to do, would be to start wearing goth platform boots. I love boots, I love 'em so much, but I have nowhere near the self confidence to overcome my anxiety and go full goth in public. I'd love to wear a skirt, and tights, and a crop top and- fuck it, a corset too, corsets are cool. But, the idea also terrifies me. Anxiety's a bitch. I guess it just makes me sad that it's socially acceptable for Women to wear Men's clothing but, yeah, the "acceptable" spectrum of Men's clothing starts at plain shirts and ends at shirts with band logos printed on them, with anything outside that spectrum being "alt".
... With all that being said, I will admit to having contemplated the possibility of me being trans on more than one occasion, though I don't think it to be the case... probably.
Those big soled boots do look pretty neat. I remember thinking about getting some but figuring that, unless I got a really good brand, the sole would probably fall off pretty quickly.
I do like the whole goth culture of clothing. Sure the whole "everyone is wearing similar clothes they bought from Hot Topic to not conform" is true to a degree, but I admire the confidence to be able to do so.
I think when it comes to clothing, I like androgyny and wish it was easier to wear some clothes meant for women. I wouldn't be one for skirts or such, I don't like having my legs or arms exposed, but more variety would be nice. It's part of why I like JJBA and am happy it's reached broader appeal. The clothing designs in that are very out there for male characters.
Post by: Imic on November 11, 2022, 03:08:47 am
Post by: Mech#4 on November 11, 2022, 03:32:07 am
Clothing has no gender and it's what people give and bring onto something that adds meaning or value. Go explore! The labels that apply are those you choose. Them stuff with yourself is trying things out, and it's better anyway the more you know because the conclusions come by you first. c:
How arbitrary some differences are really annoys me. Like with belts as I mentioned... or disposable razors.
Post by: Loud Whispers on November 14, 2022, 10:51:39 am
I have no doubt that the French Revolution, and a general rebellion against nobility/aristocracy in Europe, was tributary to fashion changes. But I doubt that the French Revolution was the source.To bring up my earlier example, which is strikingly relevant here, it's rather like some of the Chinese couples I saw in Beijing wandering around in traditional Hanfu clothes. Which is to say that there exists the people and the subculture who do dress in the traditional clothes, but the effect of Western fashions has made it such that the traditional clothes are no longer a living, normal cultural construct which evolves with the times - but is instead a static thing which exists in contrast, in its own sphere where the fact of wearing it is treated as a rebellious act, and not an ordinary act. Dandies would not have been dandies just 1750s, but in the 1790s the fact that they doubled down on traditional fashion and wore lace and breeches in direct opposition to the without-breeches (https://en.wikipedia.org/wiki/Sans-culottes) fashion is what I mean. French rev merked fashion
Look at Oscar Wilde, for instance. Dandies were condemned for snobbery and effeminate clothing, but nevertheless there was still a cultural construct capable of maintaining their lifestyle more than a decade after the French revolution.
The French revolution, which targeted the trappings of a particular way of life, came at the same time as the Industrial Revolution. Things, including clothes, were made en masse - and capitalists love shaving pennies off the cost of production. Goodbye lace, embroidery, decoration. These were all time consuming, produced by hand and expensive.I'll have to agree with you, since the perspective you advocate is full of such wisdom and sagacity as to be without counter-argument. The only exception perhaps is that industrialisation actually increased the demand for luxurious fashion. One of the fondest things I ever studied at University was the history of the rise of conspicuous consumers in London - which arguably featured the first community of non-aristocratic but wealthy wastrels whose sole vocation was to be seen spending money. Moroccan leather, Chinese silk damascs, Italian lace and Indian wool & cotton were all in incredibly high demand by conspicuous consumers - one amazing dress in the London history museum made 400 years ago was made for a lady by Chinese tailors using measurements made to order and shipped to the UK, taking 2 years to arrive. The importation of so many foreign textiles upended the English wool industry which had hitherto been the backbone of English industry & taxation since the time of the Normans (I exaggerate, but it was a major source of income and tax revenues for people and King), and a lot of the peoples involved in the wool trade were inevitably threatened by changing tastes of fashion. In one amusing incident, a very well-off lady was wandering around in her fine Chinese silks, when two wool spinners picked her up and nailed her dress to a post in protest! However the ire of the wool tradesmen soon died down when they began embracing changes in industrial looming that allowed English workers to make more money working Egyptian cotton or Indian calico than they would sticking to the wool trade. I doubt the industrial revolution would necessarily have a negative or positive effect on fashion diversity, as there are industrial nations known for experimenting with fashion just as there are known for not. But what is key is that in the following centuries Western fashion was marketed as the clothes of civilisation, progress, normality, and the world has never shaken those ideas since
Another significant revolution was spiritual. The Reformation, begun in the early sixteenth century, established criticism of ornamentation and boisterous colour. This extended beyond criticism of ornate Catholic cathedrals and into critique of individual dress. Good works defined man, and the rich man could not make it through the gates of heaven. Sobriety and charity were not indicated by boisterous clothing.
The paintings of the Dutch Republic show spiritual men in sombre black.
Spoiler (click to show/hide)
The third revolution, and I'd argue the most significant, was in travel. Globalism established a mono-culture dominated by colonising powers such as the American and European nations. Mass-production of drab factory clothing would not have mattered were it restricted to a single nation, but it wasn't. Cheap clothing dominated the global market, undercutting clothiers everywhere.Globalism and imperialism decided that there would be one standardised fashion across the world, but it wasn't a guaranteed fact that the fashion would be so boring.
Stop encouraging me, youse're gonna make me do something I won't regret :PThat goth scene got me acting unwise
Post by: Great Order on November 15, 2022, 03:00:00 am
1) There's a lot of "UwU Good Girl" type stuff that I just find cringey. Done as an occasional joke it'd be fine, but it's constant and chucked at literally everyone regardless of their opinions on it.
2) Way too much negativity and overdramatisation. I saw someone seriously arguing, with others supporting them, that most cis people treat us like pre-civil rights black people. I get it, a lot of people view us as dangerous, perverts, etc. etc., but the sheer amount of constant doomerism is absurd and honestly, I can see it being self-defeating.
3) There are some really awful hot takes. I still get a bit pissed off about the person who told me that I *need* to be an out-and-proud trans person or else I'm basically betraying everyone else.
It's part of why I'm not too keen on my psychiatrist's recommendation that I go and basically do trans networking. Maybe I've got a bit of a warped view because of being exposed to online spaces rather than ones with people face-to-face, but I dread coming across people like this in real life. On top of that, I really don't want being trans to be a big part of my identity. I mean, it is, it's impossible for it not to be, but I don't want my life to heavily focus around it. I want to transition and just get on with life really.
Sorry for dropping a chunk of negativity on here, it's just beginning to get to me a bit. It feels like I'm wading through a load of crud when I'm trying to find help and advice.
Post by: Rose on November 15, 2022, 11:46:40 am
Yeah, I moderate support server for trans people in the greater portland metro, and we have to routinely tell people to cut it out when they do points 2 and 3. Thankfully point 1 is less common here.
Also thankfully I managed to join a little bay12 irc channel that later turned out to be full of trans people, and it doesn't have any of that shit and the people there have been great.
Post by: LadyBrassroast on November 15, 2022, 01:54:42 pm
Post by: Vector on November 15, 2022, 03:05:20 pm
And then when you get a couple of the less marginalized trans people in a group that's more mellow they can be convinced to also become more relaxed. It's all about developing social norms.
I don't think I've ever gone in for a trans-only internet space myself though, I just tend to end up in a lot of spaces that happen to have a lot of us.
Post by: Rolan7 on November 15, 2022, 03:32:48 pm
Quote
I don't think I've ever gone in for a trans-only internet space myself though, I just tend to end up in a lot of spaces that happen to have a lot of us.It's interesting how that keeps happening (this community for example, as has been noted). I know of two theories I agree with:
1) Neurodivergent people tend to congregate, and that statistically means more people who question gender and perhaps find a disconnect. The neurodivergent have an offset perspective which can lead to critical analysis of social mores.
2) People who already knew they were different coming out as such once they feel safe saying so, following some well-received pioneers.
The latter can apply to a lot of groups, like furries or Homestucks. Or bad groups who are intolerant, so we must be careful. Being discerning in who is accepted into a community makes it all the more meaningful when openly queer people are accepted.
That said, I'm all for "containment" threads like this or channels on discords, because there's a difference between accepting trans people and needing to see our stuff all the time. (particularly the cringe stuff from GO's first section). Maybe or maybe not it's fine that I'm still mentioning my transness (nonbinary genderfluid dream hijinks) in other threads, but it's very good to have a relief valve where I can uWu or w/e. (I'm 36 and HRT has me comfortably unhorny, though I enjoy my relationships).
Post by: nenjin on November 15, 2022, 07:16:29 pm
Quote
3) There are some really awful hot takes. I still get a bit pissed off about the person who told me that I *need* to be an out-and-proud trans person or else I'm basically betraying everyone else.
This is the one that always gets me >.>. About 6 years ago or so I started seeing chatter about trans rights activists taking the tactic of "no one is our ally." That even people who agreed with you had to be treated in some way as if they weren't, to constantly push the envelope further and get more support out of people than they were already giving. A sort of take-no-prisoners attitude even amongst allies and supporters. An un-passable purity test.
While many things may not be equal, at least we can observe that bad takes and being toxic knows no boundaries.
Post by: Vector on November 15, 2022, 08:13:30 pm
Post by: Rose on November 16, 2022, 10:29:51 am
Post by: Egan_BW on November 16, 2022, 03:54:42 pm
Post by: Rolan7 on November 17, 2022, 08:44:22 am
Quote
[GEORGE enters apartment, sits down. JERRY is in midst of making coffee](also my liver is in great shape, which is both absurd but also maybe a sign that I've been doing better... I give HRT a lot of credit for that)
GEORGE: I got my blood test results back today.
JERRY: Oh?
GEORGE: Well first of all they got my name wrong. Again.
[JERRY makes a disappointed noise]
GEORGE: Anyway, the results said my E was very low and my T was off the charts.
GEORGE (deadpan): 10x the T levels of the average woman.
JERRY (confused): I thought that was the-
GEORGE (shouting): YES, JERRY, THAT'S THE POINT!
Post by: Magmacube_tr on November 20, 2022, 12:52:16 pm
Post by: Vector on November 20, 2022, 01:15:20 pm
Post by: Egan_BW on November 20, 2022, 07:39:23 pm
So, any of you saw cute boys passing by?sadly not
Post by: Magmacube_tr on November 20, 2022, 08:11:59 pm
Honestly, our country just had another mass shooting at an LGBTQ night club last night.
Murica?
sadly not
Awwww myaaaaan...
Post by: SOLDIER First on November 20, 2022, 08:45:42 pm
Post by: Rolan7 on November 20, 2022, 10:10:47 pm
*sorta
Spoiler: Colorado (click to show/hide)
Post by: Egan_BW on November 20, 2022, 10:33:32 pm
im gaywould you describe yourself as cute boy y/n
Post by: SOLDIER First on November 20, 2022, 10:39:32 pm
Post by: Vector on November 21, 2022, 12:47:43 am
bitch, i'm adorable
LOL. Me too.
Dunno if others have seen this and I haven't read it, but this (https://genderdysphoria.fyi/) seems like a helpful resource for trans ppl.
Post by: martinuzz on November 21, 2022, 05:33:09 am
They say LGBTI rights activism is a political thing that has no place in sports.
Lick Qatar anus much, that FIFA
Post by: Loud Whispers on November 21, 2022, 06:54:18 am
hi feral im uwudr uwu I'm CIA
FIFA announced that any players wearing a 'one love' wristband at the World Cup will get a yellow card.Slave labour
They say LGBTI rights activism is a political thing that has no place in sports.
Lick Qatar anus much, that FIFA
I sleep
LGBT
I coma
Ban booze
I fifa
Post by: Starver on November 21, 2022, 11:20:57 am
FIFA announced that any players wearing a 'one love' wristband at the World Cup will get a yellow card....thus making the wristbands more political.
They say LGBTI rights activism is a political thing that has no place in sports.
(I wonder how tempting it would be for an entire team toaim to get yellow cards... I've no idea if that'd be game-ending. I mean, if it's just the one incident can you be re-yellowed for not then taking it off, or does it just mean that you're more vulnerable to being upgraded to accumulating a red-worthy amount of yellows (two, three? - I really don't know, it's not my sport and I'm not up-to-date) so you've got to be a bit more careful with the sliding tackle[1]...)
I'm not watching Qatar, but then I wasn't going to watch it anyway. Maybe I'll not bother even making a spreadsheet, just for the sake of the spreadsheet... In the interests of ny support for LGBTQI++ I'm going to not use OpenOffice, slightly. i.e. ever so slightly less than I would have normally (I've got it open on the other screen in front of me, but that's tracking my progress in some online game with no obvious[2] prejudice to the community...). Not even to work out who the next team might be that sends England out of the contest.
[1] Always a problem if also going commando!
[2] It has no female/etc characters, but it isn't explicitly anti non-binary, so it's better than other games and it can't even be misogynist if none of the violence is against females, right? ;)
Post by: EuchreJack on November 21, 2022, 11:37:39 am
hi gay I'm straight*
*sortaSpoiler: Colorado (click to show/hide)
Sounds like the LGBTQ+ community is essentially going through a similar experience to People of Color, only People of Color are arguably further along.
I see a lot of parallels between Malcolm X's statements about the political parties and People of Color, and how the political parties of today treat LGBTQ+.
...But, the Political System did put a black man in the Presidency, and a black man is now arguably the most feared Supreme Court Justice. So progress is possible.
Post by: Imic on November 24, 2022, 05:01:17 am
Post by: Rolan7 on November 24, 2022, 11:44:12 am
I've been wishing people a happy TG last night and today, and was recently informed that people may have thought I was punning >\\<
I mean I do wish a happy gender for all, I just meant ThanksGiving, I hate mobile typing!!
Post by: Egan_BW on November 24, 2022, 11:52:33 am
Post by: Magmacube_tr on November 25, 2022, 10:25:30 am
Little did they knew...
Post by: Egan_BW on November 25, 2022, 03:23:29 pm
Post by: Great Order on November 25, 2022, 06:07:14 pm
Post by: Great Order on December 02, 2022, 10:11:25 am
Now I just need to wait... a decade. For my first appointment.
Yaaaaaaaaaaaaaaaaaaaaay...
Post by: Loud Whispers on December 03, 2022, 06:10:48 am
No really, please God, save our NHS
Post by: Rockeater on December 03, 2022, 10:10:13 am
Post by: Rolan7 on December 04, 2022, 01:17:35 am
What gender do schemes have?? "It depends"
And as the dunmer often worship the ambiguous Boetheia, it's appropriate they also worship Vivec who is also unbound by gender.
I might think that Boethiah is agender while Vivec is genderfluid, but that seems counterfactual since Boethiah tends to have clear but different gender in their appearances. And Vivec embodies simultaneous duality- bigender if not pangender.
Edit: Oh oh! And the
Emulating their people in all ways, including gender. eeeeeee!
A Dance In Fire V6 (https://en.uesp.net/wiki/Skyrim:A_Dance_in_Fire,_v6)
Quote
"That sounds," said Scotti, searching for the appropriate word. "Like ... bunk."
"Perhaps it is," shrugged Basth. "But [they have] many rights as the Voice of the People, including the granting of foreign building and trade contracts. It's not important whether you believe us."
Post by: Mech#4 on December 04, 2022, 06:21:15 am
I do like how the Daedra Princes are described as not really having genders and being whatever they wish to appear as. That they're some kind of force that just happens to appear as something they like to. Like how Hermaeus Mora doesn't appear as a humanoid but instead a blob or void. Though, most of the daedric princes clearly have preferred forms and gender appearances they use.
Post by: Great Order on December 04, 2022, 09:46:45 am
Post by: Egan_BW on December 04, 2022, 09:54:22 am
Post by: MrRoboto75 on December 04, 2022, 12:05:24 pm
Post by: Magmacube_tr on December 04, 2022, 01:00:23 pm
Reject binary gender, become tentacle-void.
Now this is something I can get behind!
Post by: voliol on December 04, 2022, 03:55:58 pm
Reject binary gender, become tentacle-void.
Now this is something I can get behind!
I swear I saw a subreddit like this. Though I believe there was some asexuality thrown into the mix as well, for good measure?
Post by: MrRoboto75 on December 04, 2022, 04:17:48 pm
Post by: Grim Portent on December 04, 2022, 06:12:24 pm
Sort of like the Chaos gods of Warhammer. Daemons have no sex, most just default to identifying as masculine because it's how humans think of them and that's literally what gives them form. In a world where women made up the bulk of violent actors Khorne could be a woman with a dog's head, like a vaguely Norse Sekhmet.
Post by: Great Order on December 09, 2022, 09:29:34 am
Given this, I'm pretty sure I've got a solid idea on what to expect from anti-androgens and hormones, but does anyone have any advice or anything that they think I might have missed? Just want to be prepared for it.
Post by: Sarai on December 09, 2022, 11:33:44 pm
Less than a week until my endo appointment.
Given this, I'm pretty sure I've got a solid idea on what to expect from anti-androgens and hormones, but does anyone have any advice or anything that they think I might have missed? Just want to be prepared for it.
Depending on your location expect either great or terrible experiences going forward with healthcare. Probably already expected. Have you ever heard of trans broken arm syndrome (https://www.usatoday.com/story/life/health-wellness/2021/07/27/trans-broken-arm-syndrome-what-it-how-combat-discrimination-health-care/8042475002/)?
Depending on the anti-androgen you take (I'm thinking of spironolactone), you will begin to pee all the goddam time and it's so freaking annoying, especially when combined with general public restroom anxiety.
You will begin to study the mirror religiously while you await physical changes, and grow impatient while it appears that nothing is happening. Then suddenly it will feel like everything is changing all at once and it gets very exciting! And then years down the line you'll look at yourself now and at yourself when you thought you were experiencing a bunch of good changes and think "holy crap I thought that was great but I look so different now!"
Basically, what I'm saying is you will be impatient and it sucks, but it takes a lot of time for hormones to really kick in.
And unrelated, it was my birthday today and my wife took me to get some banana pudding 'cause it's my favorite even tho she hates bananas and I just 🥰🥰🥰 I am so gay for this woman.
Post by: LadyBrassroast on December 09, 2022, 11:42:06 pm
Post by: Sarai on December 09, 2022, 11:46:54 pm
your chest area is gonna hurt like a son of a bitch. like an itchy kind of hurt. that's normal, it's growing pains.
And you're going to hit your new goodies on all the door frames T_T
Post by: LadyBrassroast on December 10, 2022, 12:03:47 am
Post by: Great Order on December 10, 2022, 11:26:10 am
Know of TBAS, my intent is to be a pain in the arse if it afflicts me.Less than a week until my endo appointment.
Given this, I'm pretty sure I've got a solid idea on what to expect from anti-androgens and hormones, but does anyone have any advice or anything that they think I might have missed? Just want to be prepared for it.
Depending on your location expect either great or terrible experiences going forward with healthcare. Probably already expected. Have you ever heard of trans broken arm syndrome (https://www.usatoday.com/story/life/health-wellness/2021/07/27/trans-broken-arm-syndrome-what-it-how-combat-discrimination-health-care/8042475002/)?
Depending on the anti-androgen you take (I'm thinking of spironolactone), you will begin to pee all the goddam time and it's so freaking annoying, especially when combined with general public restroom anxiety.
You will begin to study the mirror religiously while you await physical changes, and grow impatient while it appears that nothing is happening. Then suddenly it will feel like everything is changing all at once and it gets very exciting! And then years down the line you'll look at yourself now and at yourself when you thought you were experiencing a bunch of good changes and think "holy crap I thought that was great but I look so different now!"
Basically, what I'm saying is you will be impatient and it sucks, but it takes a lot of time for hormones to really kick in.
I'm wanting to see if I can get a GnRH inhibitor instead, apparently they're generally better tolerated but more expensive, however I'm going to be on shared care so I'll be paying the normal UK prescription cost.
I've already got a couple of pictures on my phone for comparisons, because I know I'm gonna struggle to notice them until they're shoved in my face because that's just how my brain works.
your chest area is gonna hurt like a son of a bitch. like an itchy kind of hurt. that's normal, it's growing pains.Yeah, I gathered that's one of the more sucky bits. And pets somehow always manage to do stuff like jump on your chest when you're lying down.
It's also how I found out about the advice for when you're medically transitioning to always google "[symptom] in teenagers", because breasts hurting for no reason is a bad sign if you're an adult, but if you're a teenager or MtF it's normal.
Post by: alway on December 10, 2022, 12:43:12 pm
Likewise, if you do end up on Spironolactone (and to anyone else on it): you'll want to increase salt intake. It flushes a lot of salt out of your body, which has a feedback loop where your body becomes less able to maintain hydration, you drink more water, you pee more which flushes out more salt, etc. A lot of folks I know get into this feedback loop and end up in what is probably a mild hyponatremia state, where they have an unquenchable thirst bc they don't have enough salt. Your body is very good at maintaining sodium levels (because otherwise you die) so some advice for anyone on Spironolactone: your body makes salt taste better when you need more of it. If instead of merely salty, salt tastes like a gift from the gods descended from the heavens as a reward to you personally, you probably need more salt! Having enough salt allows your body to retain water better, decreasing the frequency of using the restroom and resolving that unquenchable thirst you're feeling (lack of salt also can lead to headaches, which salt resolves). So if you find yourself in that state, a pinch of salt (or very salty snacks) can resolve the issue.
Overall, expect a bunch of body weirdness. Hips move around a bit, so you may find you have bad hip pain for a few weeks at some point, along with how you hold yourself and walk shifting a bit. If you bite your nails, get out of the habit of that, as they grow faster but thinner. Your body's smell will change, which is often one of the first changes (usually within the first week or two). Down below, things will be weird for a while; libido often changes at least once, as does the stimuli it responds well to; and the feeling of it will at some point likely change to more of a full-body experience than the more localized one you're used to. Basically, welcome to Puberty 2: Exploring Your Sexuality (Again).
For tracking progress, I recommend keeping a little medical diary: note down relevant info like blood test results, any changes you experience w/ the dates they happened, and so on. As well as selfies at least every 3ish months. Changes tend to be fairly ambiguous for selfies within 6 months of each other, but cumulatively, you'll start seeing undeniable changes within 6-12 months which is quite nice to have visually in front of you when it feels like things are taking forever to change.
Also, it may take a while for levels to get where you want them. Took mine nearly a year before they got into the target ranges where T production was being properly suppressed. But it may also be quick: I know a lot of trans folks end up finding they're some degree of intersex, and have levels halfway to the targets before even taking any meds; and some who just get to target levels nearly immediately after the dose is ramped up to the usual amount. So far as I'm aware, there isn't evidence either way on whether it even matters in the long term, so don't stress out about that.
Another very important thing: This is puberty! Your body is growing and changing and adding entire cubic inches of tissue and such to different areas! Eat! A loooot of trans folks unfortunately have eating disorders. In addition to all the other harms of those, the visual changes from hormones come in large part from changes to fat and muscle distribution. Make sure you get enough to eat or your body won't have the fuel it needs for the changes you desire.
Post by: Rolan7 on December 10, 2022, 06:07:52 pm
In a matter of 1-3 days I felt fantastically less depressed
My 3-month T was already down at 13 on monotherapy, with a good 200-something E level (300 sounds ideal)
My 6-month T was STILL at 13, despite disruptions to my E intake reducing my E level to 90 (and yeah I was mildly depressed again, though less so)
This is increasingly convincing me that my initial T was already very low, along with E. Would explain some things.
It doesn't really change anything - given the choice between "man" or "woman" I still prefer "neither but I like the E". Maybe I'd like T instead, but I don't care to find out. (Though I have always greatly admired trans men, total kings)
Orchiectomy also seems less... useful to me, which is convenient since I was apathetic about it. Sounds like I'm saving a lot of cash there, being uninsured.
Which leads to something I'd kind of buried... My parents, naturally I guess, really want grandchildren. There are a lot of reasons I'd rather adopt but it still kinda stings to disappoint them I guess. Particularly my mom since she's been so supportive of all this, but my dad has feelings too (even when he expresses them with "jokes").
I guess what I'm saying is that it would be nice if I never had a choice. I mean I *don't*, it's not something I could or should force, but like... what if I never even had the opportunity at all? Physically?
I'm surprised at how relieving that possibility feels.
And while that would be more than enough, I *should* still take solace in two things:
I offered to donate gametes and adopt, which I still think was a perfect solution but emotionally it doesn't work for them somehow
My brother isn't infertile. He's less agreeable than me but that's not my problem, he could use their help!
This is all stuff I already mostly-handled with when I thought I was gay, but the idea that I never had a choice is... annoyingly appealing. The takeaway is that I don't want to. I'd get "my tubes tied" right now if I had coverage.
Post by: Imic on December 10, 2022, 06:36:05 pm
...
I'm AMAB.
...
Dunno if I've mentioned this on this thread before or not, but, uhm. Yeah. As an AMAB individual, Transmasc people give me gender envy. Not sure what to do with this information.
Post by: Great Order on December 10, 2022, 06:43:35 pm
EDIT: Good news is that I've let my current Jitsu senseis know about me being trans since it's going to become relevant very soon, and they've been supportive.
Post by: Sarai on December 10, 2022, 09:06:39 pm
As an AMAB individual, Transmasc people give me gender envy. Not sure what to do with this information.
Gender is fuckin' weird and complicated. Experimenting with it is usually pretty fun tho
Post by: Rolan7 on December 10, 2022, 09:46:04 pm
In other words I'm glad I ate more because I definitely redistributed some fat, while losing some net! (I think a lot of it went to my butt, which I STILL don't get the appeal of...) Also I suddenly found loads more willpower for taking care of my body and largely maintaining my modest strength. I... hm. I always looked up to and wanted to be a *strong* woman, and I think I remain slightly above the average for men.
There's this streamer on Twitch, Willow, who gained 20 pounds of muscle on a lean frame (and it looks fantastic). Literally, goals. She's a pretty lesbian though and I'm only gay for exceptional women at this point. I still like men.
Trans-men very included <3
Maybe if I ever meet a toxic trans-man I'll change my tune, but all the ones I've encountered are so dang badass and nice. There's this one, a moderator and former sexworker, who's going off his hormones to have a child soon! That's like, Borderlands Torgue levels of badass right there. Ultimate manhood. Gosh >///<
Post by: alway on December 11, 2022, 02:36:15 am
I'm not gonna lie. I... keep low-key wishing I was Transmasc.My recommendation: explore those feelings and the specific parts of them. Ask yourself why you feel gender envy, and what specific parts of it you find desirable for yourself. Is it having masculinity that was personally crafted, rather than enforced upon them? Because that's something you can explore and redefine for yourself. Is it the feeling of freedom to explore variations on gender expression/presentation? Here's someone coming to an answer that takes that to heart, basically "cis people dont need to pass": https://mobile.twitter.com/JoCat105/status/1551414701384507394
...
I'm AMAB.
...
Dunno if I've mentioned this on this thread before or not, but, uhm. Yeah. As an AMAB individual, Transmasc people give me gender envy. Not sure what to do with this information.
If it's wanting to be visibly friendly to or involved with queer folks, we want co-conspirators rather than allies. The social circles I'm in practically have memes about The Cis Giy Who Hangs Out With the Trans Women. Frequently they turn out to be just another trans person later, but often, they're just a really good guy who is well liked for not being too insecure around gender feelings and showing up to help folks as much or more than anybody else in the space.
In general, the things you get envy over are in fact probably achieveable; they just take deliberate effort to reconstruct the person you present to the world in the image of the person you wish to be, and see yourself as. This process is a big part of what transition often includes, as it provides more of a blank slate than most folks get to work through these things. But it's also just something everyone can, and frankly should, do.
Post by: MrRoboto75 on December 11, 2022, 09:09:25 am
Post by: Great Order on December 14, 2022, 09:07:53 am
Post by: chaoticag on December 14, 2022, 12:59:51 pm
I'm cleared to start HRT, hopefully I'll be getting on with it by next week.Grats!
Also I haven't been here in a while, hi. I'm a trans lesbian.
Post by: Great Order on December 14, 2022, 01:58:51 pm
If that'll last remains to be seen, I've heard about some people changing sexuality as a result of HRT.
Post by: Rolan7 on December 14, 2022, 02:16:41 pm
It might be true I guess, I haven't checked studies, but I don't feel like sexuality works that way. I figure it's probably just bi people exploring their sexuality with more confidence.
Oh and congratulations!! Good luck getting through the longest week ever, but you're almost there :D
Post by: Great Order on December 14, 2022, 05:48:01 pm
Honestly, I'm doubting I'll change much. I've always felt waaaaay more envious of lesbian couples than hetero. Not in a "Oh that's hot" way like you'd expect from... some individuals, but in a far more "I really wish I had that relationship and was one of them" way.
Post by: None on December 14, 2022, 10:27:19 pm
Sorry, I guess I don't really need an answer to say I'm happy for you!
Post by: Vector on December 14, 2022, 10:53:21 pm
I've heard about it from other trans people. It's up in the air if that's actual changes, or a result of people being more comfortable in their bodies/overcoming internalised homophobia because you're no longer your AGAB.
I've had small changes and my only transition was social. I'm actually somewhat interested in men now that I have made it clear to them that heterosexual-formatted relationships are entirely off the table. A little less interested in women but that's mostly because there's a lot of transphobic Harry Potter fan lesbians.
Post by: Great Order on December 15, 2022, 10:08:31 am
I'm excited for the journey ahead of you! I'm not sure which is correct to say I'm happy you're on your way towards the best, truest, or actual form of yourself, but it makes me warm to know the barriers towards, well, you, are parting. I see it was an exciting and enabling time for Rolan, how are you feeling about it? Anxious, eager, affirming?Excited and anxious, I guess. For me those two are the same emotion, but with a positive or negative slant respectively, so it's hardly surprising that it's happening.
Sorry, I guess I don't really need an answer to say I'm happy for you!
I'll be calling the doctor either tomorrow or the beginning of next week and printing off the letter to bring in. It's being sent by snail mail too, but I'd like to get started soon as.
EDIT: Talked to the doctor, been prescribed, gonna be picking it up Monday or Tuesday!
Post by: Great Order on December 19, 2022, 07:04:06 pm
Mission failed, it was weirdly validating and I'm now feeling really happy that my existence upsets bigots.
Post by: EuchreJack on December 20, 2022, 01:16:02 am
Landed me my first bigot. Someone on Reddit DMed me saying that I'm mentally ill and no matter what I'll be a man and etc. etc.I find this inappropriately hilarious.
Mission failed, it was weirdly validating and I'm now feeling really happy that my existence upsets bigots.
Post by: Magmacube_tr on December 20, 2022, 02:10:17 am
Landed me my first bigot. Someone on Reddit DMed me saying that I'm mentally ill and no matter what I'll be a man and etc. etc.I find this inappropriately hilarious.
Mission failed, it was weirdly validating and I'm now feeling really happy that my existence upsets bigots.
As you should.
It turns out, when they decide to message people to insult them, transphobes either have no idea about how trans people work, or automatically assume that their target is a trans woman for reasons that is a whole another can of worms. They essentially roll a coin to bigot or begot.
Which leads to them telling a trans man how they'll never be a woman and vice versa.
Post by: Great Order on December 20, 2022, 06:57:25 am
Post by: Magmacube_tr on December 20, 2022, 06:58:51 am
Oh no, I'm a trans woman. The weirdly validating bit was that it feels like I've "made it" as a trans individual.
Ooooooh... I get it now.
Post by: Tiruin on December 20, 2022, 09:10:54 pm
Because wow there's some bits of that culture that make things so harsh that assimilation and its own culture is pretty much unseen in it. GLAD THAT GOT PARTIALLY RECOGNIZED in the WPATH Standards of Care 8 (which FINALLY has people's voices from the community compared to the rubbish 2012 version), and it's still lacking to put it lightly, but obviously very much improved.
Post by: chaoticag on December 21, 2022, 05:25:54 am
Landed me my first bigot. Someone on Reddit DMed me saying that I'm mentally ill and no matter what I'll be a man and etc. etc.You managed to upset an asshole by just existing congrats.
Mission failed, it was weirdly validating and I'm now feeling really happy that my existence upsets bigots.
It's been green generally a great way for me to filter out folks not worth taking to for me. And I think it's a good sign that anti trans rhetoric seems to not be gaining as much traction as you'd expect as prominent transphobes have been showing their whole ass lately
Post by: voliol on December 21, 2022, 09:07:23 am
Because wow there's some bits of that culture that make things so harsh that assimilation and its own culture is pretty much unseen in it. GLAD THAT GOT PARTIALLY RECOGNIZED in the WPATH Standards of Care 8 (which FINALLY has people's voices from the community compared to the rubbish 2012 version), and it's still lacking to put it lightly, but obviously very much improved.
Had not heard of WPATH before this, and have just looked it up. Chances are I'm taking this out of context due to not being a health care professional familiar with the lingo, but the following sentence found on their history and purpose page (https://www.wpath.org/soc8/history) is something.
Quote
This version of the Standards of Care is the first to be developed using an evidence-based approach.
Post by: Rolan7 on December 21, 2022, 08:42:45 pm
Notably:
They were impressed at how much it *wasn't* a disaster. I truly am doing better nowadays.
Towards the end I was on my side cleaning under a chair and I just sorta... relaxed for a few seconds. Went limp, closed my eyes and took a sip of subspace. It was lovely and rejuvenating, and my dad commented on it as what it was: Me being socially tired. They'd both signaled they were also nearly done, but via more complex vocabulary cues.
Dad's wife poked me in the boob while complimenting my shirt. I didn't visibly react, processed it later. It's fine, it's fine. It was just unexpected. She's known me for a long time and that I don't like being touched. But I think it's probably that thing where women are more touchy with each other. That's probably it! A friend agrees, that was probably it.
Or she was wondering where my (modest) chest went because I went braless to Thanksgiving, and was wearing one of my lovely amazing sports bras.
Did she feel the bra? I don't think she did. Why do I care, I'm out to her. Well if I'm out to her, why doesn't she use my pronouns?? Because my dad doesn't. this is stupid.
Bizarrely that... neurodivergence... is largely a distraction from a much more important idea I've been CAREFULLY mulling over for a couple weeks: whether I'm really NB. I think I am, but I really really REALLY like my HRT (particularly at this effective level) and all the "unwomanly" traits I love about myself are traits I've also loved in women. Women who I am not, generally, attracted to. I might be straight-
I refuse to "become" a woman via HRT, that's stupid anime BS. The true me is something I found through intense meditation and, primarily, dreams. I may be genderfluid, but I don't think I'm binary. I refuse to let hormones change me. They only let me unlock my true potential. I love my body, and I guide my body. It mustn't guide me.
Post by: Vector on December 21, 2022, 10:38:06 pm
Dad's wife poked me in the boob while complimenting my shirt. I didn't visibly react, processed it later. It's fine, it's fine. It was just unexpected. She's known me for a long time and that I don't like being touched. But I think it's probably that thing where women are more touchy with each other. That's probably it! A friend agrees, that was probably it.
Resident AFAB would like you to know that that's not "normal" female touchy-feeliness :I If you do that as a woman to another woman, either it's deliberate aggression, the equivalent to shoving a dude in the chest, or you apologize immediately. There's a lot of maneuvering done to make sure that tiddy awkwardness doesn't happen. The point is that I don't think it was a thoughtless accident.
I refuse to "become" a woman via HRT, that's stupid anime BS. The true me is something I found through intense meditation and, primarily, dreams. I may be genderfluid, but I don't think I'm binary. I refuse to let hormones change me. They only let me unlock my true potential. I love my body, and I guide my body. It mustn't guide me.
If it turns out that you're a trans woman who prefers men, it won't make you any less queer. Many people have taken this journey with highly variable results. The outcome can't really be predicted in its concrete details, nor controlled.
Post by: Great Order on December 22, 2022, 09:30:19 pm
I've been on HRT, and a low dose at that, for less than a week. Obviously, I'm not seeing any results yet, but my brain is telling me that means I won't see any. I really fucking wish it wouldn't.
Post by: Vector on December 22, 2022, 11:52:53 pm
It's like being pregnant, there's not exactly immediate effects.
Post by: Great Order on December 22, 2022, 11:57:56 pm
Post by: methylatedspirit on December 23, 2022, 10:13:21 am
I'm gonna soapbox for this. It's easier to ask for forgiveness than it is to get permission, after all.
I feel that the thing that underpins a lot of shittiness w.r.t. people vs. LGBTQ+ subjects is the idea of mediation. The social constructs around us that say that it is not only possible, but that it's good to stuff the 'entropy of being' into neat little boxes. I believe it terrifies mediocre people when you show them trans people, Queerness, things 'acting weird', because it forces them to grapple with "error" states.
After all, glitch art is an inexorably transgender expression (https://www.whitneypow.com/blog/trans-historiography-of-glitches-and-errors) because it is that idea of deriving beauty from "error" states of (computational) systems, a reflection of how being trans is an evident "unaddressed" state of the systems of, and around gender. If you're in the business of packing chaos into semantic boxes, then we were not "meant" to happen, as much as glitches are not "meant" to happen.
I'm gonna say that the bullshit around gender is a situation vaguely similar what the recent Folding Ideas vid on Warcraft (https://youtu.be/BKP1I7IocYU) described. Bullshit around nonconformity is similar to how a player was shamed and bullied for doing something that a) is statistically insignificant, and b) literally meant nothing, because they're playing the wrong class for the stats to matter.
The actual things that do biologically matter if you are trans, nonbinary or just "different" are weaponized against you to enforce indefensible premises, because we're all stuck in the collective illusion.
Hell, it's not like mediation is necessarily a cishet-exclusive thing. I have fallen victim to this, as a trans entity myself. The urge to put things into boxes runs deep. Labels, for instance, can be oppressive when you say that certain features are label X, because it is that implicit usage of force to put people into boxes that only they should have the right to check in and out of. It's a consent failure.
People are way more entropic than the labels we can assign to them. People are not the boxes we airdrop on them. Everyone is the illusion of order constructed, brick by brick, out of chaos. (https://youtu.be/rokAtlFGa7Y?t=385)
Post by: alway on December 23, 2022, 11:45:09 am
My two favorites were in Doom (2016) and Warframe, back when I was working on the Switch ports for those. The first was a really pretty bug with the virtual material system driving the texture streaming, which left everything textured in ultra-bright digital patterns, especially featuring the brilliant cyan of 0x5a5a5a5a interpreted as an R11G11B10. Not entirely dissimilar from my favorite jacket, which I bought afterwards, but if it were bright enough to oversaturate bloom https://liveheroes.com/en/product/show/199045
Or in Warframe, when I was attempting to cache out gpu state, but missed a bit of code, and so it took all the shaders and inputs in the scene and mixed them around in a way that was stable in a stable scene, but reshuffled how each object was drawn if any objects entered or left the scene. It was really pretty!
Glitches as gender thing or metaphor is quite good, and I do incorporate that into my personal aesthetic and presentation with the help of dataerase stuff (like that linked above) and my favorite purse, which is a lovely iridescent retroreflective material (which also acts in the infrared spectrum bathroom sink hand sensors operate in, causing them to sometimes go off one after the other if I walk past a line of them in a public restroom; love that).
Post by: MrRoboto75 on December 23, 2022, 02:11:30 pm
Post by: EuchreJack on December 23, 2022, 03:12:22 pm
Post by: MrRoboto75 on December 23, 2022, 03:48:30 pm
It's been my observation we're all broken people just trying to function as best as we're able.
Guess everyone slightly needs a wheelchair as well?
Post by: EuchreJack on December 23, 2022, 03:50:22 pm
"Need" is a strong word. But who doesn't enjoy a chair with wheels?It's been my observation we're all broken people just trying to function as best as we're able.
Guess everyone slightly needs a wheelchair as well?
Post by: Great Order on December 25, 2022, 10:57:23 pm
Spoiler: A bit NSFW (click to show/hide)
Post by: alway on December 26, 2022, 12:45:47 am
Question for people:Oh, yeah, that can be pretty common. Everything that bothers you which your brain previously was suppressing as something impossible which couldn't be dealt with is now back to the realm of things you can do something about and thus much more at the forefront.Spoiler: A bit NSFW (click to show/hide)
Spoiler: NSFW, a bit of sex ed (click to show/hide)
Post by: Tiruin on December 26, 2022, 02:16:21 am
First off: this thread has excellent gender, this'll go nicely in my entropy pool. Gendernoise here.Power to all those who use it/its and more c:
but also the art people linked is such Good(TM)
alway always has great points on that note.
Post by: Imic on December 26, 2022, 02:08:18 pm
Post by: Great Order on December 26, 2022, 02:24:34 pm
EDIT: I think the hormones are having a minor emotional effect. I'm feeling things a little bit more. When I'm thankful it feels more genuine. Not that it wasn't before, but it feels even moreso now. Some things make me feel a little sad that didn't make me feel anything before. Little bits like that.
Post by: Tiruin on December 27, 2022, 08:15:33 am
Meant to ask this ages and ages ago, but Tiruin, has your avatar always had the trans pride flag in it, or did I just fail to notice it until after I found out what the trans pride flag looked like?I love you noticing this, and no! I edited it in subtly just this year (or was it last year?)
It was originally some light tan color until I realized (given being friends with the artist who spliced it waaaaaaaaaaaaaaaaaaay before the program that made splicing accessible was made) that I can edit it myself.
Post by: Strongpoint on December 27, 2022, 02:18:19 pm
Being into fitness, I can't overlook the biological differences in muscle mass and bone density living as a man for your entire teenage and most of your adult life has versus someone who was born biologically female. That muscle doesn't simple disappear overnight, the bone mass doesn't return to any level because as far as the body is concerned, you developed with male levels of hormones and that's what it should be. If someone has trained their whole life as a man, the differences magnify. If they trained their whole life as a man and used Performance Enhancing Drugs, the advantage magnifies even more.
A life-long male in their early 30s who is untrained will, statistically, be stronger in most metrics that matter to professional sports than an untrained woman of the same age. So if they transition to female with no hormone therapy, then they will by the numbers have strength and performance above the female standard. It's why we even have gender separated sports in the first place.
(slight necromancy but I just like this particular topic )
The bolded part is not entirely correct. The main reason why we have separate male and female leagues\tournaments\chapmpionships is that we want to see meaningful competition. We don't ban people simply because their build gives them advantages.
But we do separate athletes when there is simply no chance to compete. Male\Female division is one of them. Using weight categories in martial arts or weightlifting is another. No 50 kg guy would have a chance to become a boxing champion if weight categories wouldn't exist. He wouldn't even have a slightest chance to become top 50 or top 100 or top 1000... But there are no weight categories in, lets say, basketball even if it is obvious that weight offers an advantage there. It is just not big enough to make it impossible to overcome the gap.
So, if post-hormonal-therapy transwomen still have, on average, a slight advantage that doesn't mean they should be banned because, evidently, that advantage is not nearly enough to make them dominate female leagues.
Post by: EuchreJack on December 27, 2022, 03:57:09 pm
Throughout most of the last Century, the folks that watch, and more importantly, the folks that FUND, Sport have traditionally had ZERO interest in Female Athletes, so they were banned from playing with the Men.
Most of the crap still keeping the genders separate is the junk science that was made up to justify Female Exclusion. And it's now being weaponized against Trans Athletes, explicitly to keep THEM out of Sport.
Post by: Strongpoint on December 27, 2022, 05:37:37 pm
Throughout most of the last Century, the folks that watch, and more importantly, the folks that FUND, Sport have traditionally had ZERO interest in Female Athletes, so they were banned from playing with the Men.
Or... no one wanted to watch no contests and witness gruesome injuries of females in contact sports. Mixed sport doesn't work. In many sports, 16-year-old boys with adequate training will completely destroy female world champions.
Sure, there was serious resistance against female sports. But separation is not the consequence of this resistance. If anything, having no separation would be the easiest way to ensure that there are no women in sports beyond amateurs.
Post by: Great Order on December 27, 2022, 06:46:26 pm
Interestingly, one of the sports that also shows no difference is extreme long distance running, which is probably because after a certain point being stronger or fitter doesn't really mean much because any advantages they give you collapse in the face of 1000 miles of running. Instead, it's all about psychological resilience.
Post by: Starver on December 27, 2022, 07:03:29 pm
Recently it's been posited that women's and men's results in events that they have for decades been co-mingled (performances excepting) should be separated again!
That there have been women who have outperformed the men, rarely but notably, and that the prizes have been equalised (by value and extent) with the prize-listings often side-by side-by-side, doesn't seem to matter. The stated aim is that the first women, overall, might be dispirited to be found down beyond the first dozen or so men in the combined result-order list. But then there are age-classes in which the young and old categories only win out against those in more traditionally prime age-ranges in a very few exceptional circumstances. All I can see is an attempt to resegregate everyone again. (Perhaps even with a crafty eye over seperately listing trans competitors... it has that kind of smell to it. And, given that this bit is at least relevent to the thread subject, I might as well mention that.)
Of course, there are many subtle complications to all these issues. And historical inertia combines with any reactionary counterpush, either for or against what any given somebody might think is the proper natural situation....
[1] Related: Reading about the history of bowling the other day, apropos of nothing much else to do with this subject, it seems the Professional Women's Bowling Association only merged with/filtered into the PBA in 2003, but has re-established itself as a separate body in again in 2015 (IIRC). Though this seemed to be more for financial/sponsorship reasons.
Post by: EuchreJack on December 27, 2022, 08:05:43 pm
This is relevant to Trans Athletes, since it means there are twice as many people vested in clearly dividing Sport by Gender.
Post by: Strongpoint on December 28, 2022, 12:14:55 am
Interestingly, one of the sports that also shows no difference is extreme long distance running, which is probably because after a certain point being stronger or fitter doesn't really mean much because any advantages they give you collapse in the face of 1000 miles of running. Instead, it's all about psychological resilience.
You shouldn't present one of several competing hypotheses as a fact. It may be that females have better fat-to-energy conversion, better muscle protection from damage, etc. And those advantages outweigh male advantages.
But why is not really important. If the results are close enough, separating sexes is not really necessary but...
What we should have is open competitions and then separate competitions for whatever groups of people may find it necessary to have their own competitions. For whatever reasons they may want: to have a chance to actually win, cultural reasons, or simply desire to have a shared activity with other members of the group.
Post by: Vector on December 29, 2022, 06:39:18 pm
What the hell am I doing? I'm about to turn 33 in a country that hates me and it feels like I have nothing for myself. I've fucked this up.
I gotta believe in myself, remember that I'm being treated for anemia, and also that the past three years have been nonstop gutpunches, this past year especially. And that I haven't been to therapy for three weeks because of the "holiday" season. Maybe it's OK to cry.
Post by: Tiruin on December 29, 2022, 10:31:22 pm
It's fully okay to cry ESPECIALLY especially especially just because. That one is in a country where a ton of (recycled, hateful) rhetoric is repeated by supported platforms that push complete fabrication is also a thing independent of that. x~x You can feel!
Also I don't see anything wrong in realizing stuff with media at any age? A good adage that struck me from found family was the note of "We age non-linearly" especially given how trauma or other factors (even developmental) don't necessarily readily apply in how many contexts, especially in neurodivergence/neurodiversity, and furthermore especially when it comes to whatever standards of age-related success there is.
It's going to be a process. Connection/Organization has helped tons, because wow individual power will be strained if not within collective care. :(
Post by: Great Order on December 31, 2022, 08:34:09 pm
Post by: ixn on January 02, 2023, 09:01:26 am
i haven't already celebrated that with enough people so i'm posting here!
i've almost finalized all the moving related junk you run into in the US, including getting on the state's medicaid (and then i'll be setting up with an LGBTQ-positive nonprofit clinic)
transitioning even "just" socially has felt pretty rewarding on its own, i think i'm ok seeing myself as kinda butch? but i feel much freer to experiment and find what i'm comfortable with now that i'm in a safer and more left-leaning area of the country.
Post by: voliol on January 02, 2023, 11:46:04 am
hello thread! i'm a transfem who just barely made it out of the Deep South thanks to some pals across the country. :')
i haven't already celebrated that with enough people so i'm posting here!
i've almost finalized all the moving related junk you run into in the US, including getting on the state's medicaid (and then i'll be setting up with an LGBTQ-positive nonprofit clinic)
transitioning even "just" socially has felt pretty rewarding on its own, i think i'm ok seeing myself as kinda butch? but i feel much freer to experiment and find what i'm comfortable with now that i'm in a safer and more left-leaning area of the country.
Congratulations on making it out, in both the moving sense and the social transition sense! And welcome to this part of the forum :)
Post by: Vector on January 02, 2023, 01:36:14 pm
CONGRATULATIONS!! And welcome :)
Post by: Great Order on January 04, 2023, 12:12:27 am
I don't know if this is my body reacting to it in some odd way or if it's that the skin in the area's getting a super dose and softening up way faster than the rest of my skin.
Post by: Rose on January 04, 2023, 02:35:58 am
Post by: Rolan7 on January 04, 2023, 09:15:40 am
I don't know much about patches/gels but I'm sure you're getting a general dose as well. I feel like my skin got a bit softer, but mainly it got less greasy! So that's awesome, you've already got a visible effect :D
Post by: Great Order on January 07, 2023, 12:10:49 am
EDIT: Apparently I shouldn't be seeing that effect yet, actually. Might just be wishful thinking on my part.
Post by: Vector on January 08, 2023, 04:58:09 am
Post by: alway on January 08, 2023, 11:49:46 am
My favorite fic (it is A Lot, mind the tags/CWs inside)
https://archiveofourown.org/works/32378017
https://m.webtoons.com/en/challenge/with-great-abandon/list?title_no=55067&page=1&webtoon-platform-redirect=true
Cute webcomic about some gays
https://archiveofourown.org/works/16358996
Another of my favorites from ao3; sad/ambiguous end
Post by: McTraveller on January 09, 2023, 09:57:13 pm
What's the modern take on use of language like "gender assigned at birth" versus simply "gonads observed at birth." Or more generally - is gender so closely tied with gonads and other presentation?
Or is gender orthogonal to primary and secondary sexual characteristics? Or is it sometimes orthogonal and sometimes linked?
Or the ultimate extreme - does gender matter anyway? If so, why? If not, why do we make such a big deal about it? What does "getting gender wrong" actually mean, aside from side effects like in most cultures a history of oppressing the feminine?
My very naive fundamental question: if being a woman isn't related to bearing children, and being a man isn't related to siring children, just what is gender anyway?
Post by: Rolan7 on January 09, 2023, 10:41:45 pm
It's a lot to get into, but sex isn't a simple binary. You've probably heard of intersex people, but you might not know how common intersex situations are. 1.7% according to Google, which sounds low- but is a lot more likely than sharing a birthday with someone.
Sex is often described as bimodal for that reason, which I understand to mean "There are two sets of of traits, but people have a mix of those traits".
Gender is indeed orthogonal to those traits. I personally take a rather absolute position that there is no inherent link between sex and gender. Gender is ENTIRELY socially constructed. When a culture recognizes two genders, which is common but not universal, those have (AFAIK) always been associated with the two sex-categories. Very roughly, male and female people are labeled men and women.
And that categorization certainly matters! More than I'd personally like, that's for sure, though I've been confusedly agender most of my life. Our cultures put a great deal of importance on gender, perhaps as much as other categories like race and economic class.
A child is taught these social constructs of "man" and "woman" and, for very complicated reasons we don't yet understand, tends towards one (usually) VERY early in development. That is a positive reaction to a cultural category. For example, choosing combat-figures over domestic dolls. Notably this response is limited by the options offered- options which are a result of culture, usually a gender binary.
Of course many people aren't ever offered this choice. They are given toys according to their sex, perhaps scolded for going after the wrong toys. But given enough freedom we see some kids express preferences that go against our expectations. This is consistent with my theory. The gender they're gravitating too is probably not a *perfect* fit, but gender never is - it's a choice between the options offered by culture.
Note that gender options vary EXTREMELY by culture. The meaning of "man" and "woman" vary wildly based on time, location, and economic class. A medieval male serf is more similar to his wife than he is to his feudal lord. There are physical differences - sex is real, if not purely binary- but gender? The roles we play in society? Gender is COMPLICATED.
Okay I've rambled enough, what was your last question... Oh, easy
In all our cultures to my knowledge, women are still women if they're infertile. We can imagine a culture wherein all (adult) men can fertilize, all women can be fertilized, and everyone else is of a third gender. Heck, we've observed that in history - eunuchs are described as distinct from men and women. Holy virgins and unmarried midwives might be similar.
So clearly it isn't really about fertilizing and being fertilized. There's simply more to it than that! It's a very complex and changing social categorization.
Post by: Strongpoint on January 09, 2023, 11:36:32 pm
My very naive fundamental question: if being a woman isn't related to bearing children, and being a man isn't related to siring children, just what is gender anyway?
Below may be a controversial opinion disliked by many on different sides
Take the word "Asian" What does it mean? It looks like a very simple question, but... There are so many ways to define it - being born in Asia, being a citizen of an Asian country, residing in Asia for most of your life, having a specific appearance, following certain culture, etc. And most of these definitions are vague.
It is the same when you go for the words woman or man. Like one religious fascist is asking on youtube "What is a woman?" Woman by sex, by gender, by social role? Answers will differ. I'll be honest, I dislike the mutation of the English word gender because it creates confusion in an already complicated matter, and simply inventing a new word would be better but... this can't be changed and we are stuck with the word people define differently and it causes issues.
Here is my definitions (other people have different ones.)
Sex is a matter of biology. What the body is. Evolved biological differences. Problem is, with evolution being a mess, whatever way you'll define sex (genitals, chromosomes, ability to produce eggs\sperm, whatever) there will be people who can't be clearly defined
Gender is... also a matter of biology and is directly linked to sex. Just like human bodies are sexually dimorphic, our minds are also sexually dimorphic. Women and men have different brains and different hormones, and we have evolved different behavioral patterns. Simple example: aggressive\reckless men procreate more and aggressive\reckless women die before giving birth. Clear evolution pressure
But again, it is a mess... Those parts of our body (or rather entire systems) that determine our behavior may not match "the norm" for the rest of the body. It is also always a spectrum and beyond our ability to measure and quantify.
Then there are also gender roles. Those are determined by culture. They also evolved (but not biologically) with the starting point being biology. It is what society deems appropriate for each gender. Many, many people call this gender, and here comes "gender is a social construct". I think it is a bunch of bullcrap that denies observable biological reality. Also, saying that implies that culture makes someone transgender playing right into the hands of bigots - "if you will raise children a certain way, they'll become socially constructed as transgenders. If children will be exposed to LGBT propaganda they'll also become transgenders"
Post by: Maximum Spin on January 10, 2023, 12:28:09 am
A child is taught these social constructs of "man" and "woman" and, for very complicated reasons we don't yet understand, tends towards one (usually) VERY early in development. That is a positive reaction to a cultural category. For example, choosing combat-figures over domestic dolls. Notably this response is limited by the options offered- options which are a result of culture, usually a gender binary.I'm always curious about statements like these.
Of course many people aren't ever offered this choice. They are given toys according to their sex, perhaps scolded for going after the wrong toys. But given enough freedom we see some kids express preferences that go against our expectations. This is consistent with my theory. The gender they're gravitating too is probably not a *perfect* fit, but gender never is - it's a choice between the options offered by culture.
I wasn't raised this way. I was always allowed to choose my own toys as I wanted, my choices were according to my mood without worrying about gender (even the toys I was given when I was too young to pick them out, which are still boxed up in my childhood home somewhere, follow no particular pattern), and nobody ever told me that some things were for boys and other things were for girls. We didn't have cable when I was young, so I didn't see a lot of advertising, but when I did, I never really thought much about whether things were depicted with boys or girls since I already had the impression that it didn't matter. In my upbringing, it was very firm that being a boy or a girl was a matter of equipment and didn't have any bearing on what you could do, how you could dress, your personality, or... well, anything that wasn't covered by a swimsuit.
The adults around me also clearly modelled this attitude - if anything, I knew more female hunters, sports fans, factory workers, smokers, beer swillers, breadwinners, etc. than male. I don't even think I saw a skirt before kindergarten where some of the female teachers wore them, and by then it was already impossible for me to think about it as a gender thing... it just seemed like they were for silly, impractical people. Needless to say, I had more or less the same numbers of male and female friends and nobody ever objected to this or told me I should think anybody had cooties, including the other kids. (I didn't even hear of that concept at all until I was a teen.) And overall, the idea that liking X or doing Y makes you a boy or girl (or not a boy or girl) isn't something I had heard of until I saw it on the internet as an adult. Honestly, I still don't really understand it and I just think of people as people.
Well, I don't really have any point, but I wanted to share.
Post by: Rolan7 on January 10, 2023, 01:10:43 am
But like, I'd visit my mom's friend's kids. And watch Sesame Street. I had
Hm, there was this one PE teacher in like 2nd grade. I never could figure out their gender. I was already kinda aware that I was... unable to see certain social things other people see, so I never asked. It sorta bugged me but it was just one unimportant thing in a long list of such things.
Me, I was just me. I kinda liked dolls sometimes and maybe I liked the wrong TV shows but that was just me being
Anybody can say "I was just me" but not everybody had to work so hard to figure out what that meant. Some people fit in easier. I don't know where I belonged. I don't think I fit in the "opposite" slot, but that's just a theory.
That PE teacher... and later in 6th grade, a classmate. On the day we'd never see each other again I asked him "You're a guy, right?". I should have been sure from listening in on conversations, but it's so frustrating how rarely people use names and pronouns when you want them to. And some information slips my memory so easily, like faces and names. Anyway, he looked so confused... I assumed he'd be mad. That's what happens when you question a guy's masculinity, right? But it wasn't anger. I don't know what it was- of course I didn't. I don't know if he was trans in 1997 or just knew that I was seriously asking. Either way, he was a boy. That was that.
Post by: Maximum Spin on January 10, 2023, 01:44:17 am
I don't remember my life before school very well, but I think it was similar in some ways? We lived remotely and my parents were pretty egalitarian about stuff. For some of the time my dad was home more than my mom, early computer job, despite us being in the middle of some woods.Yeah, I mean, it sounds like my case was just stronger. I didn't have things like that. Anchors, I mean. I didn't have media like that, and I didn't have people who were clearly classifiable in those terms at all. Not family, friends, or neighbours. I honestly have lots of reasons to think that the environment I grew up in was particularly weird, though, so it's not much of a surprise to me.
But like, I'd visit my mom's friend's kids. And watch Sesame Street. I hadstrongandrogynous women in my life, but I also had my hyper-feminine aunts and rugged farmer men. Gender was everywhere, enough that even I saw it.
Post by: alway on January 10, 2023, 01:58:47 am
What's the modern take on use of language like "gender assigned at birth" versus simply "gonads observed at birth." Or more generally - is gender so closely tied with gonads and other presentation?1. Terminology like AMAB/AFAB are.... kinda cringe? In that way of someone explaining something badly, but not quite badly enough to call them out on it. They're generally used as stand-ins for several peices of information which may not be true, with a veneer of being polite by not talking directly about what is meant. As mentioned, current stats suggest intersex people outnumber trans people, or are at least a comparable quantity (many are both; intersex and transgender have high odds of occurring together). Birth gender assignment is either based on a very small subset of features, or is coercively applied by doctors deciding to 'fix' the ambiguity and force a child down one of two binary paths of the doctor's choosing. So people are assigned one of two labels, but those features implied by those labels may not actually be present. Of the trans folks I know, it's been like 50/50 odds on whether they even need T blockers because their bodies just don't produce it. If you need to know about biology, don't ask about gender, or even assigned gender, as they are largely orthogonal.
Or is gender orthogonal to primary and secondary sexual characteristics? Or is it sometimes orthogonal and sometimes linked?
Or the ultimate extreme - does gender matter anyway? If so, why? If not, why do we make such a big deal about it? What does "getting gender wrong" actually mean, aside from side effects like in most cultures a history of oppressing the feminine?
My very naive fundamental question: if being a woman isn't related to bearing children, and being a man isn't related to siring children, just what is gender anyway?
2. Gender is complicated. Best to think of it as... attempts to label clusters within a high-domensional space consisting of dozens of attributes (most of which are not biological). Most forms of categorization within human language are similar. This is why, even within a society, you won't find widespread agreement on what genders there are or what they consist of.
3. Gender, like society, religion, and philosophy, are fake. And like those, and other fake things, they go on existing nonetheless because they are of utmost importance to people everywhere. :P
4. Relatedly, it matters a lot. It is one of the core concepts of self, and relates to numerous attributes, and exploring that space is a very good way of figuring out the person you are and the person you want to be. Gender is tricky for precisely the above reasons: it is a stand-in for a number of attributes which may or may not even be present in a person with the gender those traits are associates with.
This covers some things to ponder: https://threadreaderapp.com/thread/1342553808178716672.html
Likewise, while some cling to bioessentialist views on gender, it is notably very funny when they encounter the real world and can't make heads or tails of how to correctly categorize me personally. They believe gender and sex are two different things, that gender is made up and sex is concrete and binary; when in reality my biology does not fit a binary, and that is by choice. My hormones say estradiol is the order of the day, and so my body fills it out as requested. Once upon a time, this was not the case; and so I have a delightful mix of features. My biology doesn't fit those silly false dichotomies surrounding the idea of 'sex' as one of a binary set.
Post by: Maximum Spin on January 10, 2023, 02:59:50 am
I'd also like to add that the common figure of 1.7% for "intersex" conditions is widely regarded as invalid by doctors, because 88% of that estimate consists of cases of late-onset adrenal hyperplasia (affecting an estimated 1.5% of the population), which, as the name implies, is not present at birth, does not result in genital ambiguity, and is not considered a DSD or "intersex" condition by doctors. Individuals with this condition (which can coexist with any sex chromosome configuration) have hormonal disorders which are usually mild, but are otherwise physically the same as unaffected individuals with the same sex chromosomes, and generally continue to identify as such. Another condition which is included in that estimate, but which is not regarded as an "intersex" condition, is vaginal agenesis, in which the female reproductive system develops "normally" internally, but fails to breach the skin surface. This is clearly a disorder of genital formation, but does not result in ambiguity, and such individuals are clearly phenotypically "female" and in fact just as fertile as anyone else except for the 'access' problem. Some researchers also do not include aneuploidies (all the things I mentioned in the last paragraph, where there are unusual configurations of sex chromosomes) among "intersex" conditions, which apparently results in an estimated rate of those conditions of approximately 0.02% of the population.
Even individuals with other categories of DSDs, including the most classical "intersex" conditions of CAIS (when an XY fetus develops a "female" phenotype) and CAH (when an XX fetus develops a "male" phenotype) [each about 0.008% of the population], do not usually adopt an intersex identity, although the best estimate I could find for both was "less than a fifth", which isn't as specific as I might like. So basically, to sum up, I recommend against using the word too freely!
Post by: Vector on January 10, 2023, 03:14:24 am
I guess I have never heard "intersex" used as a slur except when a person wanted an ugly word for a trans person (what I mean is I have never heard anyone who wasn't trans or being clocked as trans called intersex as an insult). There was a lot of nastiness about micropenises a while ago but I'm not talking about that, I'm mentioning only the i-word.
This might be partly a problem with having put "intersex" into LGBTQIA+... I think more or less everyone in the community understands that the "I" may want nothing to do with us and uninterested in finding common cause, much like large numbers of "A" people don't consider themselves queer (and large numbers do and are welcome to participate, to be clear). But perhaps others don't know that it's supposed to be a welcome mat, not a wedding. For "I" it's a declaration of allyship and openness more than anything else.
Anyway, I'm not sure if it's clear from my post but I'm curious about this and interested in learning more.
Post by: Maximum Spin on January 10, 2023, 03:25:41 am
-lol I just remembered that Vector doesn't like to be quoted, two hours later, sorry, I always forget that, too used to quoting everything-Hm, I wouldn't have a clue where to point you to in terms of resources, but certainly, my understanding from the people I've spoken to is that they do firmly consider "intersex" to be an identity which does not apply to them. I can't speak for them in terms of whether they consider it to be a gender, though. I agree that it doesn't seem like the same thing to me. I suppose you could also use the word "label", although "identity" is the term I've seen used - it's possible to imagine that someone might not want to be labelled as a diabetic, and, if there were conditions that were in some sense like diabetes but arguably distinct - maybe diabetes insipidus could qualify? - it even makes sense to imagine someone with such a condition arguing about whether it falls under the label. In this case, the point that opens the debate is really that some of the most common DSDs are not even medically regarded as "intersex", at least not consistently, so there's certainly room to argue the label.
I don't think the people I've spoken to would mostly regard "intersex" as a slur either - the story I heard was more typically one of frustration toward well-meaning people using the word in a way they considered inaccurate. So I agree with you on that part, as far as I can say.
In any case, surely one can identify as having particular genitalia? Gender isn't the only form of identity. Ultimately, the point is, there are people who are often categorized as "intersex" who do not feel that the word describes them.
ETA: Like I said, I learned most of this from people with Klinefelter syndrome, and I understand there is a similar situation around Turner syndrome, so I guess that's who would be best to talk to. Neither is exceptionally uncommon so there are reasonably-sized communities around them.
Post by: voliol on January 10, 2023, 04:37:59 am
Just to be clear, I'm not saying only those "out" are homosexual or transgender (using modern terms). Rather, that in a world where we can't just ask gay people "does gender-based sexuality" exist and get a "yes duh", because we don't trust them to give an answer independent of what social constructs surround sexuality (or similarly with trans people and gender), we can still deduce there is something there, causing what would otherwise be very strange behavior. And denying this "something" is denying the experiences of those people.
I'm sorry if I'm misrepresenting any of you, just to make it clear I think it is a very easy trap to fall into. Both from a position where you truly aren't affected by this "something", due to being agender or bi/pan of some kind. But it's also easy if you are ostensibly affected, but it doesn't pull you against the grain. Like, how many cis and/or straight people have you not met who deny gender and/or sexuality? There's obviously some reactionary response here as well, but part of it is unwillful ignorance. Because it doesn't come naturally even if people have gender or sexuality, when they aren't forced to think about it.
Re: intersex I don't know that I know any people with DSDs, but statistically I should know someone with late onset adrenal hypoplasia. Don't feel I have much to add, but it's interesting for sure.
Post by: Vector on January 10, 2023, 05:08:00 am
@McTraveller: as you can see lots of other people have replied. Here's yet another viewpoint:
What's the modern take on use of language like "gender assigned at birth" versus simply "gonads observed at birth." Or more generally - is gender so closely tied with gonads and other presentation?
I agree with Alway but I'm going to embellish a little.
So, "assigned [foo] at birth" is a term that the trans community actually took wholesale from intersex people. The "assigned" part was originally about ambiguous genitalia that were then declared to be [foo] and then your parents would raise you as a [foo]. LOL.
"Coercively assigned..." was originally a way of nodding at a surgical intervention. I have seen some trans people misappropriating this (well, misunderstanding it) and using that language to explain how angry they are at having been made to be [foo]. The last time I saw it misused was a long time ago, though.
Now. Trans adults, almost all of whom right now have had to experience socialization and childhood as a gender misaligned with their sense of self, use AGAB as a way to talk about childhood and formative early adulthood experiences, or experiences around misogyny for example, see below. I think discourse around AGAB and the reason to say it that way matters more, makes more sense, whatever, when you don't pass as the thing you're trying to live your life as, or when you're trying to explain "I think I might be trans, can someone talk to me about it" and you don't want to have to say "I'm a man" or "I have body parts [bar]." In that case, you aren't a trans man, or whatever, yet. You were assigned female at birth and you're trying to find out what happens next.
Something that happened IRL recently: two cis women and two nonbinary people in a room. The cis women start talking about how work is always left to women. The nonbinary people nod. Later when the enbies are kvetching one of them angrily says, "she was right though, why was it all AFABs?"
There's other AGAB discourse, usually around intracommunity arguments. I'm not going to air them out here for public consumption but you can find them on Twitter.
An important note is that AGAB is more or less only socially acceptable as a thing to talk about explicitly for: 1. online conversations between 2. people who don't know each other IRL, who 3. are talking about RL events where 4. perceived gender rather than actual gender is relevant, and most importantly 5. there is no photograph of the person available.
It's generally considered to be Bad Form to describe trans people in terms of their AGAB, especially nonbinary people. There's some nuance to this situation but the main thing is that if you are talking about someone who is nonbinary to a third party who hasn't met them, like "I just met my kid's new teacher, Mx. so and so," you should absolutely not respond to further questioning with "Oh, they're AFAB" or "Oh, they're AMAB." Provide the information that the other person gave you and maybe other elements that are 1. chosen and 2. visible (the person's gender presentation, like "Mx. Anderson has a crew cut and a skirt"), and ideally nothing else.
First, you might be wrong. But one of the reasons why this is so very cringe is because nonbinary people historically have unequal access to medical transition and hormones, although we are getting more of it in recent years. So in some/many cases you are drawing attention to somebody's inability to get healthcare or a deliberate choice they are making in case they need to "pass" as something binary for safety.
In other cases, like cases where there's a lot of ambiguity and mixed signals, many trans people really don't want to be informed that you clocked them as one thing or another. Once again... ya may be wrong. Just let it go...
Or is gender orthogonal to primary and secondary sexual characteristics? Or is it sometimes orthogonal and sometimes linked?
I think it's more that it's a linked variable, meaning that one's sex has something to do with it, but it is not entirely determined by externally visible sex characteristics. There is some evidence that trans people are basically "created" by hormones gendering the brain in utero not matching hormones which gendered the body. These are separate waves of hormone baths.
Or the ultimate extreme - does gender matter anyway? If so, why? If not, why do we make such a big deal about it? What does "getting gender wrong" actually mean, aside from side effects like in most cultures a history of oppressing the feminine?
I think it matters. We're not getting rid of gender anyway, not without getting rid of all our books and all our history. Most cisgender people seem to really enjoy their genders, too. The best we can do is try to open it up so that people can play with it and make something new from it.
I'm not really sure what you mean by "getting gender wrong." Do you mean, what side effects are there to getting gender wrong? Or do you mean, "what is it to get gender wrong?"
My very naive fundamental question: if being a woman isn't related to bearing children, and being a man isn't related to siring children, just what is gender anyway?
"Gender" is "genre." (In other romance languages, they are literally the same word) Two of the popular genres in our culture are the "soft baby lullaby song" and the ... the "inseminator's song" (I was going to say "warrior's song," but whatever). If you're agender maybe you're noisecore.
The thing is that what seems fundamental to you does not seem fundamental to many others, and I don't mean trans people. For example, I've heard that "being a woman or being a man comes down to the role you want to play during sex and that's the only difference." I've also heard that it's about "caring for children while men are away" vs. "being called upon to go to war."
And then, there are the signs and signals which are used to show "my privates are hidden under my clothes but be aware that I could sing a lullaby if necessary, if ya know what I mean" and so on, which also become part of gender. A lot is made of handkerchief and carabiner codes but, well, I won't keep writing, you can finish the sentence yourself.
So gender is also, in a sense, about signaling normative sexuality, or tied to those expressions. It's a big fuzzy cloud, remember, a big fuzzy cloud full of nonconformists.
My point is that I have heard both of the dichotomies above as being the one and only thing that matters most about gender and exclusively determines gender. You can't all be right, so most people usually use a definition that kind of includes all of these things at the same time. And then boom, you have The Feminine and The Masculine in western culture, and Traditionalism, taran tara!! and a bunch of gender non-conforming people, and the transgender riot.
Post by: Maximum Spin on January 10, 2023, 05:24:14 am
Re: intersex I don't know that I know any people with DSDs, but statistically I should know someone with late onset adrenal hypoplasia. Don't feel I have much to add, but it's interesting for sure.I know, right? It's interesting that it's so common. I have family members with hyperandrogenism, which might be that, but could also be caused by other conditions.
@Max Spin: *thinking noises*I'm sorry to say - I'm not interpreting this as you making any statement, I'm just using it as a convenient backreference to the conversation - that I can't give you anything more than that. Honestly, I tend to be uncomfortable speaking for other people so I probably wouldn't have brought it up at all normally, but it just happened to twig the memory for me and, already being in a little bit of an overly gregarious mood today, I thought "oh hey, I know something about this!" and felt like it was a good idea to share it, and now I'm a little uneasy about that, so uh... well, that's not your fault, that's just me, but I hope it gives some kind of context. Also, I'd like to add, not to you specifically but just in general, that I also wasn't assuming anyone meant anything harmful by raising DSDs in the first place.
Post by: McTraveller on January 10, 2023, 08:10:26 am
Still trying to wrap my head around it. Mostly about terms like AGAB - because it seems to always been used in a negative connotation, when for many people the letter on their birth certificate matches how they see themselves. So it's "almost always correct" in the statistical sense (high 90s percent)... so it has always struck me as odd the way it seems to be used (and to be fair I've only encountered its use online, so...)
I think part of it is also that I don't personally tie my sexuality or gender role or nationality or career so tightly to my sense of identity... so trying to understand why for so many people some aspect of life like that is so core to identity is something I'm trying to understand - because I just "don't get it"; I don't get offended if someone assumes something incorrect about me in that way, for example.
So yeah one of my questions was - "what does it mean if someone gets your gender wrong?" It's less clear than the question of "what does it mean if someone gets your sexuality wrong" because that clearly impacts the practicality of physical relations. I guess if people always assume your gender (appearance/behavior) matches your physical activity preferences, that's where the conflict really arises (even moreso than association with child bearing/siring)?
Is the social impact really as simple as "society uses gender as a shortcut people use to decide if they want to hook up with each other, so when those associations become less clear, people get sexually frustrated and that bleeds over into other expressions of frustration"? Sure it's got nuances, but isn't that really the core of what gets people so bent out of shape? Or maybe even if it isn't about hooking up, just a general violation of expectations*? Messing with expectations is always a good way to generate conflict...
Incidentally, I am in the camp that thinks gender is as "real" as any other social construct - it's not "fake." Perhaps there's an argument that it's arbitrary, but it's definitely not "fake."
Spoiler: * A side thought (click to show/hide)
Post by: Starver on January 10, 2023, 10:20:51 am
Using the addage of "Gender is what's between your ears, sex is what's between your legs, sexuality is who is between your legs", all three things (themselves not even striftly binary, linear or otherwise uncomplicated) are, IMO, perpendicular.
Gender cannot really be detected at birth, so is provisionally assigned based upon the observed (or assumed, presumed or even wishfully-thought) sex.
'True' gender may reveal itself later, but (as mentioned) social conventions/expectations may do as much damage as the surgeon might previously have done to the inconveniently non-standard sexual features. But physical sexual characteristics is the golden standard for society to take its cue from, even if not really supposed to be actually on full display for impromptu checking by strangers.
Sexuality shouldn't really (certainly not involuntarily) come into things until(/after) puberty, and as such might be inevitably described in terms arising from the way sex and gender have ('male-brained female body' and 'female-brained male body' both map to 'queer', despite being different in so many ways apart from perhaps the shared sense of 'otherness', and not necessaily a predictor of the choice/non-choice of partners), becoming what might be the most socially obvious label presented in maturity[1]. Given how both sex and gender can be presented differently (whether going to the extent of full-blown top-and-bottom surgery or merely living life as whoever you think you want to be to the greatest allowable extent), it is still contextually tied into what people want to think of it, and perhaps change as easy as any relationship status might, but who two people are (or seem to be) who are holding hands/kissing seems to be what most people latch onto easiest.
I was citing some of my life experiences (or, rather, of people I know who have relevent life experiences) to back up my philosophies in this subject, but it started to get a bit too involved and closer than comfortable to identifying those I wouldn't really wish to be anything more than an abstract anecdote. The two easy to boil down cases are of a friend's son who played with feminine toys at a very young age and grew up to be gay yet otherwise happily male (SFAIK), whilst someone else who I never knew to be anything other than a 'lad' eventually went through the full(?) surgical process to a very passable trans-female (but, last I knew, apparently fully and contentedly asexual in a carer relationship). Not great support for my wider views, and woefully short of any AFAB cohort, but showing enough of a mixing-it-up to untie some of the common fallacies (phallusies?) about sex/gender/sexuality cross-pigeonholing.
Myself: unambiguous with the bits and pieces, I don't believe I have any relevent dysphoria and my practical sexuality is pretty much of towards the V. planifolia. Not worthy of citation, and perhaps then makes me a bad person to opine upon the actual complexities. But here are my 'qualifications' anyway, should you feel the need to respond to my diatribe.
[1] Clothes do complicate this. In a given time and society that vehemently denies ambisexual/androgynous clothing options, the person wearing a man's clothing is perhaps most conveniently deemed a man, regardless of everything else, and vice-versa the person in ubiquitously female attire. But clothing styles and options change so much that exceptions to the standard probably just feed into the battle between polarisation and ambiguity of the next culture along, or across any other narrow divide.
Post by: None on January 10, 2023, 11:47:07 am
Spoiler (click to show/hide)
Post by: alway on January 10, 2023, 01:32:20 pm
But that's only a part of it. Intersex conditions often aren't even something people are aware of having, as they usually don't manifest in ways people notice. For example, the folks I mentioned who went on feminizing hormones, whose first hormone blood test prior to starting revealed 'oh yeah, your body just doesn't produce testosterone as we would expect it to.' As was also mentioned, things like XXY and other chromosome differences often don't manifest all that differently phenotypically because chromosomes just don't control development as much as the zeitgeist tells people they do. We don't normally get a good inventory of where and what all our internal organs are; nor is it standard to test hormones or genetics. In one particular case study, a perfectly normal woman gave birth to a daughter; in her late teens, the daughter has a screening related to late/incomplete puberty, and was found to have XY chromosomes. They then tested her mother, who was also found to have XY chromosomes, without it affecting her phenotype. This is the point I'm making about intersex conditions: they often aren't a big deal, and often don't affect how someone goes about their life; but nonetheless, they do quietly invalidate AGAB-as-biology assumptions, just as things like trans people taking hormones does.
As for gender being fake: I say it specifically in the way The Hogfather mentions that you won't find a single atom of hope, love, or justice in the universe. Gender is fake, in that it isn't tied to any particular measurable thing, but is instead how humans have chosen to subdivide and classify. Likewise, this doesn't imply it isn't a matter of choice: I don't believe in a gender binary or cis-normativity. That doesn't mean I get to live outside of all the systems society has built around those things or even that I am free of that influence over both my thoughts and presentation. But at the same time, different societies see gender differently; see different dividing lines on what makes up gender; find different meaning in what gender is. It is all too easy to get caught up in one's own culture's narratives and forgetting any others ever existed.
Underlying all of this, that same high-dimensional space of attributes that get all bundled up into "gender" exists; how you subdivide, or even which things you include as part of it, is all surface-level labelling and classification. The trouble comes when society moves from passively categorizing and labelling, and into the realm of declaring "because it is of this gender, it must have these attributes." Whether that's gender roles, biological, or social in nature. Some of these things aren't chosen; some of them very much are chosen, in an attempt to become closer to the person we want to be.
As an aside, I do disagree with this bit:
"It's kind of like if somebody had a medical transition and then said "I don't identify as trans." Like, sure, ok, but the world is going to identify you as trans whether you like it or not. You may not identify with the term, and it may not be important to you as a political category, but as a descriptor of what has happened with your body it's kind of ironclad."
I know it's not the point it's making, but incidentally, transgender isn't a bio-essentialist descriptor; it's equally valid to be a trans woman who takes hormones as it is to be a cis man who takes hormones or a cis woman who doesn't take hormones or a trans woman who doesn't take hormones; everyone should have that autonomy over their bodies regardless of gender and regardless of whether they actually want to make use of that autonomy. Like, if you want to make your body more in the image of what you would prefer it to be, and it is generally safe to do so and the tradeoffs are worth it, go for it. This distinction is an important one as it decouples the question of body modification from the question of gender: changes should be made to one's body specifically because they want those changes, rather than it being expected of them as part of a gender, trans or otherwise. When I was starting hormones a bit over 5 years ago (holy wow it's been that long already? dang), I was nervous as everyone is about "is this the right decision? what if after exploring it I turn out to not actually be a woman??" To which I had the realization: It doesn't actually matter; the real question that matters is whether I would prefer my body the way it was, or the way it would become. From this, I immediately realized: even in a worst-case scenario of detransitioning and being a cis man for the rest of my life, any lingering changes would be welcome over the way things were. (since then, of course, the changes from hormones have gone beyond the best hopes I dared have about them; can't even imagine a life without them).
went through the full(?) surgical process to a very passable trans-femaleAs another aside, most trans women don't actually get surgery to any part of them which is visible to society. It's sort of a spontaneously generated mythology built by cis people who don't understand how people can completely change their body's appearance without surgical intervention. 90% of the heavy lifting is just done by hormones: it changes skin, hair, nails, smell, facial structure and the shape of bodies on every level above the skeleton (and even a couple there), causes breast development, and so on. A good number get breast augmentation later, as wider shoulders from testosterone puberty tend to make those appear smaller; a few get FFS to shave a bit of the facial bone structure. Bottom surgery is still less common than not (though around a slim majority do want it at some point; there's a lot of hurdles for that one) But for the most part, it's just presentation and hormones. The transtimelines subreddit shows this off quite nicely if you want concrete examples.
Post by: Vector on January 10, 2023, 04:21:33 pm
@Alway -- I appreciate your critique.
Still trying to wrap my head around it. Mostly about terms like AGAB - because it seems to always been used in a negative connotation, when for many people the letter on their birth certificate matches how they see themselves. So it's "almost always correct" in the statistical sense (high 90s percent)... so it has always struck me as odd the way it seems to be used (and to be fair I've only encountered its use online, so...)
Yeah, so the specific term AGAB as seen in online discourse is used to describe a tension between how you were assigned and what you are, so it's going to represent strong negative feelings for many people. When people clock you as having a different gender than the one you were assigned, that can be the moment before things get violent, or just interpersonally nasty.
There are lots of trans people like Alway said who don't have especially negative feelings about their AGAB, who don't experience gender dysphoria. But the term, "AGAB," almost always comes up in those moments of tension. The difference between who you were made to be and who you are if given half a chance.
So yeah one of my questions was - "what does it mean if someone gets your gender wrong?" It's less clear than the question of "what does it mean if someone gets your sexuality wrong" because that clearly impacts the practicality of physical relations. I guess if people always assume your gender (appearance/behavior) matches your physical activity preferences, that's where the conflict really arises (even moreso than association with child bearing/siring)?
Your mileage may vary on the following. I'm writing about my experience and I don't claim that it's generalizable. And sorry for the long post.
In my particular situation, I don't identify as a woman but I sort of look like one. I say sort of because there are a lot of changes I've made from how I was told as a child to behave or else. Let's look at some of the things a person can do gender without medical intervention:
- Hairstyle
- Personal grooming (shaving or not shaving things, for example)
- The pitch/manner/style of their voice
- The way that they walk, sit, stand. Do they hold doors open for women? For men?
- Word choice (how they talk about themselves and about other people, cis or trans.) (have you ever heard this person say "ladies and gentlemen?")
- Word choice part 2: one of the ways that one signals "mutual cisgenderness" is by indicating that specific trans people are confusing/sending mixed signals, in private. A person who won't shit on a trans stranger and who can read their gender signals is sometimes treated as though their behavior is suspect.
- Speech style: direct? blunt? making space for others? with a habitual tendency for understatement?
- Clothing -- not just "masculine" or "feminine" styles, but emphasizing or de-emphasizing aspects of their appearance, like the trans femme empire waist dress or the trans masc "dysphoria jacket;" or choosing clothing that now encodes transness itself, eg the famous outfit of blocky glasses, thigh highs and skirt or skinny jeans, an anime t-shirt, and birkenstocks or doc martens.
- Clothing part 2 -- tucking and binding.
- Gestures; how often do they smile? do they take up space? glare openly at people who are being annoying? hold your gaze?
- Job choice -- public-facing? gendered? the kind of job where one can be hidden from view?
- The people with whom one associates. Mostly men? mostly women? mostly queers? a mix?
- Handwriting
- Hobbies (frequently gendered)
- Who they date and in what way. How did the lucky meeting happen? If you're trans, it was probably on the internet.
- The books and movies a person is familiar with and the characters that they relate to.
- When questioned, do they understand a fundamental distinction between male and female? Or do they make telling mistakes?
When examining the overall "signal" that a person puts off, there are many people who defer to perceived AGAB without thinking about it. Others see a discrepancy between the perceived AGAB and social signals and say: "aha, a trans person!" Sometimes this is good, and sometimes this is very, very bad.
(For example, when a child asks their parent, "mommy, is that a man or a woman," and the parent looks at me very closely and says "Uh... I don't know, sweetie," that is a happy experience for me. But most people wouldn't like to have that experience with any regularity)
I can pass as a cis female with effort, but many of my signals on the above list are mixed, opposite, or "confused." On the above list the "non-trans" signals for me are: I don't bind, I have pretty handwriting, I have lots of stereotypically feminine hobbies, and I am caring towards others. I wear femme clothing sometimes -- which is different from "female" clothing in the sense that most women don't wear that style either, but they are wearing "female" clothes.
Anyway, regardless of what I put on, the gestures, overall personality, and "vibe" all read wrong. When I wear femme clothes, people who I know often cannot recognize me, and think I am a different person. I get lots of compliments. It doesn't confuse trans people, though, who know what's up, and usually say something like "I dig your costume."
But when I wear what I would normally wear without thinking about it, and act how I normally would like to act, sometimes people get angry because they can see my AGAB but they think I would be a bad mother or wife. Or because they find it confusing, because sometimes I look like a woman, and sometimes I look like something else that they don't have words to describe. There is a distorted signal. I certainly don't look like a man, but I don't look like a woman either. Luckily, I don't identify as either of those, so that's the intended effect.
And sometimes, I do things that are seen as belonging to the sacred domain of men, like stepping into a conflict to protect other people, and I'm not just criticized for it -- it's as though it didn't happen, it's a scar. It's removed from the public record because someone like me could not have acted like that, because if that goes on the record, I am no longer cis, and it's agreed in cisgender society that it's important to overlook the little things that make a person not-cis.
And more importantly, there are certain things that you just can't do, the deep gender taboos, the fundamentals, and in those moments the perception crosses over, and I am not just a "confusing" or "gay" woman but a woman who, sometimes, performs the social role of a man correctly. I earn my gender over and over again until it can't be ignored and it can't be made coherent in anyone's mind by claiming either "that's a man" or "that's a woman." Eventually people treat me with respect, and they can finally see me. But it takes time. Usually years with any group of people.
So let's talk about the people who don't just defer to AGAB and who aren't angry about it. Trans people can usually clock me instantly as "some flavor of trans." Cis people who are told that I am trans but saw me as cis through perceived AGAB become unsure of my AGAB.
And then there's the more interesting ones: the trans women who consider me to just be male, full stop, the gay men who read me as a gay male (piloting a woman's body), the straight cis men who decide I'm a he/him even when I'm wearing a dress, the lesbians who say I am unusually feminine for a nonbinary person, it goes on and on.
So, why not just be perceived as a woman? Why should I be?
Why not be perceived as a man? Why should I be?
Post by: TD1 on January 11, 2023, 09:43:42 am
And I'm just like
.... lol?
Post by: GadgetPatch on January 11, 2023, 10:39:43 am
I'm all for streamlining communication, and (as a former med student of trans experience) I can still see the utility of inventing new shorthands for the medical state of a body, for a limited set of circumstances.
But hey, I also prefer a slightly clumsy but more accurate language, to a false oversimplification.
Post by: Rolan7 on January 11, 2023, 10:50:51 am
Yeah it's weird, "gender critical" "feminists" kept defining women as people with vaginas. I mean people with working vaginas and ovum and XX chromosomes well maybe some other chromosomes look the chromosomes don't matter we can just tell by looking. Well okay THOSE trans wo- those people sure looked like women but that's terrifying so I won't call them that word. Look we just want our single-sex safe spaces to be safe, and trans people make those spaces unsafe by constantly getting assaulted by us. Or tricking us into assaulting other cis people. I mean "normal" people, "cis" is a hateful slur actually. I refuse to say "cis" or "not trans" or "woman" because those words are very scary to me. I'm normal! I'm normal! You other normal people know exactly what I mean by normal, right? woah ixnay on the pitchforks, it's too soon
Those trans people are always saying "man" and "woman", ugh. Unless they're talking about medical situations like abortion, when suddenly they go for medical terminology? It's like they're not even *trying* to reduce womanhood to having a fertilizable womb! Don't they know that using specific and inclusive language just emboldens people? We need people *scared* dammit! Scared of those non-normal people! They're a threat to us, you can tell because they aren't normal like us! Stop calling them men and women, it... normalizes them.
We should only talk about us biological women (AKA real women also don't ask me to define that, bigot) and the men who own our vaginas.
/
Post by: Rolan7 on January 11, 2023, 11:01:40 am
I've found that anti-trans people seem the most confused and reluctant to use "man" and "woman", instead talking about various physical things like vaginas or chromosomes. They're fine terms. For certain situations like reproductive health though, it's a lot more accurate *and* inclusive to describe demographics who can become pregnant or impregnate.
Even for cis people, gender is so much more than reproductive function!
Post by: alway on January 11, 2023, 11:31:43 am
I just find it humourous that people are afraid to say 'man' and 'woman' now. I say this because I'm currently reading an article which references 'people who own a vagina' and 'people with a penis'That's not fear, it's accuracy. As to why this matters, here's a bit of an anecdote: I know a man who became pregnant; it was unplanned, unintended, but nonetheless something he would have been happy to take to completion and given birth to a child who would have been loved dearly by him and his partner. He found out he was pregnant when he had the miscarriage.
And I'm just like
.... lol?
As many would be, he was kinda fucked up over this. He sought out support, and found group therapy nearby. He got there, and they saw his beard, heard his deep voice, and informed him that this was a therapy session for women who experienced miscarriages, not men, who were unable to. He was turned away.
Something to understand here: this isn't a one-off. When you are in a marginalized group, this is how every single interaction regarding basic healthcare goes unless care is taken to properly define who things apply to. You might say "close enough, ignore the outliers," but the thing about outliers is, it's the same people 100% of the time, who now get their basic needs ignored 100% of the time. That's not an outlier, that's incredibly harmful oppression of a group on the grounds of said group being small.
As another example of this: the case of Robert Eads. He was a trans man diagnosed with ovarian cancer. He went to around 20 different doctors, all of whom refused to treat him; after all, gynecologists treat women, not men! By the time he found a doctor willing to treat his cancer an entire year later, it had already grown and was beyond what could be dealt with. He died 2 years later at age 53.
Post by: GadgetPatch on January 11, 2023, 11:46:07 am
I say this to show it happens to all kinds of people. The way gendered language gets baked not only into social mores, but also into laws and everyday procedures, is ridiculous and unfortunate. It's not just what words people use.
Post by: McTraveller on January 11, 2023, 10:02:05 pm
I can't fathom why you'd base available medical care based on a label rather than on what organs and biochemistry are present.
A less controversial example is laws like "oh that aluminum can holds water, not sugary soft drinks or beer, so it's not subject to recycling deposit/refund laws."
Post by: Strongpoint on January 12, 2023, 02:08:16 am
Quote
As another example of this: the case of Robert Eads. He was a trans man diagnosed with ovarian cancer. He went to around 20 different doctors, all of whom refused to treat him; after all, gynecologists treat women, not men! By the time he found a doctor willing to treat his cancer an entire year later, it had already grown and was beyond what could be dealt with. He died 2 years later at age 53.
WTF? It sounds absurdly disgusting. I can't imagine something like that happening here. Sure, chances are that a patient like this will receive long lectures about their sanity (and\or morality) from the doctor but outright refusal to treat from ~20 doctors?
Post by: TD1 on January 12, 2023, 04:53:13 am
Actually maybe that post doesn't make any sense and I've been spending too much time on twitter, lemme try again:Truly, Twitter is the bane of legibility.
I've found that anti-trans people seem the most confused and reluctant to use "man" and "woman", instead talking about various physical things like vaginas or chromosomes. They're fine terms. For certain situations like reproductive health though, it's a lot more accurate *and* inclusive to describe demographics who can become pregnant or impregnate.
Even for cis people, gender is so much more than reproductive function!
I find there's a point where the language becomes ridiculous, which doesn't help anyone. Presented with the phrase 'people who own a vagina' I envisaged someone with a vagina as a pet, or who possessed the deed to a vagina.
I snorted a laugh, which is probably not what you want.
Edit: Also, I'd like to apologise for the tone of my previous message. I stand by its sentiment, but not its wording - which I now see to be slightly incendiary.
Post by: Rolan7 on January 12, 2023, 09:13:06 am
It's pretty weird to see them parroting their definitions of womanhood in response to everything, since they're conflicting definitions? And it's not disagreement among their ranks - an individual will swap instantly between definitions when you respond, and see no hypocrisy there. Truly, a woman is defined as "Not a trans woman" to them.
I sorta considered posting some of the particularly wacky arguments I've gotten (that's basically what that rant was). Engaging with them can be insidiously fun, particularly when they're sooooo off the mark. It's so easy to get a "You will never be a man" from them by acting like a trans man - without lying! Just being my gender-fluid self! That can be really... affirming? Not because they're the arbiters of gender, but because it reveals just how flimsy their anti-trans ideology is. It's that relaxing feeling of confirming that they have no attacks of substance.
Of course I'm small enough not to be doxxed or have (many) death threats spammed at me, and I'm pretty stealth in my actual life, so I'm emotionally able to enjoy such frivolity. It can stop being funny real quick.
Anyway yeah, some women can't get pregnant (trans or otherwise) and some men can get pregnant. There's this one guy I know who moderates a chat, he's going off his hormones for a whole year to do it. I'm not sure how to describe how huge that is to someone who doesn't need HRT. Truly some mind-over-matter and dedication to his goal. IDK, I just think about that a lot. If it was just an ideology/fad/whatever, who would ever do that?? But these guys do! I guess most people see a pregnant guy and don't see an absolute king doing something unthinkably brave...
Post by: Starver on January 12, 2023, 09:42:59 am
And the additional pressures from social and cultural issues cannot help at all, whether it's counter or in addition to biology and/or identity.
Post by: Strongpoint on January 12, 2023, 12:59:18 pm
Quote
They really do use phrases like that, reducing "men" and "women" to gametes.
Well, gametes ARE the most convenient way to determine if an organism is male or female.
And this reminds me something I often hear in other parts of Twitter... Oh... Yes... religious folks "How can you reduce humans to animals?"
Post by: Maximum Spin on January 12, 2023, 02:08:48 pm
Well, gametes ARE the most convenient way to determine if an organism is male or female.In biology, gametes are how "male" and "female" are defined. From a biological perspective, every human can be classified into one of those two categories with no overlap, based on gametes - even everyone with a DSD, since no human being has ever been found to produce both gametes, and this is almost certainly impossible because the systems that allow their production are in absolute competition. There are, of course, people who produce neither gamete for one reason or another, but it's always possible to trace the developmental pathway backward and determine what "would have been".
So from the perspective of the study of biology you can always determine a gametic sex, sure.
Post by: Starver on January 12, 2023, 03:46:30 pm
Post by: Rolan7 on January 12, 2023, 10:01:16 pm
North Dakota Bill Would Require Employers Use Pronouns "Associated With Deoxyribonucleic Acid" (https://erininthemorn.substack.com/p/north-dakota-bill-would-require-employers)
How is anyone this silly...
(They aren't. The cruelty is the point, these bills are designed to scare their targets and maybe shift the Overton window for more "reasonable" bills. Or maybe the Supreme Court just allows something like this, why wouldn't they?)
Post by: Egan_BW on January 13, 2023, 04:41:33 am
Pronouns "Associated With Deoxyribonucleic Acid"hi my pronouns are TACGTCAGCTGACCTACGTCAGCTCAGCACGTAACCAGCTACGACTCTGCTCCAGACATGCT / CGATGCTAGCCGTTATCGATATGAGGCTAAGCAGCGATCTCGGTCCTGTCAAGTATGCA
(There isn't any easter egg hidden in there I just mashed keys.)
Post by: Strongpoint on January 13, 2023, 04:49:48 am
In biology, gametes are how "male" and "female" are defined.
So from the perspective of the study of biology you can always determine a gametic sex, sure.
It is not merely from the perspective of a study of biology, it is the most common meaning of the words woman and man, one used for many thousands of years, it is probably one of the earliest to arise because it was an important concept in everyday life of tribes.
Even before people had any idea about gametes, female was one who can bear children and male was one who provides seed. And woman and man are merely words to refer to adult human male and adult human female.
Therefore, phrases like "men can be pregnant" are absurd and go against the way how a huge majority of people understand the word "man". And yes, I am fully aware that other definitions exist and are in use by a growing. Yes, I understand what someone means when they say "a pregnant man." No, I don't think they are crazy or wicked or whatever. I just don't see any sense in hijacking a word that already has a meaning and infusing it with a quite different meaning while trying to erase the previous meaning.
What the point of replacing a word "man" with "AMAB" (or similar) and not make a separate word for your new broader definition of a man? Why create confusion?
Post by: Loud Whispers on January 13, 2023, 05:08:37 am
I'm GATTACA Binary uwuPronouns "Associated With Deoxyribonucleic Acid"hi my pronouns are TACGTCAGCTGACCTACGTCAGCTCAGCACGTAACCAGCTACGACTCTGCTCCAGACATGCT / CGATGCTAGCCGTTATCGATATGAGGCTAAGCAGCGATCTCGGTCCTGTCAAGTATGCA
(There isn't any easter egg hidden in there I just mashed keys.)
Post by: Starver on January 13, 2023, 06:00:42 am
UGGCAUGCGACUGCACAUGCGCGUAAA
Post by: voliol on January 13, 2023, 09:04:57 am
In biology, gametes are how "male" and "female" are defined.
So from the perspective of the study of biology you can always determine a gametic sex, sure.
It is not merely from the perspective of a study of biology, it is the most common meaning of the words woman and man, one used for many thousands of years, it is probably one of the earliest to arise because it was an important concept in everyday life of tribes.
Even before people had any idea about gametes, female was one who can bear children and male was one who provides seed. And woman and man are merely words to refer to adult human male and adult human female.
Therefore, phrases like "men can be pregnant" are absurd and go against the way how a huge majority of people understand the word "man". And yes, I am fully aware that other definitions exist and are in use by a growing. Yes, I understand what someone means when they say "a pregnant man." No, I don't think they are crazy or wicked or whatever. I just don't see any sense in hijacking a word that already has a meaning and infusing it with a quite different meaning while trying to erase the previous meaning.
What the point of replacing a word "man" with "AMAB" (or similar) and not make a separate word for your new broader definition of a man? Why create confusion?
The common use of "man" and "woman" is "person who appears socially a man/woman", because no one takes a look at others gonads casually. Sure, there could be separate medical definitions where applicable, but I don't see how that would be less confusing than just referring to the body parts.
Post by: TD1 on January 13, 2023, 09:41:54 am
Of course, I also view a priori gender claims to be completely irrelevant except on a personal level. Indeed, they're nonsensical when given any real-world application, as a biological definition of 'man' does not discriminate according to how one behaves, thinks, or dances nude in the streets.
Which doesn't mean gender's not without intense personal meaning! It fuels identity and forms community, much as similarly a priori claims to nationality do.
Post by: Horizon on January 13, 2023, 10:36:08 am
Post by: MorleyDev on January 13, 2023, 10:48:40 am
----
And from a purely biological explanation for transexuality, a thought I've had that there's probably been research into I've missed and I fully accept I'm talking out my arse:
With my limited understanding of biology I know that when a fetus forms, it's always female first. Then other hormones come in and cause male traits to develop, but the template it's using as a starting point is female biology. And biology is not an exact process, so I can see plenty of room for things to go wrong. A male body forms but the brain develops in such a way that it 'expects' to interface with a female body. A female body remains but enough hormones happen that the brain develops in a way that it expects a male body. And all sorts of combinations of percentages in between.
Now, if that's the biological basis then there's two potential ways it can be 'addressed'. Either 'fix' the body so the brain can accept interfacing with it, or 'fix' the brain so it correctly accepts the body. But we aren't dealing with a simple chemical imbalance like can be addressed by SSRIs, so 'fixing' the brain is basically a no go. So you're left with doing what you can for the body to make the person's quality of life livable.
And again, the legal/social system has to cover the entire population of that society so has to accept this which means Lived Gender inherently becomes separate from Biological Sex as legal/social concepts.
Yes I'm aware this is probably the most coldly clinical way to talk about it, sorry about that.
Post by: Frumple on January 13, 2023, 11:09:22 am
the law has to leave room for thatI mean, do note that one of the ways the law has "left room" for that historically is "non-consensual surgical procedures on children", so sometimes the room made is not exactly kind or comfortable or actually there, it can be less like a room and more like assault inflicted on infants. Sometimes humans look at something breaking their categories and choose violence :-\
Post by: MorleyDev on January 13, 2023, 11:18:32 am
That's more the alternative approach of trying to remove them from the system entirely, which....yeah not a good approach.
Post by: Frumple on January 13, 2023, 11:21:29 am
Post by: MorleyDev on January 13, 2023, 11:57:39 am
Really only line of debate is determining what's a reasonable thing to enforce on a child compared to what is best left delayed until they are old enough to make an informed decision and give consent. And that will always fluctuate with culture.
Post by: Frumple on January 13, 2023, 12:14:39 pm
When it comes to intersex, though, it hasn't been particularly uncommon for the parent to not be informed, either. Doc just "fixes" it as a matter of course, and the law was by and large a-okay with that. Most of the point is just that legal systems don't actually have to recognize the fiddly bits of intersex folks, it's perfectly (and historically) capable of just eliminating them by force.
Post by: Grim Portent on January 13, 2023, 01:54:30 pm
Being intersex was viewed much like having a cleft palate, it was a disability, a deformity that would condemn the person to suffering if it wasn't fixed. Suffering either caused directly by their body not working 'correctly,' or suffering caused by others being cruel and stupid. The desire to conform isn't uncommon among people who get bullied for physical differences or disabilities.
Not great reasoning, but I can understand where the doctors were coming from when they did those procedures. Indeed, were I a doctor who delivered an intersex baby in the 1950s I would probably consider the surgery to be better long term than the increased risk of bullying, sexual assault, suicide and murder that the child would likely face without it.
Post by: Vector on January 13, 2023, 03:11:03 pm
Post by: McTraveller on January 13, 2023, 03:39:10 pm
Remember that the difference between 9 and 11 is about 20% of their life at that point - hence the "not close" hyperbole.
Post by: Vector on January 13, 2023, 06:16:23 pm
Dunno about the other claims, but 9 for menarche isn't (https://pubmed.ncbi.nlm.nih.gov/12509562/) anywhere close (https://www.cdc.gov/nchs/data/nhsr/nhsr146-508.pdf) to "average", though that is about the earliest possible.
Remember that the difference between 9 and 11 is about 20% of their life at that point - hence the "not close" hyperbole.
Thank you VERY much for the correction. My comment was based on some half-remembered (and now I clearly see, fear-mongering) claims about puberty in the US starting at younger and younger ages that were common discussion in my teenaged years. In retrospect that's an obvious error in terms of statistical implications, but well, whatever. It's a mistake.
I'm going to modify the post...
Post by: McTraveller on January 13, 2023, 06:19:10 pm
EDIT: I had to look it up partially because my daughter is 9 and I'm like wait what? I don't recall our pediatrician talking about that yet... /sweating
Post by: Maximum Spin on January 13, 2023, 06:28:57 pm
With my limited understanding of biology I know that when a fetus forms, it's always female first. Then other hormones come in and cause male traits to develop, but the template it's using as a starting point is female biology.This is very much inaccurate. A fetus in fact starts with two sets of tubing, one male and one female, and gonads that are neither. In males, the female tubing (Muellerian ducts) is supposed to disintegrate eventually, and in females the male tubing (Wolffian ducts) is supposed to disintegrate. So in other words, the "template" or "base" isn't one or the other; it's the starting point for both but also not quite fully either (since several parts of either sex still have to grow). In some cases, some parts of the tubing fail to disintegrate fully or other parts fail to grow properly, but this isn't usually considered a DSD and is not usually externally visible (eg, many men have a small remnant of the Muellerian duct attached to the testes, it has some name I don't immediately remember). It doesn't change the gametes the gonads will develop to produce either.
Post by: MorleyDev on January 13, 2023, 06:38:43 pm
Either way I'm not really thinking about genital development but brain development, if there's some underlying architectural 'XX' and 'XY' structure of the brain and how it expects the body it's piloting to be and if that could misalign with body development. If we start off as a 'blank' template that is later specialised, doesn't really change that concept...
tbh I'm more just thinking of a simplified model that could be used as a starting point to help cis people who are in that "I don't really get trans" category and "you don't need to get it, just accept it" doesn't work get their heads around it as a "thing that can happen".
Post by: Maximum Spin on January 13, 2023, 07:00:10 pm
[On claims about age of menarche declining]I don't think these claims were fear-mongering per se, but wild misunderstandings. At least, the ones I remember. Average age of menarche varies between ethnic groups in the US, and the changing ethnic composition WAS bringing down the overall average - but not with any particular group significantly changing. So it was probably a combination of some possible degree of racial apprehension, and just completely misunderstanding what was going on. I guess it depends what you think of as "fear-mongering", but it's not what I would call it.
Either way I'm not really thinking about genital development but brain development, if there's some underlying architectural 'XX' and 'XY' structure of the brain and how it expects the body it's piloting to be and if that could misalign with body development. If we start off as a 'blank' template that is later specialised, doesn't really change that concept...Have you ever read Testosterone Rex? As I understand it, there's considerable ongoing challenge to the idea that male and female brains differ significantly.
Post by: MorleyDev on January 13, 2023, 07:22:03 pm
One study put forward was that it's related to the rise in obesity rates causing it to trigger earlier. (http://pediatrics.aappublications.org/content/116/3/620).
Quote
Conclusions. The apparent influence of early maturation on adult female overweight is largely a result of the influence of elevated relative weight on early maturation. Interventions to prevent and treat overweight should focus on girls before they begin puberty.
Post by: Maximum Spin on January 13, 2023, 08:38:37 pm
The study I saw on age of puberty (https://pubmed.ncbi.nlm.nih.gov/24190685/), they split it between ethic groups and it was a general trend in the USA amongst all but African Americans that it was starting earlier. It seems to be a global trend too, or at least a western one.Hm, well, okay. I remember reading that changes were nonsignificant after controlling for ethnicity, but I'm not familiar with that study.
Post by: GadgetPatch on January 13, 2023, 09:41:53 pm
Either way I'm not really thinking about genital development but brain development, if there's some underlying architectural 'XX' and 'XY' structure of the brain and how it expects the body it's piloting to be and if that could misalign with body development. If we start off as a 'blank' template that is later specialised, doesn't really change that concept...
tbh I'm more just thinking of a simplified model that could be used as a starting point to help cis people who are in that "I don't really get trans" category and "you don't need to get it, just accept it" doesn't work get their heads around it as a "thing that can happen".
Been revisiting a Human Behavioral Biology lecture series recently (by one of my favorite researchers in the field), and as of the mid 2010s there's plenty of research pointing to developmental differences between cishet, cis-queer, and trans bodies. And they tend to be complex, and the research is underfunded at best, or a side-effect of research on cis populations more often... but:
Things like how the speed of the inner-ear noise experienced when you plug your ears varies based on what sex you're attracted to, regardless of your sex. Things like phantom limb sensations for lost bodyparts (genitals, breasts) removed as part of cancer treatment, which are widely reported among cis populations, but nearly never among trans populations, including those who were (at the time) not aware they were trans. And things like "fixed action patterns" (unlearned lizard-brain reflexes) that are hard-coded physiological responses; for those that vary by sex, the bodies of trans populations tend to have the opposite responses, and this is seen before any hormone changes etc, which suggests it's developmental.
Post by: Strongpoint on January 13, 2023, 10:19:16 pm
Completely off topic, but strictly speaking is there even such a thing as a consensual surgical procedure on a child? Being a child automatically means informed consent is impossible and so it's always via a proxy such as a parent.
Really only line of debate is determining what's a reasonable thing to enforce on a child compared to what is best left delayed until they are old enough to make an informed decision and give consent. And that will always fluctuate with culture.
I especially dislike the idea of puberty blockers so a child may decide when they reach 18 years. All I can say is WTF?
Becoming an adult is not only living X years, it is also experiencing the hormonal storm and dealing with how it changes your personality.
Post by: MorleyDev on January 13, 2023, 10:27:21 pm
And again, it was not really on-topic and more a general observation on medicine. If a child can't consent for surgery they can't consent for medication either for the same reasons, either parents or doctors are imposing on the child for their best interest as a consequence of that.
Post by: GadgetPatch on January 13, 2023, 10:42:05 pm
I especially dislike the idea of puberty blockers so a child may decide when they reach 18 years. All I can say is WTF?
Becoming an adult is not only living X years, it is also experiencing the hormonal storm and dealing with how it changes your personality.
Yeah, okay, if I'm reading you right, this is an exceptionally weird take. To the point that I almost don't want to get involved.
But no, blockers are a humane, common sense, and entirely reversible way to afford trans children agency over their own bodies. Plenty of adults are insensitive to their body's hormones and don't undergo puberty, and they turn out just fine. The absence or presence of hormones and puberty don't magically turn you into a better decision maker. Ridiculous idea, and a worse policy.
(And yes, forcing trans-identified kids to undergo an unwanted puberty is not only unnecessary, but also weird and cruel.)
Post by: Rose on January 14, 2023, 05:15:04 am
Post by: Strongpoint on January 14, 2023, 06:22:18 am
I especially dislike the idea of puberty blockers so a child may decide when they reach 18 years. All I can say is WTF?
Becoming an adult is not only living X years, it is also experiencing the hormonal storm and dealing with how it changes your personality.
Yeah, okay, if I'm reading you right, this is an exceptionally weird take. To the point that I almost don't want to get involved.
But no, blockers are a humane, common sense, and entirely reversible way to afford trans children agency over their own bodies. Plenty of adults are insensitive to their body's hormones and don't undergo puberty, and they turn out just fine. The absence or presence of hormones and puberty don't magically turn you into a better decision maker. Ridiculous idea, and a worse policy.
(And yes, forcing trans-identified kids to undergo an unwanted puberty is not only unnecessary, but also weird and cruel.)
Entirely reversible is debatableif we talk about the development of the brain and, by extension, personality. I believe that maturity requires experience of dealing with hormonal swings and sexual urges, it is an important part of growing up and transitioning from a child to an adult. Sure, some people don't go through this and are fine but their maturity curve is different.
Also, when someone has a mentality - I am not sure if I want to be a wo(man), experiencing becoming one may help decide. After all, children are neither men or women, they are boys and girls
And yes, forcing trans-identified kids to undergo an unwanted puberty is not only unnecessary, but also weird and cruel.
This part is true, but if medical professionals determine that the kid is indeed trans, why bother with the waiting period and don't go straight to desired hormones?
Post by: McTraveller on January 14, 2023, 08:47:45 am
Post by: Rolan7 on January 14, 2023, 09:18:47 am
But lets say Strongpoint is right and someone's brain cannot fully mature without experiencing a puberty. Which puberty do they get- the one they seem to prefer, or the the one they don't?
Trick question. Obviously to be a fully mature person, everyone must experience both puberties. "experiencing becoming one may help decide". The fact that they don't want it can't be a deciding criteria. It will definitely be very traumatic for most children, and have permanent physiological effects on bone structure and voice, but only half what trans people already experience.
Or maybe that's horrific. Instead we could offer them the puberty they prefer. They won't always be correct, but it still reduces harm compared to no action.
End of hypothetical. Fortunately I don't think we need to personally experience puberty in order to form an opinion on it. We just need up to 16 years to mature, watching how puberty affects our peers.
Post by: Egan_BW on January 14, 2023, 09:34:53 am
Some way of experiencing exactly what someone else has seems like it'd be a boon, at least.
Post by: Rolan7 on January 14, 2023, 10:06:10 am
I'm sure it's part of the reason that cyberpunk settings are so popular with trans people. Either extensive bodymodding or "just" immersive VR (CP2077 Brain Dances). Which reminds me that I still want to get my ears pierced soon :D A friend enthuses about hir piercings a lot (and robotics work) and I love seeing someone assert ownership of hir body like that.
I'm still very lowkey in my presentation, but I've always thought earrings looked nice... Lots of subtle options too!
Post by: Egan_BW on January 14, 2023, 10:35:28 am
Post by: Horizon on January 14, 2023, 10:51:09 am
I'm sure it's part of the reason that cyberpunk settings are so popular with trans people. Either extensive bodymodding or "just" immersive VR (CP2077 Brain Dances). Which reminds me that I still want to get my ears pierced soon :D A friend enthuses about hir piercings a lot (and robotics work) and I love seeing someone assert ownership of hir body like that.
Man it woulda been cool if they'd done more with Brain Dance.
Post by: McTraveller on January 14, 2023, 11:48:34 am
The "unnecessary" qualifier is an interesting one, and I feel like it relates to the word choice in "the wrong puberty"*. Strictly speaking, puberty is only necessary (though not sufficient) for procreation (yes yes, in humans, anyway).
Spoiler: * (click to show/hide)
Post by: Frumple on January 14, 2023, 02:57:17 pm
Now, if that's actually your position, you do you -- just be aware no one's going to be surprised if someone metaphorically or literally decks you for trying to correct them about what cancer's doing to a loved one or whatever. There's times and subjects "close enough" terminology isn't worth worrying about.
Post by: McTraveller on January 14, 2023, 03:17:58 pm
EDIT: Ok actually I think cancer is both wrong and terrible; there is a clearly identifiable malfunction in cellular behavior. For something like dysphoria there is no clear malfunction - all processes are working "normally" but they are just in conflict. So the entire situation is wrong, but the hormones / organs / neurochemistry / mental thought processes in isolation are not "wrong".
While I appreciate that "wrong" in some contexts means "terrible/awful/reprehensible" and in other contexts means "incorrect", there is danger in assuming the incorrect meaning for a given context.
So I call for disambiguation, and out of engineering habit I prefer "wrong" to mean "incorrect" and use the other more specific words for thing that are terrible/awful/reprehensible.
Good example: It is awful that someone is injured in an accident, but it is not "incorrect" that they are injured in an accident; the latter is borderline nonsensical.
Post by: Rolan7 on January 14, 2023, 04:41:48 pm
I agree that "unwanted"/"undesired" isn't always "bad", if it's necessary or useful. I help a lot with my cousins' children, heh. But as Frumple points out, "natural" isn't "good".
If we are going to force people to experience a puberty then we must first justify doing so (both because we must justify using force, and especially using force to curtail liberty). In a world where everyone was eventually happier living without hormone therapy, it might be moral to deny HRT to minors. Possibly even to adults, weighed against their personal liberty to make harmful decisions.
We would have to prove that we live in such a world, and the data strongly indicates otherwise. I think we all know the data I'm talking about. People with access to gender-affirming healthcare are much more likely to live happier lives. Simple social acceptance is also a huge factor there.
That's why my response to "there are many 'unwanted' things to which we subject people all the time" was to pretend to argue for something that nobody wants. "Unwanted" rules must be justified over allowing liberty. That justification could be training obedience in a child, but even then a harmless rule would seem safer than a rule against gender freedom or affirming health care.
Post by: Thorfinn on January 14, 2023, 05:28:12 pm
Are we sure we want to start discussing brain development? If we are to acknowledge that the trans brain is different, doesn't that inherently mean that for some tasks, one might prefer a male brain, for others, a female, and for a third, trans? Plus at least another for the opposite trans, and whatever other genders come to the fore.
And if some brains are just better suited for certain tasks, why would it be wrong to discriminate against someone with am objectively less qualified brain? We do that all the time, right? People with test scores below a certain point are not eligible to be doctors or lawyers or engineers or rocket scientists, for example.
Is it really a good idea to stake out the position that it's perfectly reasonable and scientifically accurate to say, "The best person for this job is a man"? Or even, "Statisically, we should hire a man for this job as his brain is more likely the best for this purpose."
Post by: Great Order on January 14, 2023, 06:45:05 pm
Good example, although not neurological, is the military. Men are on average stronger than women, which is a desirable trait in the military. In part the discrepancy is also due to historical prejudices still affecting it, but it's also in part because it's easier for men to pass the physicals.
Of course in reality there's more emphasis on stuff like nepotism. You're related to the owner, or your friend works there, or you both were in the same year at university...
Post by: EuchreJack on January 14, 2023, 06:58:16 pm
2nd Point of Order: We should generally refrain from forcing people to do anything in a free society.
Spoiler (click to show/hide)
Post by: Rolan7 on January 14, 2023, 07:07:26 pm
Quick question here.There are other reasons that potential signifiers of transness and homosexuality are concerning: eugenics.
Are we sure we want to start discussing brain development? If we are to acknowledge that the trans brain is different, doesn't that inherently mean that for some tasks, one might prefer a male brain, for others, a female, and for a third, trans? Plus at least another for the opposite trans, and whatever other genders come to the fore.
And if some brains are just better suited for certain tasks, why would it be wrong to discriminate against someone with am objectively less qualified brain? We do that all the time, right? People with test scores below a certain point are not eligible to be doctors or lawyers or engineers or rocket scientists, for example.
Is it really a good idea to stake out the position that it's perfectly reasonable and scientifically accurate to say, "The best person for this job is a man"? Or even, "Statisically, we should hire a man for this job as his brain is more likely the best for this purpose."
As someone with little faith in modern society, and as a lowkey gender-abolitionist who would be *proven fundamentally wrong* by gender having a biological basis, I still stand by whatever science finds. Things are true even when they're dangerous, and especially when they change minds.
I'm ready to change my mind. How else could I have used scientific data for so long in good conscience? It's both scary and exciting. There is something intensely relieving about finding out one is wrong: It indicates that one is still growing and rational.
And if new information is abused by the people executing their campaign of indirect extermination, well, that doesn't change the underlying truth.
Besides: It will always remain a true fact that I deserve to live, and that I'm happier this way. I know that from personal experience. I could be forced to remember things otherwise, and that's why conversion camps delende est
Post by: McTraveller on January 14, 2023, 07:10:35 pm
Given that now coercive effort is used for the "powerful" to get their way in addition to physical force, I think we're actually worse off, in that those doing the forcing now often no longer have to risk their own physical well-being to impose their will.
Post by: Rolan7 on January 14, 2023, 07:24:51 pm
Not to get all intersectional but if the 1910's were a lawless society based on individual pugilism then I think we would have seen a rebalance of wealth disparity.
Post by: Thorfinn on January 14, 2023, 08:22:11 pm
Don't we (theoretically) do that anyway?Sure, but we (theoretically) do it through evaluating the person rather than generalize by sex/race/whatever.
There are developmental differences but from my understanding there's no real difference in processing)That's the question. Whatever hypothetically happens in the brain development must have persistent effects, or that would not explain why trans is persistent. Without knowing what the development differences are, how could one say what else might be affected?
Like @Rolan7 says, eugenics is a serious consideration. Which is why I think its a bad idea to argue for genetic or developmental ties to trans. By definition, that would make trans more like a birth defect, something to be "cured". At least until contradictory evidence is in, it makes more sense to think of it as a choice, because at least in this respect, who is to say one choice is any better or worse than any other?
Post by: Frumple on January 14, 2023, 08:23:32 pm
Good example, although not neurological, is the military. Men are on average stronger than women, which is a desirable trait in the military.Pain resistance and cooperation are also desirable traits in the military, often moreso than physical strength in a modern army, and women on average have the advantage there.
Part of the myriad issues with that kind of reasoning is that people, in general, are often remarkably bad at actually identifying what heuristic is going to produce the best outcomes of a particular organization. You see it with all sorts of qualifying practices, from SATs and such, to physicals, to basic resume shit. There's ways to at-least-be-better at that sort of thing (that involves a lot of effort and second guessing and we're still not super good at it but still), but in general when the processes involved are applied to any sort of hiring/recruitment practice, they end up looking roughly fuck-all like the previous "best" practices, which are often enough found to have actually been shite :V
... anyway, tl;dr, we try to do that but like with driving and standing straight and all sorts of things we're generally not good at it, like actively bad holy shit how do we not die more kinda' dealio. Theoretically is a good way of putting it, very "understatement chic", heh.
Post by: Great Order on January 14, 2023, 08:30:27 pm
Post by: Strongpoint on January 14, 2023, 10:02:31 pm
Quote
And if some brains are just better suited for certain tasks, why would it be wrong to discriminate against someone with am objectively less qualified brain?
Does NBA discriminate against short people? No. The free market of NBA chooses individuals better suited for the task of playing basketball. And taller people are better suited for this on average but individual merit is the deciding factor.
Quote
Is it really a good idea to stake out the position that it's perfectly reasonable and scientifically accurate to say, "The best person for this job is a man"? Or even, "Statisically, we should hire a man for this job as his brain is more likely the best for this purpose."
We already have a large group of people who are objectively worse in most professions. - People with disabilities. But no, it doesn't mean that an employer can deny every person with a disability (ignoring their actual skills and abilities) and not be rightfully accused of discrimination.
Point of Order: It was the alleged inferiority of the female brain that was used to deny women the right to vote and the right to own property. So fuck that shit.[very sarcastic voice]
Yeah, we should not pursue knowledge and truth because people used to use unscientific biased "research" for discrimination (and some will still use and misrepresent whatever new data will be available)! Just forbid those unholy ideas of studying differences, ban them from science and eliminate any scientists who will dare to do any research on this unholy topic. [/very sarcastic voice]
Post by: KittyTac on January 15, 2023, 05:47:16 am
Post by: voliol on January 15, 2023, 06:42:57 am
I came out as bi to my mom and she was surprisingly fine with it. :D
Congrats! :)
Post by: Starver on January 15, 2023, 07:39:51 am
Possibly a more practical thing (not for the fleeting desires of society, but its longer term potential) is that if a male soldier dies, his contribution to posterity can be fulfilled equally well by any surviving male soldier at all. And, at least until it becomes a ridiculous amount, can double, triple or even far more his contributions by filling in for as many dead colleagues as are unable to return (or return 'intact') to fulfill their peace-time duties for the stay-at-home women of the nation who would be necessary to ensure that there's a future generation of the nation. And can even do their bit of non-military 'service' on a weekend pass or equivalent home-rotation. (Or, frankly, via any small container, properly handled.)Good example, although not neurological, is the military. Men are on average stronger than women, which is a desirable trait in the military.Pain resistance and cooperation are also desirable traits in the military, often moreso than physical strength in a modern army, and women on average have the advantage there.
Whereas, with an Amazon Army, each battlefield loss narrows the options for the then typically nine-month-and-more bottleneck on home-front replenishment[1] and that may not be a happy situation, before even considering the excess of men[2] with far less 'war-work' to do, away from the more direct slaughter. And so clearly a standing army is more practical (in the long run) to be all-male than all-female.
Which is not to say that a mixed-membership service is less optimal than your tried and tested female-barring versions, either, and (even prior to full Brave New World attainment) not all of those nine months need necessarily be fully excused from at least support roles. But it might suggest that a battalion or three of post-menopausal recruits could swing the advantage of a war, if it gets that desperate, with few disadvantages and possibly a number of additional advantages. (Assuming you can tactically coordinate the perhaps useful mood-swings, etc[4]...)
[1] I know there's more time needed than that, but anybody could technically take over from that point. With 'uncles' and 'aunts' being logistically just as interchangable with whatever parent(s) you divert back to the front. If not fully amortisable into one-to-many creche-'commanders' who then instill an age-hierarchy over their young charges to streamline and regiment the process of reaching battle- and/or birthing-age themself which it sounds like this hypothetical perpetually-at-conflict society is going to do anyway, right?
[2] Assuming somehow men aren't otherwise infrequently available, and valued highly for every bit of contributive effort they can be pursuaded to give back at the 'farm', as such a precious commodity[3] to the female part of the population that it is now they who have to go into the martial sphere rather than have the option of choosing a marital one.
[3] I say... is this because of something back in the mists of time, much much earlier on in this multi-generational war, that was unleashed upon the region (nay.. the world!), somehow targetting the Y-chromasomes in a devastating (and possibly uncontrollable) strike against the roughly-parity but disproportionately armed populations of the instigator's enemies? I really think we need to know! And, naturally, it managed to cross back to the very place that developed it, too. Because of course it would.
[4] j/k! ...in case that needs to be said about much of this post. Once into the speculative hyperbolae, certainly.
Post by: GadgetPatch on January 15, 2023, 10:55:06 am
I came out as bi to my mom and she was surprisingly fine with it. :D
You love to see it.
I remember coming out to my mom, and her side comment about how she wasn't that surprised; always sensed some kind of vibe from me, but couldn't place it. Ended up being much less scary than I thought.
Congrats, and glad it went well!
Post by: Great Order on January 15, 2023, 01:03:23 pm
I came out as bi to my mom and she was surprisingly fine with it. :DEyyyy, nice one.
Post by: Enemy post on January 15, 2023, 01:22:57 pm
I came out as bi to my mom and she was surprisingly fine with it. :D
That’s great!
Post by: Great Order on January 15, 2023, 10:39:51 pm
Brain's fucked.
Post by: Rolan7 on January 16, 2023, 11:58:49 am
El Goonish Shive: Reintroduces a character who made me cry in high school because of their trans experience
how did I forget about this? Well okay there was a lot going on in my home lives, and this wasn't *called* being trans, but wow
Character stuck in a terrifying monstrous shape all their life wakes up after transformation magic (https://www.egscomics.com/comic/2004-05-28)
It's just another dream... right? I'm going to wake up and be gross again (https://www.egscomics.com/comic/2004-05-31)
Everything changed. Which implied anything could change. (https://www.egscomics.com/comic/2004-06-13)
Please don't call me a woman, but I'm finally a human (https://www.egscomics.com/comic/2004-06-14)
I was never a man. I just didn't want to disappoint people (https://www.egscomics.com/comic/2004-06-18)
Creator commentary: The character was going to be fridged, but the author took pity on them by making them female (https://www.egscomics.com/comic/2004-07-09)
Fishnets-guy and the anthro are the characters siblings, and I find their reactions heartwarming and relatable to my own. Minus the underwear-poke, thankfully, it WAS a 2004 joke-a-day webcomic.
I'm running late but I need to dig up my favorite fics sometime, and also check out the ones Alway posted earlier! A long time ago she shared this great one about a NB Republic Commando and a sentient CIS fighter, but AO3 has a astonishing amount of "trans clone trooper" hits O_o and I really gotta run
Post by: Egan_BW on January 16, 2023, 12:05:33 pm
Post by: Rolan7 on January 16, 2023, 12:27:46 pm
Either way, just another of those magic gender-swap comics that I was strangely fascinated by ???
Post by: Thorfinn on January 16, 2023, 02:06:44 pm
Oh yeah, there's a reason I used theoretically in there. We're just kind of shit at being a meritocratic species.It's not as bad as you make it out to be.
If you hire your incompetent son-in-law, eventually your house in Mar-A-Lago gets raided. Sooner or later, sub-optimal choices always come back to bite you, and the worse the choice, the worse the bite, and, often, the sooner the bite.
BTW, I only inquired about whether brain differences was a path we really wanted to go down because of all the posts from people talking about how there those differences were real and resulted in expression of gay, trans, whatever. Largely by people who seemed ostensibly to be from the pro-trans side.
Quote from: Strongpoint
We already have a large group of people who are objectively worse in most professions. - People with disabilities. But no, it doesn't mean that an employer can deny every person with a disability (ignoring their actual skills and abilities) and not be rightfully accused of discrimination.But those are physical disabilities, and legislation was passed requiring businesses to make reasonable accommodation. To the best of my knowledge, that was only applied to a few mental disabilities, and only at the margins. For example, since climbing windmill towers and radio antennae is physically demanding, the business would not have to accommodate quadriplegics. Neither were they required to accommodate those with diagnosed suicidal tendencies, at least current ones.
Regardless, should we be be drawing on a precedent that relies on categorizing having a trans brain as being disabled?
Good point, Starver. I think a lot of it depends on how warfare develops. At the margin, a society which gets its females slaughtered is at a disadvantage. But imagine warfare as it evolves into 4th and 5th generation, where physical defenses mean at most defending a green zone, and most of the battle is fought by other means, whether terrorism, drones (another form of terrorism) or other less physically demanding tasks. I'm not sure that's a good way to force-evolve warfare, but it's pretty much unavoidable when you force-evolve the military into accommodating those less physically capable. Certainly we have no examples of Amazonian societies having been able to survive into modernity. Might there be in the future? Prediction is hard, especially about the future.
Post by: Vector on January 16, 2023, 02:21:37 pm
I get frustrated because the feminist criticizers think that there's this big gotcha. But whatever downstream effects there are are not known. You can assert that there are observed differences between cis female and cis male brains without also claiming that women are naturally and permanently worse, or "intended" for particular tasks. The first does not actually provide evidence for the second.
Post by: Strongpoint on January 16, 2023, 02:36:33 pm
Quote
But those are physical disabilities, and legislation was passed requiring businesses to make reasonable accommodation. To the best of my knowledge, that was only applied to a few mental disabilities, and only at the margins.It is not what I meant. With almost any job, people with certain disabilities will be worse (on average) but no sane employer will go for something like - "you know deaf people are on average worse at doing this job and I don't give an F about your actual skills. Go away.". Doing this will be outright discrimination.
It is like denying a woman a physical job even if she is far stronger than an average female, meets the requirements, and is no worse or even better than other available candidates.
Quote
Regardless, should we be be drawing on a precedent that relies on categorizing having a trans brain as being disabled?
Hey! Don't put words in my mouth. Especially something so... gross. I used disabilities as an example that even if we know that category X is (on average) worse at doing task Y, hiring not on the basis of the merit of an individual is still discrimination.
Post by: Thorfinn on January 16, 2023, 02:38:18 pm
But whatever downstream effects there are are not known. You can assert that there are observed differences between cis female and cis male brains without also claiming that women are naturally and permanently worse, or "intended" for particular tasks. The first does not actually provide evidence for the second.The flip side is also true. Since potential downstream effects are not known, there is no rational way to say whether membership in some arbitrary group does not make one better or worse at any given task.
The only way something this complex could be worked out is through experiment. If some arbitrary demographic is irrelevant to the task, then any company that "discriminates" is by definition hiring someone well less suited, which eventually shows up if it's a significant difference.
And we already do this to some extent. No one complains if a firm hires all women, or all Africans, or a handful of other cases, certainly including gay, and probably soon, trans. What is not permitted is to make a control group so we can test our hypotheses of whether brain differences also have cognitive or performance differences.
Post by: Thorfinn on January 16, 2023, 02:45:22 pm
Why the extreme emotional response to discrimination? By choosing to be with Mrs. Thorfinn, I discriminate against all other potential mates, male, female, furry, whatever. I'm dead certain we all do this. I don't know anyone who objects on general principle to people hanging out with people they like. Why in this case?QuoteBut those are physical disabilities, and legislation was passed requiring businesses to make reasonable accommodation. To the best of my knowledge, that was only applied to a few mental disabilities, and only at the margins.It is not what I meant. With almost any job, people with certain disabilities will be worse (on average) but no sane employer will go for something like - "you know deaf people are on average worse at doing this job and I don't give an F about your actual skills. Go away.". Doing this will be outright discrimination.
It is like denying a woman a physical job even if she is far stronger than an average female, meets the requirements, and is no worse or even better than other available candidates.QuoteRegardless, should we be be drawing on a precedent that relies on categorizing having a trans brain as being disabled?
Hey! Don't put words in my mouth. Especially something so... gross. I used disabilities as an example that even if we know that category X is (on average) worse at doing task Y, hiring not on the basis of the merit of an individual is still discrimination.
Post by: Strongpoint on January 16, 2023, 03:06:17 pm
Quote
Why the extreme emotional response to discrimination? By choosing to be with Mrs. Thorfinn, I discriminate against all other potential mates, male, female, furry, whatever.
You are using this word in a very loose way.
to discriminate
to treat a person or a particular group of people differently, especially in a worse way from the way in which you treat other people, because of their race, gender, sexuality, etc.:
Post by: Vector on January 16, 2023, 03:11:58 pm
Post by: Rolan7 on January 16, 2023, 03:17:57 pm
Post by: Maximum Spin on January 16, 2023, 03:56:48 pm
[thicker corpus collosum in women]I just want to say that this is heavily disputed (https://pubmed.ncbi.nlm.nih.gov/9353793/) and seems to be based on studies with a very low sample size, with the original analysis having an n of 14 (https://pubmed.ncbi.nlm.nih.gov/7089533/). Results since then have occasionally gone either way, and, while it's true that the largest study I know of (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3767965/) found a difference, their result on the full set of 316 subjects was only significant at an IMO inadequate P<0.03 level. I think it's best to characterize this difference as unclear.
While I'm on the subject, it's also my understanding that the previously mentioned findings of transgender individuals having brain anatomy consistent with the gender identity have generally failed to replicate (eg, this example (https://www.nature.com/articles/s41598-017-17563-z) also has a good review of the status of the field); it seems like the scientific consensus on the topic is currently weakly on the side of brains clustering mostly by assigned sex.
Post by: Thorfinn on January 16, 2023, 04:23:05 pm
No, I did that. I decided to exclude from the set of prospective Mrs. Thorfinns all people with male genitalia. I also excluded all over the age of 40, all who were already married, etc. During college, I chose to spend most of my time around other science and engineering types. Yes, I discriminated against all those who were matriculating at the cosmetology institute down the street.QuoteWhy the extreme emotional response to discrimination? By choosing to be with Mrs. Thorfinn, I discriminate against all other potential mates, male, female, furry, whatever.
You are using this word in a very loose way.
to discriminate
to treat a person or a particular group of people differently, especially in a worse way from the way in which you treat other people, because of their race, gender, sexuality, etc.:
At least I'm assuming that's how one would interpret things. If by "discriminating" I made some worse off because they did not have the pleasure of my company, well, and? Don't we all?
Vector, this isn't about some right to exist. I only read back a few pages, but it seemed if anything everyone was opposed to any eugenics or even conversion therapy. Please don't go overboard. You asserted that there were differences in brain, but we don't know whether or not that has downstream effects. Agreed. But that means we don't know whether there are downstream effects, not that we must assume there are none unless proven to some arbitrary standard.
BTW, I'm not saying there are morphological differences in the brain. I don't know, and, frankly, don't care. I'd much rather evaluate someone on his actual performance, not because of some alleged difference to which his demographics makes him more prone.
Post by: EuchreJack on January 16, 2023, 04:38:45 pm
Post by: Strongpoint on January 16, 2023, 09:43:17 pm
Sadly, it is a part of science in which too many people want confirmation for their preconceived notions, not the truth.
Post by: MorleyDev on January 16, 2023, 10:11:55 pm
a) Reduced to the minimum needed to produce a reproductive benefit.
b) Emergent in large groups but rather poor for understanding individuals who are still likely to run the whole gambit of human variation.
It's like, the average woman could be one standard deviation worse than the average man at throwing rocks but...well, that doesn't tell you much about how good I am at throwing rocks as an individual*. Which puts it more in the category of "huh, interesting" rather than any kind of modern societally defining information. And when working with a limited sample size of "people near you who you can find to throw some rocks", you wouldn't want to exclude all the woman on that basis either, since you're still gonna find a good chunk of higher-than average rock throwers. And outside of people who've spent their whole life pushing themselves to the far far end of that bell curve of rock throwing, it's probably not gonna be a very big difference in the size of the two groups.
* I'm very bad at it, my dominant arm is hyper-extended so an overarm throw tends to result in a pop-out.
---
Another issue with researching gender identity and brains I can see is that consciousness and self-perception isn't exactly something we've found a "spot" for in the brain as far as I know, it's appears to be one of those 'emergent propeties' where it's just a result of a bunch of unrelated stuff happening to mix together in a way that produces it. So even if there is something in the structure that creates that mixing that produces a perception of oneself as a different gender to their biological sex, it's not like that's something you can point at in the brain and say "it's this". So whilst discussing the potential for a link is philosophically interesting and may be an exploratory method to help 'confused' cisgendered people get that foot into 'groking' it by bringing up the potential (so long as framed to not lead to the 'problem to be fixed' misconclusion), it's not exactly easy to research beyond "huh there's this statistical correlation but it's not a guaranteed thing" which...again, falls into the "huh interesting" category of facts.
Statistics are hard, large scale emergent properties are useless to individuals, you'll never know if anybody but you is truly conscious, and we all die cold and alone. At least that's what I tell myself every night :D
Post by: MaxTheFox on January 16, 2023, 10:47:12 pm
Post by: Great Order on January 16, 2023, 10:59:34 pm
Post by: GadgetPatch on January 16, 2023, 11:00:57 pm
Spoiler: EDIT: This is mostly just saying the same thing again. (click to show/hide)
I'm fascinated by the behavioral biology of sex and attraction, and all the beautiful little intricacies that help make us Us. But there's queer folk trying to celebrate their experiences and joys here, that are being talked past. And that seems like a shame.
Post by: MorleyDev on January 16, 2023, 11:07:46 pm
Plus Sister having had a child has shut down the "but I want graaandchiiildddreen" from my mother. So that's nice. Because...no, not happening. Eww. Still get the occassional "but you'd be such a good father" or "maybe you'll meet someone with kids!" but like...I like being an Uncle. You get to give him back. Can't do that with your own kid...
(Well I guess technically you can but... xD)
Post by: GadgetPatch on January 16, 2023, 11:29:16 pm
I'll never be able to get my head around what people mean when they say something or someone is hot, though. I get it, intellectually, but I don't *GET* it. Beep boop, does not compute. Like I've got a sense missing!
Post by: Great Order on January 16, 2023, 11:47:24 pm
I apparently count as queer according to some because I'm asexual, so my queer experience is mostly defined by a lack of experience xD Cuddling is fucking awesome though.Ha, I resolved the grandkids issue by spending the last 7 years saying I don't want kids. Not ace in any way, I just value my free time and general freedom to do things. Having a kid pins you down for a minimum of 18 years. On top of that, I've got mental health issues that I don't want to pass on and that'd make me poorly suited to being a parent. You can't just have a depressed mope for a month or two when you're someone's primary carer.
Plus Sister having had a child has shut down the "but I want graaandchiiildddreen" from my mother. So that's nice. Because...no, not happening. Eww. Still get the occassional "but you'd be such a good father" or "maybe you'll meet someone with kids!" but like...I like being an Uncle. You get to give him back. Can't do that with your own kid...
(Well I guess technically you can but... xD)
With regards to ace being part of the LGBTQ+ thing, yup. Pretty much anything outside the cishet norm falls under the umbrella.
Post by: Vector on January 17, 2023, 01:13:42 am
I don't want to do it, as I kind of expect that this is going to be the beginning of my being gently shoved out the door. But as my mom said, I need to work on my mental health and play the game of life more aggressively. God knows I know how to play hardball. It's practically a condition of being a union organizer. But she told me to play hardball about resting and playing, and let forcing me out of the school be a task for my enemies, not for me.
(My mom's still an asshole by the way, but she spent today talking to me for an hour about me and only me, and this is practically the first time I can remember her ever doing that in the entire time I've been alive and, you know, older than 2.)
--
I briefly identified on the ace spectrum but I'm kind of convinced now that it's less about some kind of built in wiring and more about having a vanishingly small dating pool.
Post by: EuchreJack on January 17, 2023, 12:16:53 pm
I'm going to have to come out to my advisor as part of explaining why the likelihood of my getting a job at an R1 university or, frankly, any other university, is practically nil these days, because he's been asking me about my career interests.I don't think you have to say anything if you don't want to say anything.
I don't want to do it, as I kind of expect that this is going to be the beginning of my being gently shoved out the door. But as my mom said, I need to work on my mental health and play the game of life more aggressively. God knows I know how to play hardball. It's practically a condition of being a union organizer. But she told me to play hardball about resting and playing, and let forcing me out of the school be a task for my enemies, not for me.
(My mom's still an asshole by the way, but she spent today talking to me for an hour about me and only me, and this is practically the first time I can remember her ever doing that in the entire time I've been alive and, you know, older than 2.)
--
I briefly identified on the ace spectrum but I'm kind of convinced now that it's less about some kind of built in wiring and more about having a vanishingly small dating pool.
Ideally, your advisor wants you to be successful, and would prefer that you don't limit yourself.
Hell, I've done tons of stuff that some might have said that I had "nil chance of success at".
In the event you get the question "why haven't you moved on somewhere else", you can always look them straight in the eye and say "I like it here", smile broadly, and watch your advisor unfold before you.
EDIT: Remember, someone has to be the Pioneer.
Post by: Great Order on January 19, 2023, 10:40:08 pm
A) Aren't thong-shaped
B) Aren't expensive as hell (Seriously, the cheapest non-thong gaff I can find is £37 *per pair*
C) Can be got in the UK
?
I'm not a fan of the thong type because it's like walking with a permanent wedgie.
Post by: Vector on January 20, 2023, 12:07:16 am
Post by: Great Order on January 20, 2023, 04:45:16 pm
In other news, deed poll's done. Signed by everyone who needs to sign it.
Every time I get another thing done it makes me feel way better. It's like I've been carrying around a load of tension, but it's been there so long I've not even realised it.
EDIT: Damn, £28 per pair. And that's cheaper than than the other non-thong pairs I've seen.
Well, needs must.
Post by: Rolan7 on January 20, 2023, 09:01:26 pm
What I do absolutely love is my sports bra. Technically plural, but my other one is too tight on the band :( This one feels so perfect I hate to take it off. It provides support and keeps my chest from being uh, visible, which is almost always how I prefer to look. I do like having them though.
I'm even occasionally thinking about progesterone (I have another appointment in a couple weeks) but I don't think so. I might honestly be happiest as I am! Particularly with whatever growth is still coming- I'm only 9 months in, and I think technically at C.
Post by: Great Order on January 22, 2023, 10:31:00 pm
Anyway, seems that all the tucking undies are sold out in my size. Bit of a pain in the arse.
Post by: Loud Whispers on January 24, 2023, 09:46:57 am
Post by: Great Order on January 26, 2023, 06:46:23 am
No pun intendedOh no, I made a gaffe!
Post by: Loud Whispers on January 27, 2023, 08:19:51 am
Post by: Great Order on January 27, 2023, 07:19:33 pm
I'm feeling a lot better about myself. Not like my mood's better, I'm just a lot more content being me. I think it might be just knowing that things are happening, even if there's no actual changes yet, along with me almost fully socially transitioning.
Post by: Iris on January 28, 2023, 02:43:25 am
Post by: Rolan7 on January 28, 2023, 03:18:59 am
Post by: Great Order on January 28, 2023, 12:37:00 pm
I've now spent over £100 on FOUR PAIRS. I could get cheaper ones but they're all the thong type which, as mentioned, are a no-no. I assume it's some economy of scale thing, there's not a lot of demand for them so there's no real reason to make a dedicated factory to them.
Post by: Loud Whispers on January 28, 2023, 02:13:16 pm
heyyyy guys it's ya girl Iris here, what'd I miss?Nothing much, except half of the lower boards being eggs apparently
Post by: Iris on January 28, 2023, 02:19:57 pm
heyyyy guys it's ya girl Iris here, what'd I miss?Nothing much, except half of the lower boards being eggs apparently
Considering the demographic likely to be attracted to an online DF community, that isn't even surprising.
Post by: Imic on January 29, 2023, 01:08:04 pm
Like
Brain do you understand the implications of that or are you just gonna remain clueless lol
Post by: Iris on January 29, 2023, 03:28:00 pm
Post by: Great Order on January 29, 2023, 04:12:30 pm
Post by: Grim Portent on January 29, 2023, 04:46:40 pm
I caught myself thinking the words "I wish I was nonbinary"
Like
Brain do you understand the implications of that or are you just gonna remain clueless lol
Might be worth exploring the thought further, if the idea actually interests you.
Oh yeah, the "Hang on, most men don't want to be women?" realisation was interesting.
I think in nearly 30 years of life, admittedly the first few not being all that complex in terms of thought, I've never wanted to be a girl/woman. I've idly wondered what it's like to be a woman compared to man somewhere under 10 times, mostly as part of discussions about the problems, physical and cultural, women face compared to me which in turn makes me think about the whole alien nature of specific human minds, but that's no more wanting to be a woman than I want to be a cuttlefish.
In a sense, I am a fairly typical specimen of a cis-man. Pretty much no interest in my feminine side, or any issues with my self perception as it relates to my gender and sex. Slightly camp at times, but that's a whole other thing.
Not sure it means everyone who questions their gender at times is necessarily not cis-gender, but it's certainly an indicator.
It can be weird sometimes, to think about how much our minds can differ.
Post by: Great Order on January 29, 2023, 04:49:43 pm
EDIT: Also, it looks like JK Rowling has finally abandoned all pretense of her transphobia being to protect women and has fully embraced the "All trans women are paedophile rapists" style of TERFism. I can't say I'm surprised, and in fact I'm more surprised it took this long, but it's definitely no good having the rich author of something important to so many people in my generation be like this.
Post by: MrRoboto75 on January 29, 2023, 06:59:19 pm
Wondering about it's a fairly standard thing from my understanding. The general difference is that someone who's trans would very likely press a button that swapped their sex, but someone who's cis would only press it if it was temporary or reversible if they would at all.
Frankly I concluded I'd be equally unhappy as either gender.
Post by: Starver on January 29, 2023, 07:11:45 pm
EDIT: Also, it looks like JK Rowling has finally abandoned all pretense of her transphobia being to protect women and has fully embraced the "All trans women are paedophile rapists" style of TERFism. I can't say I'm surprised, and in fact I'm more surprised it took this long, but it's definitely no good having the rich author of something important to so many people in my generation be like this.(I have made no bones of stating that her literary work is derivative, and just somehow caught a populist zeitgeist. But this isn't where I go on about that.)
I haven't heard her current views, but I suppose it's all from the recent issues of the trans-woman convicted of raping women when a man, here in Scotland. The moment I heard of the case's developments, though, I knew it'd be fashioned into a stick to beat the entirety of some people's least-favourite minority...
Post by: Iris on January 30, 2023, 01:01:49 am
Post by: alway on January 30, 2023, 08:00:45 am
Post by: Rockeater on January 30, 2023, 08:29:01 am
To be honest, the worst part of being trans is that everyone things that the fact you are trans is a Big Fucking Deal and not something entirely out of your control.That partily the reason I am not sure about calling myself trans in a sense, for most of the trans people I know irl being trans at least at some point had a very large impact on their life, for me it's sort of like "I don't feel gender as a particular anything, staying with man just seems kinda convenient at some point"
Maybe it's because I only come out to lgbt+ people, but idk, I feel like I am not sure about something.
Post by: Doomblade187 on January 30, 2023, 08:09:29 pm
I have a few friends like this. It's completely fine to not have a preference about gender, and picking one/coming out to everyone is overrated. Just be yourself and do what makes you happy.To be honest, the worst part of being trans is that everyone things that the fact you are trans is a Big Fucking Deal and not something entirely out of your control.That partily the reason I am not sure about calling myself trans in a sense, for most of the trans people I know irl being trans at least at some point had a very large impact on their life, for me it's sort of like "I don't feel gender as a particular anything, staying with man just seems kinda convenient at some point"
Maybe it's because I only come out to lgbt+ people, but idk, I feel like I am not sure about something.
A tangential label that stuck with me a while was "Gender Casual". (source: https://www.egscomics.com/comic/party-134 )
Post by: Loud Whispers on January 31, 2023, 11:55:23 am
BY THE POWER OF PURCHASING (https://www.youtube.com/watch?v=UBftW7FzOVI)EDIT: Also, it looks like JK Rowling has finally abandoned all pretense of her transphobia being to protect women and has fully embraced the "All trans women are paedophile rapists" style of TERFism. I can't say I'm surprised, and in fact I'm more surprised it took this long, but it's definitely no good having the rich author of something important to so many people in my generation be like this.(I have made no bones of stating that her literary work is derivative, and just somehow caught a populist zeitgeist. But this isn't where I go on about that.)
Post by: TD1 on January 31, 2023, 03:05:16 pm
I watched that video then opened facebook. A post from The Royal Mint (sponsored): 'Celebrate 25 years of the publication of Harry Potter and the Philosopher's Stone with a coin featuring the Hogwart's Express!'
Post by: voliol on January 31, 2023, 05:01:39 pm
What kind of answers would you get if you asked the bookstore manager who chose to put her book out front in the Christmas season? Or that other, separate bookstore manager who did the same. Or the employees who went along with it. At some level everyone is doing their job, and at least here (Sweden) I'm sure many people - out of a culture of compulsory goodness - would claim to have no hatred in them. But then a whole group of people are made an affordable loss, consistently. It turns out there's a whole lot of transphobia out there, and it is in the hearts of people, at times subtle, yet festering.
Let's hope, or see to, that that will change. And I'm sorry if my insight was too obvious.
Post by: Loud Whispers on February 01, 2023, 05:48:26 pm
So the irony here is too much not to comment on.Oh boy I can't wait to consoom
I watched that video then opened facebook. A post from The Royal Mint (sponsored): 'Celebrate 25 years of the publication of Harry Potter and the Philosopher's Stone with a coin featuring the Hogwart's Express!'
t. 25 year old consoomer
Yeah it's kind of incredible slash disturbing how much her media is still all around considering how she is as a person. It's this sort of strange thing where I'm sure most people are not as rampantly transphobic as she is, yet as they turn a blind eye towards it it's hard to deny that they are still transphobic. Or simply do not know.It's just too much of a cash cow for corpos to give a shit. You can see the cynical pivot to make "Harry Potter without Harry Potter" so they can continue to milk the Harry Potter fanbase without having to deal with any extant links with J.K. Rowling (besides paying her fat bags of money every six months)
What kind of answers would you get if you asked the bookstore manager who chose to put her book out front in the Christmas season? Or that other, separate bookstore manager who did the same. Or the employees who went along with it. At some level everyone is doing their job, and at least here (Sweden) I'm sure many people - out of a culture of compulsory goodness - would claim to have no hatred in them. But then a whole group of people are made an affordable loss, consistently. It turns out there's a whole lot of transphobia out there, and it is in the hearts of people, at times subtle, yet festering.
Let's hope, or see to, that that will change. And I'm sorry if my insight was too obvious.
Post by: MrRoboto75 on February 01, 2023, 06:35:45 pm
Post by: EuchreJack on February 02, 2023, 04:22:20 am
My childhood was during the Michael Jackson era. Great performer, awesome music. Less said about him personally, the better.
Do NOT do a deep dive on Jim Carey. You won't be happy.
Ultimately, it's best to separate the work from the people.
Post by: TD1 on February 02, 2023, 05:22:50 am
Determine textual meaning without relying on reference to its creator.
I haven't really kept up to date on Rowling's comments, but... I don't see any discrimination? Although, to quote the actor who played Hagrid:
“I don’t want to get involved in all of that because of all the hate mail and all that shit, which I don’t need at my time of life.”
Heh.
Post by: EuchreJack on February 02, 2023, 06:12:03 am
EDIT: Oh wait, the second one was a body double and younger depiction. Oh well
It IS scary how much influence Rowling has, and I tend to suspect it probably is being mobilized against the LGBTQ community.
Basically the 21st century Walt Disney.
Post by: Imic on February 02, 2023, 08:28:38 am
Post by: TD1 on February 02, 2023, 08:52:54 am
But if he were born into our era? He was outspoken in defense of Jews and racial minorities in his own time. I'd give good odds on him supporting the right to self-expression. Also keep in mind that he was first and foremost an academic who seemed to love Oxford University. Even were he inclined to be a 'raging transphobe,' good career-sense might direct him down a more moderate path.
Post by: Loud Whispers on February 02, 2023, 04:44:50 pm
Spoiler (click to show/hide)
Post by: Great Order on February 02, 2023, 06:06:51 pm
Spoiler (click to show/hide)
Shocking absolutely no one, Jordan Peterson wishes to have trans people eliminated.
Wonder how the fans are going to spin this into him not being a bigot.
Post by: Rolan7 on February 02, 2023, 07:00:50 pm
But also yeah Trump's calling for trans elimination.
Spoiler: Content Warning on what exactly I mean by that (click to show/hide)
in conclusion, I hope I misunderstood the "we can't share fics here" thing. because I feel like reading some
Post by: Frumple on February 02, 2023, 07:17:58 pm
I haven't really kept up to date on Rowling's comments, but... I don't see any discrimination?She's been regularly spewing and boosting TERF shit over on twitter, and publicly palling around with virulent transphobes, just as an easy starting point.
Like, there's problems with her writing on the discrimination front, too, but so far as more recent stuff goes, it's been her public/social media comments that have been not exactly covering her in glory. I've been mostly avoiding exposure 'cause I don't need that shit in my life, but it hasn't been particularly subtle.
Post by: Great Order on February 03, 2023, 05:29:49 am
Seen a good chunk of people on a UK subreddit genuinely arguing that JKR isn't transphobic. She's actually inclusive of trans people, it's just that she's really combative about her views.
EDIT: And her tweet saying that being told to stop being a TERF is the same as demeaning Suffragettes has been defended. The logic being that no, she's not saying that, she's comparing misogyny to misogyny. Nothing to do with transphobia at all.
Y'know, never mind that being a TERF, in its current incarnation (Where it's basically saying you're a liberal transphobe rather than conservative) is neither exclusively directed at women nor does it exclusively come from misogynists.
Blugh, hate that my mere existence is enough of an issue for people to not only get upset at it, but defend people who get upset at it.
Post by: TD1 on February 03, 2023, 08:17:14 am
I haven't really kept up to date on Rowling's comments, but... I don't see any discrimination?She's been regularly spewing and boosting TERF shit over on twitter, and publicly palling around with virulent transphobes, just as an easy starting point.
Like, there's problems with her writing on the discrimination front, too, but so far as more recent stuff goes, it's been her public/social media comments that have been not exactly covering her in glory. I've been mostly avoiding exposure 'cause I don't need that shit in my life, but it hasn't been particularly subtle.
Take your word for it! I just read through her original essay (and boiled it down to help me parse it: see spoiler, keep in mind this is VERY boiled down)
Spoiler (click to show/hide)
The general gist seems to be 'stop calling me and my fellows radicals, I have valid concerns about the youth's health and women's rights, but respect and empathise with those who've transitioned. Stop intimidating me.'
Note: Not making a point, just decided to procrastinate on work by reading essays not relevant to my dissertation :'(
Post by: Starver on February 03, 2023, 09:57:38 am
1) "Render unto Caesar the things which are Caesar's" - For all things where chromasomal (presumably) sex is important, like the different actions of diseases or the far-above mention of trans-men looking to solve issues with their original female innards, this should be as much a medical consideration as with someone having dextrocardia and/or situs inversus in a scenario where this matters.
What's more, there will be unknowingly intersex individuals who developed (externally, at the very least) in one manner despite having the chromasomes (and possibly other biochemical elements) of the other who might benefit from 'trans-aware medicine' as and when anyone bothers to find out.
I see no difference between the socially and surgically transitioned, developmentally flipped or even chimeric individuals, they all deserve the right application of the right treatment for the right aspect of any condition as it applies to them. That's no reason to decry transitioning, as it would still leave a significant number of non-transitioned people susceptible to undue assumptions and a reduced ability to identify and cater for such edge cases.
2) "Opening female spaces to all men..." is an undeserved wedge argument. I wonder how many predatory females have totally unfettered access to other (vulnerable) females, and all without the need to overcome stigma, various hurdles that even advanced M2F transitioners have to overcome and definitely under the radar compared to any bad-faith individual who tries to exploit access loopholes. (Never mind men who just find ways to hang around such female spaces as men, like countless creepy types always used to have to do...)
What protects young girls from predatory 'pseudo-trans' individuals? Well, everything that protects them from all other threats, plus additional mitigations born out of prejudices that I don't see going away.
Meanwhile, the still small minority of trans-women are being asked to make 'their space' be in the men-only spaces, vulnerable to the copious male-on-male type predators and transphobic+homophobic male-on-female types who may consider this an opportunity to physically or even (within the bounds of their own twisted version of personal 'no homo' convictions) sexually abuse.
At the very least, the sufficiently passing trans-woman could be mistakenly assumed to be a woman with precocious thrills for going into male facilities, giving 'normal' men the impression of something quite different, then they suffer from retaliation from either being a 'cock-tease' or a 'sissy', depending upon how far the encounter goes. Possibly both, by the reduced degree of logic that ends up being employed by the increasibgly confused antagonist.
Which is why I (cis-male, no real experience at the sharper end of either transitionary or feminist issues but hopefully would be accepted as a considerate ally of both sides, if allowed to be) think that the hyper-reductionist feminism version is particularly bad. As would be a given form of trans-militancy, but we're really not so much in danger of so many people suffering from the latter, on balance. To sum up my (admitedly unqualified) standpoint.
Post by: Iris on February 03, 2023, 02:12:27 pm
Post by: Rolan7 on February 03, 2023, 03:10:24 pm
On a more positive note I've storyboarded some comics I might mspaint up at some point.
And also I'm going makeup shopping rn
Post by: Great Order on February 04, 2023, 06:59:51 pm
Me left nipple's aching when I press it in now, but there's no bud as far as I can tell. This normal beginning-of-breast-growth, or have I just gone and prodded it so much it's got sore?
Post by: Imic on February 04, 2023, 07:35:37 pm
Post by: Loud Whispers on February 05, 2023, 06:34:02 am
Question for yes who have gone the "Grow boobs" side of thing:Both are possible
Me left nipple's aching when I press it in now, but there's no bud as far as I can tell. This normal beginning-of-breast-growth, or have I just gone and prodded it so much it's got sore?
The issue with politics is that you can't live with it but you can't live without it. Ya gotta know what's happening to keep yourself and those close to you safe, but you gotta stay away from it cause in the grand scheme of things there's only so much one person can do about it all. It's true that This Too Shall Pass, but it's very easy to say that when you're not living through a major historical event.Yah even if you care not for politics, politics has a way for caring about you. But also it is true that getting over engrossed in politics can just poison people's mindsets. I tend to strike a middle ground of focusing on the kinds of politics I can actually influence in some way, or at least the kinds of politics that actually has a point (e.g. I don't give a fuck about people debating Prince Harry but will vociferously defend NHS strikers)
Post by: Rolan7 on February 06, 2023, 08:52:57 pm
The mall assistant would have helped me get the proper shade, though. I went slightly too light because my family keeps insisting I'm ivory-white. It's pretty close though, aside from my rosy cheeks. Close enough to be helpful. I like it.
Pink "rose" lipstick was a mistake lol (for now). I was going for something subtle (lip-colored) and missed hard. I think red would have worked better. Interesting, though.
Next is my eyes. I got a little variety pack of shadows for Halloween but I didn't try them. Now with foundation I'm ready to experiment with them, but not right now. Seeing my dad tomorrow and I *know* my first attempts are going to be... garish. Not the stealth I'm looking for. I'm pretty excited though!
I paid $10 for 100 double blades for the awesome razor my partner got me, so now I can stop torturing myself by reusing them so much! Cheaper than I thought. I got Shark brand because I liked them best out of the sampler pack. OH RIGHT I was gonna order a plush... ehh. I'll adopt something from a thrift store. I want something special (not that my partner's Blahaj isn't special!)
Post by: Starver on February 07, 2023, 01:41:28 am
The rest is social-aesthetics. Both for your exact choice of cutter and of how much/what you then decide to cut!
Spoiler: Extensive fetenete, might not be worth reading! (click to show/hide)
Post by: alway on February 09, 2023, 09:27:16 am
Question for yes who have gone the "Grow boobs" side of thing:Sounds like about the normal amount of weirdness to expect, yeah. There's a lot going on there, so expect soreness to just sorta come and go from time to time.
Me left nipple's aching when I press it in now, but there's no bud as far as I can tell. This normal beginning-of-breast-growth, or have I just gone and prodded it so much it's got sore?
Post by: Great Order on February 24, 2023, 05:41:29 pm
Mentioned the whole left nipple being sore, still is (A bit like a bruise in terms of feel), but I'm pretty sure I can feel something a little more solid under it now.
Post by: Egan_BW on February 24, 2023, 09:01:38 pm
Post by: MrRoboto75 on February 24, 2023, 09:49:16 pm
Post by: scriver on February 25, 2023, 10:27:08 am
Post by: Rolan7 on February 25, 2023, 11:04:21 am
tldr; cis guys get breast reduction easily but don't talk about it, trans guys have to fight for it.
Congrats GO!! That sounds on-track, maybe a little early so they may get more tender yet. Pretty sure they don't hurt unless poked/bumped. Make sure you're eating plenty, the metabolism really goes into overdrive. I keep wanting to give advice but I'm no expert and your own research is probably fresher anyway... I just really liked that period where the buds were growing, because the soreness was proof/reminder that the process was working. The human body is amazing.
The soreness goes away after enough months but the growth continues. Gradually, as you know, but yeah.
Last week, after a week on progesterone, I noticed a new soreness. Much more localized. Not nearly as painful as my endocrinologist seemed to expect, heh, but maybe it gets stronger. I guess I'm working on areola shape, which I don't have strong feelings about other than general transhuman fascination!
The mood effects have been more interesting (though confused by having pneumonia). Speaking of...
I'm trying she/they out a few places. I think I like it, though my gender is still quite fluid (far cry from the agender I was for years).
I had another dream about my alternate gender-affirmed childhood, that was nice. My NB partner was in it, and we hung out in an Escher-house and my dad embarrassed me (in a good way) by saying how cute we were together, which got me to formally ask my partner out on a date instead of mutually pretending to only be friends, so that was... gosh.
Partner was masc-leaning NB, I was femme-leaning NB, we messed with old computers and youtube and musical instruments. Nice blend of our interests.
Post by: None on February 25, 2023, 11:40:39 am
Very happy for you, very cool that body does cool things when provided hormones. I'd like to make an "it's plug & play gender" joke, but I fear that might also be a) a woeful oversimplification and b) also crude and insensitive, and I don't personally know any enby/transfolk, so I don't have a good read for the community's sense of humor. Will accept recommendations and/or browbeating.
Unrelated- like half of my friends are bisexual with ADHD and most of the friends they collect are also bisexual with ADHD, as four of us acknowledged in our travel vacation. There's a nonzero chance I may be one of them, but I'm not really brave enough to find out firsthand. It's also, I dunno, a lot easier to flirt at the men in my life because there's no consequence behind it? I dunno, they deserve some flattery and it's fun to oblige that. Almost related to that - I've been told I'm good at making platonic friendships, which is a peculiar thing to hear when you assume that's the default state of friendship.
Post by: voliol on February 25, 2023, 12:41:29 pm
None, if you feel the hots for both men and women then you could probably fit into some kind of bisexual label. It can be hard to place oneself on the Kinsey scale and such, but in any case there is no need to interact with other's bi-ly to be bi. It just comes down to your own attractions. Just like gay people don't need to date to be gay, nor do straight people to be straight. :)
Plus there's a (many?) -romatic dimension on top of the -sexual one, so the netheral hots and don't need to line up with the candle-lit dinner or flirting hots. I've personally felt more or less inclined to date women or men (or enbies, though the ones I know IRL have been very few) during periods... I dunno what I was trying to make of that, maybe: don't make too much of what label you fit into, and do what you feel like. Which can be either "nothing", or something more.
Post by: Great Order on February 25, 2023, 01:45:46 pm
Quote
Very happy for you, very cool that body does cool things when provided hormones. I'd like to make an "it's plug & play gender" joke, but I fear that might also be a) a woeful oversimplification and b) also crude and insensitive, and I don't personally know any enby/transfolk, so I don't have a good read for the community's sense of humor. Will accept recommendations and/or browbeating.
I'll have you know it's not plug and play.
That'd be boofing pills.
Post by: Rolan7 on February 25, 2023, 02:57:56 pm
Look. One friend said it didn't make a difference at all, and I believe she believes that. But another friend claimed it was 10x more effective according to some study I didn't check.
I decided to
To be clear: I'm talking about progesterone. Do NOT boof hard-packed "chalky" pills such as estradiol, that doesn't help (and probably isn't healthy). Such pills should be absorbed sublingually rather than swallowed, though, which ALSO bypasses the liver.
So yeah, there's obviously lots of humor in trans culture... Some of it's actually funny unlike the above ';D
I highly recommend allies hang out in trans spaces and participate! ...Carefully, of course, but still.
Because like, I talk a big game about transhumanism but I've also been struggling with an annoying fear that progesterone might "change my gender". I keep overthinking things and it gets really complicated, and the idea of introducing a new med had me really questioning the nature of mind/body/soul etc... I joke, but I'm also serious.
So a joke along that line didn't bother me! Mostly because I've already heavily interrogated that moral quandary and came to a satisfying conclusion. It truly didn't bother me, and it's important that someone so respectful gets to participate and have fun with trans culture.
I'm spiralling a little (a little?). The point is... wait, let me find a recent quote that helped me with these intrusive doubts:
Quote
okay that was not NEARLY as recent as I thought O_oI refuse to "become" a woman via HRT, that's stupid anime BS. The true me is something I found through intense meditation and, primarily, dreams. I may be genderfluid, but I don't think I'm binary. I refuse to let hormones change me. They only let me unlock my true potential. I love my body, and I guide my body. It mustn't guide me.
If it turns out that you're a trans woman who prefers men, it won't make you any less queer. Many people have taken this journey with highly variable results. The outcome can't really be predicted in its concrete details, nor controlled.
Still very helpful though.
I am a genderfluid trans woman who prefers masc people. I prefer They/them or she/her, though I still don't mind any/all.
except from people who ought to know me. I have thick skin but I let people in.
I love being gender non-conforming, which happens to mean I'm not betraying all those years of being NB. Yay!
I keep thinking "I can't be a woman, I like having pockets/strength/androgyny" which is just misogyny. Straight-up misogyny. I am Samus [suit], Sheik, an oni. I am a shapechanger, I had to be. I had no identity for so long, so very long. Just a mask...
But there WAS something underneath. I did have an identity, I just couldn't... I had so much else to do first. Whenever I was exhausted by life I would make a promise to myself, and I don't remember what it was. I don't think I even knew, I think it was unspecific. Something I couldn't afford to think about. It's almost like I was... paving the way for someone else. A real me?
But who can say how much of that is rationalization.
Anyway...
I am extremely het and I don't think that's just internalized homophobia. I'm just not attracted to high-femme people and that's fine, I get along with them great. They're wonderful. All gender expression is wonderful, NB and binary. i just like the NB or masc more in that way <3
Estradiol didn't make me a woman. I never even worried about that, oddly. I gave it a try, and WOW I needed it like water.
Progesterone... isn't making me a woman either. This is always what I wanted. I'm just a bit less reserved about it. My body is catching up with my soul, and my mind is reeling that I can finally think the thoughts which I couldn't bear to think. Those buried hopes and dreams.
Post by: Vector on March 01, 2023, 05:12:14 pm
In another common trans experience, I'm personally spiraling and I wish I was dead. Yay <3 Also I'm about to come out to my advisor in my PhD program as nonbinary, yay! And militias are active in our area, yay! And businesses are taking down their pride flags, yay!!
Having some medical issues I think. I'm having nonstop migraines. I don't know what to fucking do.
Post by: Vector on March 01, 2023, 09:40:00 pm
Post by: alway on March 02, 2023, 12:37:51 am
Post by: Egan_BW on March 02, 2023, 03:00:25 am
Well, I asked my closest family to please update their usage of pronouns in regard to me, and they said sure.
And I got a little praise which doesn't feel entirely earned, if I'm being honest. It's just a simple thing.
Post by: Loud Whispers on March 02, 2023, 10:42:26 am
Post by: Starver on March 02, 2023, 12:07:50 pm
It's a further step, again, to be presented with an actual and unhypothetical person and to be asked to not at all presume 'their' gender (in a binary manner) based upon however they present. (Correctly or not. And I imagine there's also that frisson of being definitively addressed by the assumed gender, if one is trying to fully pass rather than aiming for ambiguity or contrarianism.) Not everyone will get their head around this.
I would say that anybody can ask for the use of any pronouns they want, and I'm happy to honour them under normal circumstances. But you can't always expect me to know (or remember) what you prefer if you don't give me something like a pronoun-badge clue. Honestly, I'm terrible with names/faces, and tying them to relevent biographies. If I get it wrong, in anybody's particular case, then I'm more likely just being faceblind/unobservant/forgetful/oblivious, than positively resistant to your wishes.
(Yet once you start gravitating towards "xir"-type constructions, you have to acknowledge that you're going beyond a planned ambiguity and are now possibly trying to actively ellicit a reaction amongst the less enlightened/flexible. Or attempting some form of transhumanism. - I don't say you can't, of course. And maybe if the choice is particularly distinctive then perhaps it'll be more memorable, even for me. Yay!)
Post by: Rolan7 on March 02, 2023, 01:08:31 pm
Quote
If people haven't seen this (https://twitter.com/Azure_Husky/status/1420177933826732034) microfiction yet somehow, it's sweet.This is really something. (I was checking my posts to analyze my journey)
I was already tearing up reading the thread, and I mean literally. There's a lot of pain there, along with the hope. (Plus I have appropriate emotional responses these days)
But I stopped and cried and came here to post, before the end. I'm surprised nobody replied to that tweet.
It's the one where
Spoiler (click to show/hide)
I'm going to take some time and absorb that as a conclusion.
Post by: Frumple on March 02, 2023, 01:39:20 pm
Also what the hell's up with the they/them "controversy?" I swear to God when I grew up we were all taught that you could use they to refer to people, and this was way before gender politics was in the public awareness or on educational syllabi. But then when it did come up, people were saying there's no they/them for people, only he/she. Witnessing this harsh reaction over what had seemed obvious and uncontroversial for ages felt like how I imagine the early-modern Christians felt seeing the rise of creationists taking the OT literally in response to archaeology and natural selectionIt's been approximately 99% bigots being assholes with everyone with sense telling them (to fuck) off, and little to nothing else (about the only exception is with some trans folk who strongly prefer to be called their preferred gender, and that is an even smaller minority of a small minority of the population; the 99% is probably not substantive hyperbole).
They as a singular pronoun has been uncontroversial usage in english for longer than there's been a united states, it's something like five or six hundred years old at a minimum, and flowed just fine in more modern writing. It didn't get jumped on as an issue until usage ticked up a bit as an effective gender neutral pronoun and some colossal fuckwits decided it was a good thing to use as fuel in the culture war. The controversy is pretty much entirely because it offers an alternative to he as the default singular pronoun, and some jackasses get in a tizzy over the thought of it.
It is remarkably useful for writing where you don't know the pronouns involved, or as a catchall for folks that have trouble remembering which one to use, though. It's much harder to fuck up if you're using they/them.
Post by: scriver on March 02, 2023, 02:07:54 pm
Post by: alway on March 02, 2023, 05:16:12 pm
Post by: Great Order on March 02, 2023, 08:36:58 pm
Also what the hell's up with the they/them "controversy?" I swear to God when I grew up we were all taught that you could use they to refer to people, and this was way before gender politics was in the public awareness or on educational syllabi. But then when it did come up, people were saying there's no they/them for people, only he/she. Witnessing this harsh reaction over what had seemed obvious and uncontroversial for ages felt like how I imagine the early-modern Christians felt seeing the rise of creationists taking the OT literally in response to archaeology and natural selectionMy favourite thing about "Nooooooo they is exclusively plural!!!!!" is that it's been used as neutral singular since the 13th century at least.
It literally predates modern English.
Post by: Great Order on March 03, 2023, 06:54:28 am
Looks like the monotherapy *may* be dropping my T levels by itself, which is good because it'd mean no injections into my arse.
Post by: alway on March 03, 2023, 12:17:37 pm
https://twitter.com/ErinInTheMorn/status/1631487855527706627?t=szMP_uLS6GCgimrQo3-RyA&s=19
Post by: Great Order on March 03, 2023, 07:02:24 pm
*Terms and conditions apply
This worries me, even though I don't live in the US. As the saying goes, the US sneezes and the world catches a cold. On top of that, I live in the UK which has a bizarre love of seeing what the US does and copying it, but they somehow make it worse.
EDIT: Of course, there's also the other big issue.
Not only would something like this set a precedent, there's LGBTQ people in Texas at this moment as we speak. While banning the books isn't going to have an enormous direct impact on their lives, the implications are there: You're in our sights, and we're more than willing to destroy you.
I'm something of a pacifist as standard, and stuff like this makes me wonder "Would this get any better if someone just offed these motherfuckers?"
Not the best thing to be thinking, and I know it wouldn't because there's a reason these people get into office. Some sort of campaign to improve the public's perception is needed, but that's not something I'd have any idea how to do other than being a member of the group and being a good person.
Post by: alway on March 04, 2023, 01:16:12 am
Post by: Vector on March 04, 2023, 08:13:59 pm
I guess that I'm a they/them now. In real life, not just internet imagination land. Neat huh?
Well, I asked my closest family to please update their usage of pronouns in regard to me, and they said sure.
And I got a little praise which doesn't feel entirely earned, if I'm being honest. It's just a simple thing.
Congratulations on your gender!!
(Yet once you start gravitating towards "xir"-type constructions, you have to acknowledge that you're going beyond a planned ambiguity and are now possibly trying to actively ellicit a reaction amongst the less enlightened/flexible. Or attempting some form of transhumanism. - I don't say you can't, of course. And maybe if the choice is particularly distinctive then perhaps it'll be more memorable, even for me. Yay!)
Honestly, I think about changing to one of the other neutral pronoun sets like ey/em/eir sometimes because "they" is coming to mean "unknown -- could be cis male or female, even!" and specifically because of that, I think I've become a lot fucking easier to misgender. People use "they" to refer to cisgender people whose pronouns they actually do know, or as a catch-all pronoun for trans people in general to say "this person is trans and I don't want to misgender them so I'll just use they instead of figuring out what their pronouns actually are."
I'm affirming something that, to me, is described as "balanced" or "both and neither," not "dunno, take a guess."
Post by: Starver on March 05, 2023, 12:53:54 pm
The generallly gender-agnostic SF universe of her Ancilliary novels has the main (focal) civilisation default to "she/her" for everyone. You know it s not an Amazon Civilisation (or parthenogenic, or LevGuinian but off-page, etc) just not a social distinction.
In co-universe book Provenance, the world(s) of a civilisation on fringe of the above Empire go for "e/er" (I think) until the person chooses to qualify either way. Self-selecting, as is their decision to 'come of age', or at least that's how it works with the protagonist and er contemporaries (seemingly without biological presumption), but I'm trying to remember if part of that was class-privilege.
It seems that other societies in the galaxy (further? I'm can't recall how far away the real non-human aliens of the series come from) may have different standards... Probably there's an "Earth vanilla" protocol out there but, without making it the issue of the writing, I think it'd be just mentioned in passing (like how the Ancillary concerned at one point says how she purposely does not wear gloves, to pose as an outsider for tactical reasons), letting the reader just settle into the gender-blindness as much as they do the idea of death-of-personality AI-controlled 'bio-drones'.
Anyway, I say fill your boots. I was just thinking about those who would feel self-righteously afronted. Who I don't think should be pandered to, so let 'em be... ;)
Post by: Iris on March 05, 2023, 01:30:20 pm
Nothing new with me except dying inside a little whenever I'm reminded that I'm a girl on the internet only, and being annoyed whenever people misgender me there despite putting my pronouns on my bio. Like, would it really be so hard to check? Or ask? Or even default to "they" instead of "he"? Is "Persephone" not a feminine enough username for you guys?
It doesn't even bother me that much, it's just the principle of the thing.
Post by: Great Order on March 05, 2023, 04:00:20 pm
After over two months of hormones, I think I'm developing boobage.And I can confirm, something hath happened. Got a bud.
Mentioned the whole left nipple being sore, still is (A bit like a bruise in terms of feel), but I'm pretty sure I can feel something a little more solid under it now.
Post by: Iris on March 05, 2023, 06:18:09 pm
Post by: Great Order on March 05, 2023, 07:22:28 pm
Post by: MaxTheFox on March 05, 2023, 08:38:08 pm
I think I've mentioned Ann Leckie's books, before. Maybe not this thread, but I'm not checking back.In my (basically post-bigotry) setting, they/them is standard. Neopronouns didn't catch on in the wider population. Sure there's ambiguity but it's usually obvious what you mean from the context and that's what matters in language. I think this is the most plausible situation, language is reluctant to that kind of change for better or for worse. And hey that covers everyone, even one of those alien species with 4 biological sexes and 16 "default" genders.
The generallly gender-agnostic SF universe of her Ancilliary novels has the main (focal) civilisation default to "she/her" for everyone. You know it s not an Amazon Civilisation (or parthenogenic, or LevGuinian but off-page, etc) just not a social distinction.
In co-universe book Provenance, the world(s) of a civilisation on fringe of the above Empire go for "e/er" (I think) until the person chooses to qualify either way. Self-selecting, as is their decision to 'come of age', or at least that's how it works with the protagonist and er contemporaries (seemingly without biological presumption), but I'm trying to remember if part of that was class-privilege.
It seems that other societies in the galaxy (further? I'm can't recall how far away the real non-human aliens of the series come from) may have different standards... Probably there's an "Earth vanilla" protocol out there but, without making it the issue of the writing, I think it'd be just mentioned in passing (like how the Ancillary concerned at one point says how she purposely does not wear gloves, to pose as an outsider for tactical reasons), letting the reader just settle into the gender-blindness as much as they do the idea of death-of-personality AI-controlled 'bio-drones'.
Anyway, I say fill your boots. I was just thinking about those who would feel self-righteously afronted. Who I don't think should be pandered to, so let 'em be... ;)
Post by: KittyTac on March 05, 2023, 08:42:31 pm
Post by: scriver on March 06, 2023, 02:56:30 am
And while I acknowledge I'm selection biased by being Swedish and limited in my interactions with English, but I'm pretty sure our they/them equivalent was more currently used than the English tongue's was too.
But you know me I get too emotional over language and semantics
Post by: MaxTheFox on March 06, 2023, 03:55:27 am
Post by: Egan_BW on March 06, 2023, 04:15:45 am
Post by: voliol on March 06, 2023, 04:56:30 am
I dislike that Sweden's media has really latched on to our version of "xe/xir", which sees basically no use in the general populace (I'm not even sure they're used in the LGBTQ community, but that just might be that I'm not enough in it) while the neutral pronouns we have, including both the direct cognate of they/them and other possible choices, barely sees any use at all just because they're not "hip" enough.
And while I acknowledge I'm selection biased by being Swedish and limited in my interactions with English, but I'm pretty sure our they/them equivalent was more currently used than the English tongue's was too.
But you know me I get too emotional over language and semantics
I haven't heard of the "they/them" equivalent ("de/dem/dom") being used, though admittedly I know few Swedish enbies. It seems odd to me in Swedish since we usually are strict with the singular/plural (unlike English, which does it all the time with "you"), though I suppose it might both a positive and negative that it doesn't conflict with an "singular person, unknown gender" pronoun like "they" does in English (and the "xe/xir" "hen does).
Granted, I view "hen" mostly as a literal construct; really practical to avoid the "han eller hon"-s ("he or she"-s) of formal text, but impractical when spoken. This is partially because it doesn't mesh well with dialectically omitting half of the "h"-es at the start of the pronouns. If "han" becomes "an", and "hon" "on", then "hen" collides with the "en" I overuse to avoid "man"1. I find it's usually not to difficult to either call the person by name, shuffle around the word order, or use some lazy construction like "männskan" instead.
Seeing how popular hen is when written though, maybe future generations will come to think of it as a natural word (i.e. not intentionally constructed during their lifetime), and bring it to spoken language without it being too stifled.
1"Man/en" is a pronoun pair referring to a general person, used in cases where "one" or "you" would be used in English. "Man" is literally... "man" in English, so avoiding it is a speech quirk found among feminists. It's far from universal but not personal either.
Post by: Starver on March 06, 2023, 05:45:56 am
[...] since we usually are strict with the singular/plural (unlike English, which does it all the time with "you"),Well, "you" is of course originally the plural, but we rarely use "ye", these days. And the rest. Plus 'tis likely most times usest thou it, thy intention really be þe article, I tells thee!
((Yeah, I think I shoehorned at least one of those onto the wrong foot. It's been too long since I knew for certain, and various contemporary dialects have retained different things differently as well...))
Post by: Iris on March 06, 2023, 07:19:38 am
I'd be more enthusiastic about them if I saw a set I wanted to pronounce rather than ones which break the drivebelt in my brain when my eyes run over them. A nice "they" is a lot more pleasing to my inner voice. Maybe a nice loanword would feel better to me?
There are various constructed languages (Ido is one iirc) that have a lot more pronouns (https://en.wikipedia.org/wiki/Ido#Pronouns) than English ever will - including both neuter and pangender ones.
Post by: scriver on March 06, 2023, 09:13:09 am
I dislike that Sweden's media has really latched on to our version of "xe/xir", which sees basically no use in the general populace (I'm not even sure they're used in the LGBTQ community, but that just might be that I'm not enough in it) while the neutral pronouns we have, including both the direct cognate of they/them and other possible choices, barely sees any use at all just because they're not "hip" enough.
And while I acknowledge I'm selection biased by being Swedish and limited in my interactions with English, but I'm pretty sure our they/them equivalent was more currently used than the English tongue's was too.
But you know me I get too emotional over language and semantics
I haven't heard of the "they/them" equivalent ("de/dem/dom") being used, though admittedly I know few Swedish enbies. It seems odd to me in Swedish since we usually are strict with the singular/plural (unlike English, which does it all the time with "you"), though I suppose it might both a positive and negative that it doesn't conflict with an "singular person, unknown gender" pronoun like "they" does in English (and the "xe/xir" "hen does).
Granted, I view "hen" mostly as a literal construct; really practical to avoid the "han eller hon"-s ("he or she"-s) of formal text, but impractical when spoken.
That's the thing though, "den/denne" (the singular variant of "de/dem") is already used that way, and completely smoothly so, because "han" och "hon" are genderised variants and developments if "den". Common phrases you would have heard used would be for example the Arthurian "den som drager detta svärd skola bli kung över hela England" ("they who draw this sword shall be crowned king of the whole of England" for the English speaker), or the very common child/play sayings like "den som sa det han va det" ("they who said it he was it" - "I am rubber you are glue") and "den som nämnde't han klämde't" ("they who mentioned it he squeezed it" -- it's our version of "smelt it dealt it"). In the two latter you can see the "den" pronoun slipping over into the gendered pronouns at the end usage. In both cases it could just as easily use the gender neutral at the second line and nothing would change, it runs just as smoothly in full gender neutral mode. I also always think of the tv-serien "Den som dräper" ("They who kills" from... 2000's sometime? You don't have to look far to see a host of it being used like this still around.
Quote
This is partially because it doesn't mesh well with dialectically omitting half of the "h"-es at the start of the pronouns. If "han" becomes "an", and "hon" "on", then "hen" collides with the "en" I overuse to avoid "man"1. I find it's usually not to difficult to either call the person by name, shuffle around the word order, or use some lazy construction like "männskan" instead.
1"Man/en" is a pronoun pair referring to a general person, used in cases where "one" or "you" would be used in English. "Man" is literally... "man" in English, so avoiding it is a speech quirk found among feminists. It's far from universal but not personal either.
Help me reclaim "man" into the old gender neutral instead! It's usage as a gender neutral pronoun is literally one of the ways the old, gender neutral "man as synonymous with human" still exists in our language (that and the suffix "-man" as a "somebody who does a thing-word"). The feminists are wrong, it is the usage of "man" as masculine and denying women grammatical humanhood which is the patriarchal construct.
Disclaimer: I don't really try to do this in my daily speak because I am self-concious enough as it is and afraid of sounding weird. But you and me together voliol we will be the start of something bigger, I know it!
Huh. I thought Swedish was one of those languages where masculine and feminine gender merged into common gender? Although a quick search shows that isn't the case for pronouns, which I guess is egg on my face.
Yes, pretty much. Grammatical gender is gone, having grown into the two gender-irrelevant "-en" and "-et" groups, often called "genus" because of Latin influence on the language of grammar. These two groups also have their own pronouns, "den/denna" och "det/detta". These are both used for basically everything, male- or female-related, people, animals, plants, things, you can find examples of all within both.
However, when it comes to pronouns, the "-en" words den split (in relatively modern Swedish, iirc) into additional gendered versions, "han/honom" och "hon/henne". These are grammatically speaking part of the "den/denna" pronoun, and is basically only used for people and personifications, and in modern times also animals. Because there's no grammatical difference between the three, you can easily use the gender neutral original instead of a gendered pronoun at any time without it sounding strange or forced. So we have this perfectly grammatically correct word with both singular and plural variants so it doesn't carry the metaphorical squeaky-floor-noise-itude the english "they" sometimes result in, and which is already used for people all the time with no issues or controversies. But it just wasn't good enough for the hipster.
Post by: Rolan7 on March 06, 2023, 09:39:49 am
Help me reclaim "man" into the old gender neutral instead! It's usage as a gender neutral pronoun is literally one of the ways the old, gender neutral "man as synonymous with human" still exists in our language (that and the suffix "-man" as a "somebody who does a thing-word"). The feminists are wrong, it is the usage of "man" as masculine and denying women grammatical humanhood which is the patriarchal construct.I kinda dig this in theory? We'd need a male equivalent to woman, of course. Apparently "werman" was not actually a thing, but I don't see why it couldn't be!
Disclaimer: I don't really try to do this in my daily speak because I am self-concious enough as it is and afraid of sounding weird. But you and me together voliol we will be the start of something bigger, I know it!
So we could be mankind, with women and wermen and neither and all other sorts of men. Cool- again, in theory :P It sounds unrealistic but that's precisely because we were taught to expect man/werman as the default in so many roles. There is no easy route.
Neopronouns and genders are cool. Anything that disrupts (innovates) the gender binary, frankly. I still associate most with having no gender (agender) followed by being a gender-non-conforming woman, but I think it's great that people today are constructing new genders. We humans (mankind? :P) have done that in many cultures in the past! The only thing stopping us from doing it again is social conservativism trying to push "traditional" gender roles (from a very specific and unfair tradition).
You might think I'd be interested in fae-gender or something, and I am, just not for me. I love how creative people are :)
Post by: scriver on March 06, 2023, 09:59:58 am
Apparently "werman" was not actually a thing, but I don't see why it couldn't be!
Wait, it wasn't? But I've built me entire gender grammar philosphy on it D:
Post by: Rolan7 on March 06, 2023, 10:08:30 am
You know what, I don't know XDApparently "werman" was not actually a thing, but I don't see why it couldn't be!
Wait, it wasn't? But I've built me entire gender grammar philosphy on it D:
All this actual linguistics is beyond me, I just did a Google and believed the first result I saw: https://www.reddit.com/r/linguistics/comments/f4h0as/the_old_english_ghost_word_werman_where_did_this/
Post by: voliol on March 06, 2023, 10:56:12 am
That's the thing though, "den/denne" (the singular variant of "de/dem") is already used that way, and completely smoothly so, because "han" och "hon" are genderised variants and developments if "den". Common phrases you would have heard used would be for example the Arthurian "den som drager detta svärd skola bli kung över hela England" ("they who draw this sword shall be crowned king of the whole of England" for the English speaker), or the very common child/play sayings like "den som sa det han va det" ("they who said it he was it" - "I am rubber you are glue") and "den som nämnde't han klämde't" ("they who mentioned it he squeezed it" -- it's our version of "smelt it dealt it"). In the two latter you can see the "den" pronoun slipping over into the gendered pronouns at the end usage. In both cases it could just as easily use the gender neutral at the second line and nothing would change, it runs just as smoothly in full gender neutral mode. I also always think of the tv-serien "Den som dräper" ("They who kills" from... 2000's sometime? You don't have to look far to see a host of it being used like this still around.
I'd argue that "den" in the example cases above is performing a slightly different purpose than the usual personal pronoun, as a definite article to an omitted noun (something like "the who kills"). Still, you have me convinced. Drawing a line between word classes like pronouns and particles is linguistic prescription to begin with, so why shouldn't we consider "den" as a pronoun in phrases where it functionally is?
And normally "den" is a personal pronoun. It just normally is used for non-person, which carries with it the same awkwardness as "it" in English. And here you come with examples where it is used for persons. I feel I understand it more now, thanks! :)
Re: the wereman stuff, I am also surprised by its supposed lack of existence. How should this be understood? That at the time "man" entered predominant use (over were?) it was patriarchy all the way down, as humans were considered men? I feel like even speculating about it might lead to the spread of more disinformation, if none of us have an actual grasp of etymology, and then by accident remember our shared speculation as any kind of knowledge...
Post by: Iris on March 06, 2023, 12:59:53 pm
Post by: alway on March 06, 2023, 03:16:14 pm
1. It isn't about what you think about grammar rules and how they should be, it's about whether you respect those around you more than you respect made up rules. If you fundamentally respect others less than made up categories based on a partial understanding of language, that's A Problem! You should probably do some self-examination there!
2. Likewise, understand that you are not an expert on this subject matter. Most cis people have a lot of learning to do on the basics of gender as applied to living in real life. If something seems weird and bizarre, it is most likely because you're the equivalent of a 3rd grader reading about calculus. You lack the context to make sense of it, rather than the thing itself being absurd and worthy of ridicule.
3. Until the former 2 points are understood and demonstrated, you will simply be relegated to the Baby's First Genders Talk because nobody trusts you enough to not be weird about it if they go into more depth. If xe/xer is too intense for you, who would bother even telling you about the meanings behind multiple sets of pronouns, auxiliary pronouns, it/its pronouns, plural folks, and so on?
Post by: Iris on March 06, 2023, 04:46:20 pm
Post by: alway on March 06, 2023, 05:34:04 pm
Post by: voliol on March 06, 2023, 06:44:15 pm
As for scriver and I talking about Swedish grammar and how it does with xe/xir and it/it types of pronouns, I kind of see the issue in that neither of us use those. But I don't think that goes for anyone else in this thread, either? Forgive me if I'm wrong about that. Yeah, I don't think I'll get some real knowledge about normally inanimate pronouns from people from grammar, but I don't see a wrong with trying to get hints casually from where I am (i.e. in this thread), as long as I know to discard them if they end up as bull. Which is likely really.
The idea of hurting other people by being stupid and inconsiderate sucks, and I do believe that's something I've done. I'm sorry for that. But the idea of always being expected to only say smart things, or otherwise be assumed to always be on a child's level also does. I dunno,
But yeah, grammatical gender is maybe off-topic for this thread?
Post by: Strongpoint on March 07, 2023, 10:33:06 pm
2. Likewise, understand that you are not an expert on this subject matter. Most cis people have a lot of learning to do on the basics of gender as applied to living in real life. If something seems weird and bizarre, it is most likely because you're the equivalent of a 3rd grader reading about calculus. You lack the context to make sense of it, rather than the thing itself being absurd and worthy of ridicule.
Here comes a simple problem. We don't even have a unified definition of the word "gender"
I regularly encounter variations of 4 major definitions.
1) Gender is exactly the same thing as sex but when talking about humans. It is binary. Can be either male or female.
2) Gender is a biochemically determined behavioral pattern that usually matches sex but not always. It is also a spectrum. Can be male, female, both(or neither).
3) Gender is (quoting WHO) characteristics of women, men, girls and boys that are socially constructed. This includes norms, behaviors and roles associated with being a woman, man, girl or boy, as well as relationships with each other.
4) Gender is an internal feeling of being X. Usually it is male or female but can be both, neither, fluid, and more.
My problem is... those 4 are absolutely incompatible. Words stop functioning when different people assign different meanings to them. I am at the point where if someone will ask me what gender is, I'll shrug, this word is becoming meaningless (and when answering a stranger whatever answer I may choose, someone WILL be insulted and call me a bigot, narrow-minded, satanist, pervert, leftists, etc.)
Post by: TD1 on March 08, 2023, 09:54:07 am
There is a distinction between a biological female and a socially-intervening female, but language imposes such vagueness on the issue that claiming 'I am a woman' is met with 'emmmm.... no you're not.'
The closest are the created 'transx' categories, which certainly acknowledge the differences between physical and social interactions with the concept of femininity/masculinity, but this very specificity seems counter to what many 'transx' individuals desire - - - - - acceptance, socially, as someone of a different and well-defined sex which is not 'trans'.
I suppose in part the fluidity and uncertainty of the language aids this ambition; a factor likely contributing to the continued (and I'd argue in many cases mutual) misunderstanding.
1. Whether you respect those around you
2. You lack the context to make sense of it, rather than the thing itself being absurd and worthy of ridicule.
3. Otherwise, nobody trusts you enough to not be weird about it if they go into more depth.
I agree wholeheartedly with point one. Points two and three strike me as.... condescending and gatekeeping, I suppose? Is the onus of proof on the believer, or the sceptic?
Post by: Strongpoint on March 08, 2023, 10:58:33 am
Quote
Points two and three strike me as.... condescending and gatekeeping, I suppose? Is the onus of proof on the believer, or the sceptic?
I heard variations of that calculus analogy so many times from... religious people. "You are a child in spiritual matters and try discussing things you can't possibly understand."
Post by: TD1 on March 08, 2023, 11:14:38 am
I do love me a bit of religious/philosophical wrangling. The 'you're too ignorant to engage in this debate' claim is disturbingly common in religious circles.
Post by: Rolan7 on March 08, 2023, 12:13:35 pm
Sure it's technically true! You can doubt basically everything, maybe you're a brain in a jar or the only self-aware mind etc. Yet expressing one's doubt about *certain* things can be telling. If I keep "just asking questions" about the shape of the earth, I might expect some reasonable pushback whenever I bring up the topic. If I keep "expressing doubt" about whether a certain president was born in America, people might wonder if I'm really *just* exercising skepticism.
People might find it rude to express such skepticism specifically towards a highly-politicized minority. It often turns out to be a passive-aggressive way to deny people's identities without actually making the case. "I'm only skeptical- the burden of proof is still on you! I'm not claiming you aren't a man/woman/etc, I simply don't believe you". That's not a neutral statement.
This tactic is necessary because it's impossible to argue someone else's gender, and yet people feel compelled to try. We're taught that being cis is normal, so being trans isn't normal, which means it must be confronted and "questioned" until it goes away. That's a self-perpetuating taboo, not anything rational or good. It is not natural, it was learned and taught by media and society.
The acceptance of trans people is a cultural revolution that rejects that brainwashing. It's a more natural position, and it's analogous to how we culturally accepted that homosexuality is natural too. This is the meaning behind "Born this way" or "We're here, we're queer" etc: This isn't *new*. People have always been trans and/or gay. It's the oppression that is unnatural: drilled into us and used by the elite to distract us from wealth disparity. Fear as a tool.
Post by: EuchreJack on March 08, 2023, 12:15:32 pm
It should be "We are children in spiritual matters, and try discussing things that we can't possibly understand."QuotePoints two and three strike me as.... condescending and gatekeeping, I suppose? Is the onus of proof on the believer, or the sceptic?
I heard variations of that calculus analogy so many times from... religious people. "You are a child in spiritual matters and try discussing things you can't possibly understand."
Anyone that says "You" is an unrepentant prick and should be excommunicated.
Post by: Strongpoint on March 08, 2023, 12:42:04 pm
Quote
This tactic is necessary because it's impossible to argue someone else's gender, and yet people feel compelled to try.
It is impossible to argue someone's gender if it is defined in a certain way. If this word is defined differently - it is absolutely possible.
Also, If I identify myself in a certain way (let's say an atheist) and someone doubts my self-identification I am not going to be insulted. I'll simply say - I am an atheist because of A, B, and C. If the person will disagree with me saying that A, B, and C are not enough (or irrelevant), I'll simply make a conclusion that we have different definitions\understandings and move on.
Other people have no obligation to agree with my self-identification. After all, I may be mistaken, missusing words, or lying.
Post by: voliol on March 08, 2023, 01:44:37 pm
QuoteThis tactic is necessary because it's impossible to argue someone else's gender, and yet people feel compelled to try.
It is impossible to argue someone's gender if it is defined in a certain way. If this word is defined differently - it is absolutely possible.
Also, If I identify myself in a certain way (let's say an atheist) and someone doubts my self-identification I am not going to be insulted. I'll simply say - I am an atheist because of A, B, and C. If the person will disagree with me saying that A, B, and C are not enough (or irrelevant), I'll simply make a conclusion that we have different definitions\understandings and move on.
Other people have no obligation to agree with my self-identification. After all, I may be mistaken, missusing words, or lying.
There's some context missing here, in that doubting trans people's self-identified gender is often done in conjunction with denying them healthcare they could die without. Trans people are touchy about gender for a reason, that being a great deal of oppression.
Gender and sexuality both has lots of nuances, which we could learn about from each other, in and outside of this thread. At the same time there can be hardships in such a discussion, because LGBTQ+ people face a lot of unfair treatment, and the lot of us sadly bring with us some bias from the world we were brought up in. Going into that difficult discussion, hedging on the other person lying won't lead to anything constructive. Please don't.
Post by: Rolan7 on March 08, 2023, 02:01:51 pm
Also, If I identify myself in a certain way (let's say an atheist) and someone doubts my self-identification I am not going to be insulted. I'll simply say - I am an atheist because of A, B, and C. If the person will disagree with me saying that A, B, and C are not enough (or irrelevant), I'll simply make a conclusion that we have different definitions\understandings and move on."I wouldn't be insulted" is such a fascinating argument.
Other people have no obligation to agree with my self-identification. After all, I may be mistaken, missusing words, or lying.
First off, while atheists are certainly not a monolith, I think most are offended in that situation. Presuppositionalists (deists who believe that everybody *actually* knows their god, most people just lie about it) get very indignant responses. Simply for having that belief! It's a very rude idea to express.
But "I would simply present a reasonable and structured defense of my identity"...
That is easy to say when religion isn't as omnipresent in small talk as it used to be, whereas gender comes up in every in-person interaction. Usually explicitly via gendered language, and often confrontationally when it's a trans (or trans-suspected) person.
You are hypothetically accepting the burden of patiently justifying yourself if someone happens to *doubt you're an atheist*, and implying that we should accept that same burden every time someone *doubts we're our gender*. That's an enormous burden
Furthermore both are impossible. You cannot demonstrate you are an atheist. I cannot demonstrate that I'm non-binary. Not only do neither of have a responsibility to do so, we *can't*. There's some outside chance we could justify the existence of atheists or trans people to this random offensive person, but we cannot prove who we are. We don't need to. The burden is on them to, IDK, make whatever case they're actually making when they "express doubt". I think that's why presuppositionalists are so annoying: there's not even anything to argue against, they're simply rude. Same with someone who "doubts" my gender, and demands that I "prove" it. There's nothing to say.
Yeah, I mean, I could define womanhood as "being me" and I'd be pretty set I guess. Though I guess I still couldn't prove it to anyone else... Radical skepticism is funny that way.QuoteThis tactic is necessary because it's impossible to argue someone else's gender, and yet people feel compelled to try.
It is impossible to argue someone's gender if it is defined in a certain way. If this word is defined differently - it is absolutely possible.
Here comes a simple problem. We don't even have a unified definition of the word "gender"This definition is plainly useless (redundant), very new (reactionary), and presupposes that sex is binary when there are obvious counterexamples. There are male traits and female traits, sure, and even one person with both destroys this definition.
I regularly encounter variations of 4 major definitions.
1) Gender is exactly the same thing as sex but when talking about humans. It is binary. Can be either male or female.
There exist people who do believe sex and gender are linked, and go on to change their sex and thus gender. These are "transmedicalists" and I'm not a fan, frankly.
2) Gender is a biochemically determined behavioral pattern that usually matches sex but not always. It is also a spectrum. Can be male, female, both(or neither).This sounds like that "gendered brains" theory. I don't know what to make of it, but the data didn't sound conclusive. I'm very skeptical but I'm interested.
3) Gender is (quoting WHO) characteristics of women, men, girls and boys that are socially constructed. This includes norms, behaviors and roles associated with being a woman, man, girl or boy, as well as relationships with each other.Yeah, these last two make the most sense!
4) Gender is an internal feeling of being X. Usually it is male or female but can be both, neither, fluid, and more.
My problem is... those 4 are absolutely incompatible.
Technically 3 is more accurate, though slightly incomplete. Genders are socially constructed and subjective. "Manhood" means very different things in different cultures, and often changes decade by decade. There are common ideas but the details evolve (or just change :P). Womanhood too. And other genders as well (https://en.wikipedia.org/wiki/Third_gender).
These social constructs are just as real as states, or money: very real, just subjective and transitory. They DO have the value that we invest in them.
So that's manhood. So what is a man? A MISERABLE PILE OF- *cough* sorry
Is a man someone who fits into the local definition of manhood more than other genders?
NO! We go by part 4. A man need not perform any masculinity whatsoever. He must simply identify as a man. Typically that means he wants to be manly, at least in some ways, but there is no requirement whatsoever.
This may sound extreme, but in my opinion it's the only consistent option. Elizabethan nobles didn't retroactively stop being men because frilly neck scruffs and leggings look effiminate now, and it was never their codpieces that made them men. They wore codpieces because they were men, and that drove them to perform masculinity.
Perhaps (definitely) some people weren't men, yet they performed masculinity anyway because of social pressure. Those are trans people. We cannot prove they were trans- we could not prove it even if they were alive today, changing into one of those 20-ft-wide cage dresses at the first opportunity. It's impossible and unnecessary to prove.
In many countries, trans people seeking health care are forced into an artificial gender binary to access affirming care like hormones. Someone seeking estrogen is required to perform femininity, often for years, in a way we would never demand of a cis woman. Oh-so-progressive nordic countries only recently stopped sterilizing trans people as a banally routine part of gender-affirming care. This is madness that cannot be justified. Someone's gender cannot be proven, and that's fine.
Bodily autonomy is the only reason we need to allow- AKA, not restrict- access to hormone therapy.
Post by: Rolan7 on March 08, 2023, 02:38:08 pm
https://maia.crimew.gay/posts/the-emails/
From the hacktivist that revealed the do-not-fly lists were kinda racist ???, a new drop revealing that anti-trans activists don't always believe what they're saying :o
Edit:
As a palate cleanser, two funny tweets about Samus:
https://twitter.com/b0tster/status/1633164041391599624
https://twitter.com/b0tster/status/1633518951194927109
Quote
thats a misconception its actually progesterone that lets you use the morphing ballYESSS LET'S GO
Post by: Strongpoint on March 08, 2023, 03:45:14 pm
There's some context missing here, in that doubting trans people's self-identified gender is often done in conjunction with denying them healthcare they could die without. Trans people are touchy about gender for a reason, that being a great deal of oppression.
Gender and sexuality both has lots of nuances, which we could learn about from each other, in and outside of this thread. At the same time there can be hardships in such a discussion, because LGBTQ+ people face a lot of unfair treatment, and the lot of us sadly bring with us some bias from the world we were brought up in. Going into that difficult discussion, hedging on the other person lying won't lead to anything constructive. Please don't.
I honestly don't understand how denying healthcare is legal. I am very confused why stories like Robert Eads' don't end in a bunch of people going to jail. Doctors may have a right to say "I disagree that you are a wo(man)", they shouldn't have a right to deny treatment because of that.
I also understand the desire of changing LEGAL definitions of the words gender, man, woman (not that I think it is a good idea in all cases) It can also be done without changing the definition by rewriting rules and replacing relevant instances of "(wo)men" with "men and trans(wo)men"
I never said that trans people are lying, Please don't put words in my mouth. I said that people have a full right to not believe someone when they say I am X. Demanding them to accept every "I am X" claim is just plain wrong and very anti-freedom of thought. Also, I listed lying as one of the possible reasons why a claim can be false. Why are you jumping on the lying part?
*I do think that not all people who claim to be trans are actually trans, some are mistaken, especially young people but it is a rather complicated discussion. Intentionally lying and putting yourself into a marginalized group is rather... unlikely
Post by: Strongpoint on March 08, 2023, 04:15:43 pm
Quote from: Rolan7
Furthermore both are impossible. You cannot demonstrate you are an atheist. I cannot demonstrate that I'm non-binary. Not only do neither of have a responsibility to do so, we *can't*. There's some outside chance we could justify the existence of atheists or trans people to this random offensive person, but we cannot prove who we are. We don't need to. The burden is on them to, IDK, make whatever case they're actually making when they "express doubt"
I can't demonstrate that I am an atheist but I can explain why I consider myself to be one and what I mean by the word atheist. My words are not enough for them? Do they define the word differently? Whatever. It is their right. As long as they don't mess with my actual rights (like punishing me for 'wrongly' identifying myself as an atheist or trying to lock me into a mental institution to cure my 'delusion') it is their business. I understand that Trans people do have their actual rights messed with.
But it is this messing with the rights that should be the focus, not trying to forcefully change someone's opinions on who other people are.
Quote
Technically 3 is more accurate, though slightly incomplete. Genders are socially constructed and subjective. "Manhood" means very different things in different cultures, and often changes decade by decade. There are common ideas but the details evolve (or just change :P). Womanhood too. And other genders as well.
Doesn't it mean that being trans has nothing to do with genetics or other aspects of one's biology and it is simply the result of someone's upbringing and cultural background?
Quote
A man need not perform any masculinity whatsoever. He must simply identify as a man. Typically that means he wants to be manly, at least in some ways, but there is no requirement whatsoever.
So your definition of a man is "Man is any person who considers himself to be a man". Do I understand you correctly?
Post by: Rolan7 on March 08, 2023, 04:53:34 pm
But it is this messing with the rights that should be the focus, not trying to forcefully change someone's opinions on who other people are.Oh, sure!
And when someone accosts me in public about gender, I'm going to say whatever I need to to survive the situation. I'm not going to explain the history and nature of gender and patiently explain my "position" and why I feel this way. They may be dangerous and they definitely don't care.
But yeah I can't force anyone to change their opinion about literally anything. I might call them rude if they go out of their way to misgender people (like my dad does), but people in real life are very often rude. The consequences of that are social.
Maaaybe. I'm not convinced of the "gendered brain" theory but I'm ready to listen. There's clearly a correlation between male physical traits and forming a more masculine gender identity. "Males tend to be men" you could say. But we constructed "manhood" in response to male traits, so that's not surprising. I'm curious what will happen when people grow up with more genders around.QuoteTechnically 3 is more accurate, though slightly incomplete. Genders are socially constructed and subjective. "Manhood" means very different things in different cultures, and often changes decade by decade. There are common ideas but the details evolve (or just change :P). Womanhood too. And other genders as well.
Doesn't it mean that being trans has nothing to do with genetics or other aspects of one's biology and it is simply the result of someone's upbringing and cultural background?
Much (all?) dysphoria is totally cultural, though. Many trans women shave their legs, but smooth legs are not a female trait. Leg shaving is just something (many) women do. It's still very important to people, but it's subjective.
Dangit, I got in a conversation about this recently so I should have been more clear. That's on me.QuoteA man need not perform any masculinity whatsoever. He must simply identify as a man. Typically that means he wants to be manly, at least in some ways, but there is no requirement whatsoever.
So your definition of a man is "Man is any person who considers himself to be a man". Do I understand you correctly?
"Identity" is tricky. I think it is a subconscious phenomenon. That's why many people are trans without knowing it yet. Figuring out one's true identity can take a very long time... It helps to have the words to better understand one's psyche, and the freedom to experiment.
So a trans man can say they're a woman. They can truly believe they're a woman. But I would say that they can only actually identify as a man.
Yet someone "identifying themself" is just claiming their identity, they could be mistaken or lying. English is tricky.
Post by: Egan_BW on March 08, 2023, 04:58:13 pm
So your definition of a man is "Man is any person who considers himself to be a man". Do I understand you correctly?
no a man is just any member of our species the word you're looking for is wereman
sprints out of thread cackling madly
Post by: voliol on March 08, 2023, 05:48:42 pm
There's some context missing here, in that doubting trans people's self-identified gender is often done in conjunction with denying them healthcare they could die without. Trans people are touchy about gender for a reason, that being a great deal of oppression.
Gender and sexuality both has lots of nuances, which we could learn about from each other, in and outside of this thread. At the same time there can be hardships in such a discussion, because LGBTQ+ people face a lot of unfair treatment, and the lot of us sadly bring with us some bias from the world we were brought up in. Going into that difficult discussion, hedging on the other person lying won't lead to anything constructive. Please don't.
I honestly don't understand how denying healthcare is legal. I am very confused why stories like Robert Eads' don't end in a bunch of people going to jail. Doctors may have a right to say "I disagree that you are a wo(man)", they shouldn't have a right to deny treatment because of that.
I also understand the desire of changing LEGAL definitions of the words gender, man, woman (not that I think it is a good idea in all cases) It can also be done without changing the definition by rewriting rules and replacing relevant instances of "(wo)men" with "men and trans(wo)men"
I never said that trans people are lying, Please don't put words in my mouth. I said that people have a full right to not believe someone when they say I am X. Demanding them to accept every "I am X" claim is just plain wrong and very anti-freedom of thought. Also, I listed lying as one of the possible reasons why a claim can be false. Why are you jumping on the lying part?
*I do think that not all people who claim to be trans are actually trans, some are mistaken, especially young people but it is a rather complicated discussion. Intentionally lying and putting yourself into a marginalized group is rather... unlikely
I never said you said trans people are lying either :P.
It seemed strange to me that when talking about how to take people's words about their gender, a general statement about all reasons a claim can be false, if these reasons didn't connect back to the matter at hand. And as you noted lying was the stranger one of these, so that's why I "jumped" on it. A misunderstanding, I suppose?
So your definition of a man is "Man is any person who considers himself to be a man". Do I understand you correctly?
no a man is just any member of our species the word you're looking for is wereman
sprints out of thread cackling madly
This thread has been won.
Post by: Rolan7 on March 08, 2023, 11:00:23 pm
Death before detransition. Literally.
I can't do it again- the decade and a half as a scared adult, repressing, or the couple months where my hormones didn't work. F'ing castor oil.
I can't do it again. I won't.
All the changes to my sex, they're just gravy.
I lived a half-life until I started hormones. So, so late.
Post by: KittyTac on March 08, 2023, 11:16:27 pm
Post by: Strongpoint on March 09, 2023, 12:41:53 am
Much (all?) dysphoria is totally cultural, though. Many trans women shave their legs, but smooth legs are not a female trait. Leg shaving is just something (many) women do. It's still very important to people, but it's subjective.
Wait. I am not sure I understand what you are saying.
Are you implying that a cisgender woman who shaves her legs has a slightly different version of female gender compared to a cisgender woman who doesn't?
And if I will start shaving my legs (let's say my girlfriend will say she prefers cleanly shaven male legs) will it mean that I moved somewhere on the spectrum and my gender has slightly changed to another variant of male?
Post by: Rolan7 on March 09, 2023, 01:31:12 am
Hmm...
Much (all?) dysphoria is totally cultural, though. Many trans women shave their legs, but smooth legs are not a female trait. Leg shaving is just something (many) women do. It's still very important to people, but it's subjective.
Wait. I am not sure I understand what you are saying.
Are you implying that a cisgender woman who shaves her legs has a slightly different version of female gender compared to a cisgender woman who doesn't?
And if I will start shaving my legs (let's say my girlfriend will say she prefers cleanly shaven male legs) will it mean that I moved somewhere on the spectrum and my gender has slightly changed to another variant of male?
I meant that women who shave their legs do so not because they are female, but because they are women.
A woman in the USA who doesn't shave her legs is still a woman, because she identifies as one, she is simple Gender-Non-Conforming in that way. also, based- saw this with women cyclists pretty often. Were they forming a "gender"? That's above my pay grade.
Similarly, a man who is secure in his masculinity can certainly shave his legs. That was even more common in cycling (there are pragmatic concerns regarding crashing on asphalt, but also it's sexy). I don't think that spawns a new variant gender, but I suppose that's debateable- are metrosexual men a gender? Perhaps.
But you do not join that group simply by shaving your legs! It is something less concrete and more personal than that. Any inclination to do so could be a reflection of your inner gender.
also, controversial take: I think one's true gender is fixed by adulthood. Some trans people say it can change, but I think conversion therapy is fundamentally impossible rather than simply moronic.
Post by: Egan_BW on March 09, 2023, 02:52:38 am
Since you believe that gender isn't really a physical difference in the brain, wouldn't it be in the realm of weird poorly understood brain stuff, like memory and consciousness?
Post by: Strongpoint on March 09, 2023, 03:56:03 am
Quote
I meant that women who shave their legs do so not because they are female, but because they are women.
I see.
Yes, many women choose to express their gender by shaving their legs, wearing 'feminine' clothing, using makeup, and generally following socially constructed gender roles\stereotypes\norms for the gender "woman". But does it really means that gender itself is just a social construct?
Post by: TD1 on March 09, 2023, 06:29:06 am
Most adults have little inclination to do so, but that doesn't mean they can't.
All it takes is personal reevaluation. Which is why I view the tabulating of outward signs somewhat silly. An Italian does not need to have a moustache and drink wine, and nor would a metrosexual (imagining, for a moment, that to be a distinct gender) need to shave his legs to consider himself one.
Edit: I think I fell behind the conversation, heh.
Post by: Great Order on March 09, 2023, 06:53:04 am
Then gender roles are then the stuff that a society expects someone of a specific gender to do. Much more mutable and varies from culture to culture.
It feels like a lot of the issues come from people saying that gender is a social construct while simultaneously saying it's immutable. If it's a social construct, then it can be changed, but if it's not able to be changed then it's not a social construct.
Post by: Strongpoint on March 09, 2023, 08:54:40 am
My personal view on this is there needs to be a proper separation out of gender roles and gender. I see gender as an immutable, likely neurological in origin, self-perception. A bit like the mental blueprint you have of your body, and when the body and the blueprint don't match it often causes distress.
Then gender roles are then the stuff that a society expects someone of a specific gender to do. Much more mutable and varies from culture to culture.
It feels like a lot of the issues come from people saying that gender is a social construct while simultaneously saying it's immutable. If it's a social construct, then it can be changed, but if it's not able to be changed then it's not a social construct.
It is quite close to my opinion. But here is a hypothetical for you (and anyone else who may be interested in answering such hypothetical).
Let's imagine some advanced alien civilization decides to play a cruel prank on me by cutting and pasting memories from my male cisgender brain to a blank brain of a human female. Will my gender stay male? And not only male but in the very same spot of the male-to-female gradient?
Post by: Great Order on March 09, 2023, 09:31:16 am
If it's just the memories, there's a whole host of other things that'd need to be carried over to turn it from an inactive brain into a functioning one, they'd likely have just created a storage medium. Of course, we're jumping into hypotheticals that I don't think even top scientists could work out yet.
Now, let's say the brain isn't blank, they've taken a random woman, removed her memories, and dumped yours in their place. I'd have to imagine that, outside of the sheer confusion, she'd still be cisgendered. Really fucked up, probably incredibly confused as to her gender, but I suspect deep down she'd still be cis.
But again, this is hypotheticals we straight up lack the answer to.
Post by: Strongpoint on March 09, 2023, 10:46:14 am
I like this perspective and it gives some food for thought.
Post by: Starver on March 09, 2023, 12:35:28 pm
And we're far from checking what does what, outside of purely fictional cases of regular body/mind-swapping such as Dollhouse, Freejack, etc, in which we only get what the writers want to give us. And those examples don't focus on crossing the gender-gap, possibly even mostly avoid it, though do at least seem to allow it but without the salaciousness of perhaps more 'specialist' fictions where they're probably making that the point.
(We don't get much in-depth insight into The Doctor in her Thirteenth incarnation, even. Personality changes, but then it did for every other, and how caterpillar/butterfly it is with basically melting down all the old cells and reforming them is something we can only presume. And, unfortunately, is just as fictional, with canon-inconsistencies on top.)
Post by: Vector on March 09, 2023, 12:42:34 pm
I have just seen a clip of a prominent American political commentator calling for "eradicating trangenderism from public life entirely" and I am both incredibly angry and wondering if anyone in the audience realized that he was effectively calling for genocide.
Yes, I think it's become pretty clear at this point what is going on.
A bill also just passed Tennessee's House of Representatives which allows county clerks to deny marriage licenses to same-sex, interfaith, and interracial couples.
Post by: MorleyDev on March 09, 2023, 12:50:31 pm
Thing is, even if you regard your brain/body not being matched as some form of 'mental disability', we already have legal and political agreement down in the books that society should accommodate others with mental and physical disabilities. There's already legal obligation to sure public buildings are wheel chair accessible, to not discriminate against people with Down's Syndrome. So even if you regard being transgender as some form of mental disability, then that doesn't change their being an obligation to accommodate, which means...allowing them to live as their 'preferred gender'.
Also mental disability is measured in distress and harm caused to the person with it, and treatment is about doing things to reduce or remove that distress. Since we already know 'conversion therapy' doesn't work for that and is instead just horribly abusive and cruel, that just leaves accommodation which is the approach proven to reduce the distress/harm.
So even by their professed 'logic', 'eradicating transgender' doesn't fit. Trying to present it in those terms is just a transparent attempt to mask their own hatred and prejudice, not that this wasn't already obvious.
Post by: scriver on March 09, 2023, 01:04:35 pm
Now we just need to get some Satanists in the clerky and start denying Christian weddings
Post by: MrRoboto75 on March 09, 2023, 03:41:19 pm
When they either forget not say the quiet part out loud, or no longer feel the need to hide it...once trans people are "dealt with" disabled people aren't going to be that far away on the list of "undesirables" to be handled next.
Thing is, even if you regard your brain/body not being matched as some form of 'mental disability', we already have legal and political agreement down in the books that society should accommodate others with mental and physical disabilities. There's already legal obligation to sure public buildings are wheel chair accessible, to not discriminate against people with Down's Syndrome. So even if you regard being transgender as some form of mental disability, then that doesn't change their being an obligation to accommodate, which means...allowing them to live as their 'preferred gender'.
Also mental disability is measured in distress and harm caused to the person with it, and treatment is about doing things to reduce or remove that distress. Since we already know 'conversion therapy' doesn't work for that and is instead just horribly abusive and cruel, that just leaves accommodation which is the approach proven to reduce the distress/harm.
So even by their professed 'logic', 'eradicating transgender' doesn't fit. Trying to present it in those terms is just a transparent attempt to mask their own hatred and prejudice, not that this wasn't already obvious.
Post by: Great Order on March 09, 2023, 06:33:03 pm
-snipped for Vec's sake-With the whole federal marriage equality thingymabob, wouldn't that be explicitly overridden?
Or is this the Reps hoping for either SCOTUS to overturn it, or to be blocked and go "Well folks, *they* stopped us, better vote for us again so we can keep pushing this!"
Post by: MrRoboto75 on March 09, 2023, 06:37:16 pm
Post by: Maximum Spin on March 09, 2023, 06:49:03 pm
Doesn't that just mean they need to respect marriage license (gay or otherwise) of other states, but you still can't become gay married in that state?The law actually has nothing to do with gay marriage or anything else.
It would also allow clerks to refuse to personally file straight marriages, same-race marriages, marriage between two Catholics, or anything else simply on the basis of not wanting to. And you can always find another clerk.
The law is stupid - if you say "I refuse to do this paperwork because it offends me", you should get fired - but there's no reason to be dishonest about it.
Post by: TD1 on March 10, 2023, 06:49:28 am
Hm, are you saying that gender is like an Operating System (or rather a part of it) which is independent of memories but needs time to form? And that merely copying memories into an empty brain will fail to produce a person because there is no OS in place which needs to be naturally developed? And that, unlike computers, hardware changes software, and software changes hardware and they can't be separated cleanly?
I like this perspective and it gives some food for thought.
So I looked into gender-as-social-construct, and there's a huge amount of supporting evidence. There's also evidence to suggest a biological basis for some gendered things, with this (https://qz.com/1190996/scientific-research-shows-gender-is-not-just-a-social-construct) suggesting that hormones in the womb (which differ wildly according to the child's sex, apparently?) could have some influence. In the nature v nurture debate, gender seems to lean heavily towards nurture with a sprinkling of nature for seasoning.
So, in most ways gender is mutable and depends on how one views one's relation to a social construct. In other (negligible) ways it's immutable and linked to biological sex.
Edit: Considering this, it seems... unlikely to me that gender is hard-wired into neurology in any meaningful way. Which is good news for transgender folks! It lends validity to the idea that it can change. Though the 'nature' element also seems to imply that at least some distinctions exist between the genders based on their sex.
Edit edit: the academic paper (https://onlinelibrary.wiley.com/doi/abs/10.1002/icd.2064) the article linked above was based on.
Post by: Strongpoint on March 10, 2023, 08:22:44 am
If your definition of gender is something that looks like
Gender is norms, behaviors and roles associated with being a woman, man, girl or boy, as well as relationships with each other.
Then your study will show that norms, behaviors, and roles are mostly socially constructed with some hard-to-quantify influence of evolved behavioral patterns (aka gender according to a different definition).
Post by: Starver on March 10, 2023, 08:54:23 am
And it may be that there are secondary effects from trans-placental chemicals, too. The old 'second boy is more likely to be gay' chestnut[1] being that of those hormones that do cross the boundary, some might have been in the mother's system due to the prior pregnancy.
Not so simple as permanently hanging around, and the placenta does do a lot to inhibit much transfer across the barrier that isn't vital for foetal survival, but some trace of transferable 'signal' left over by the general wash of chemistry might wash back again in the next instance. Any advantage (e.g. the "aunt and uncle effect", where there are handy co-parenting individuals who are able to help bring up the generation after them) could find itself evolved into the natural variation of the brain through subtle cues such as this, perhaps an epigenetic element that gets squirreled away, chance triggering a different valid path of brain (and thus mind) development that on balance is positively advantageous to the lineage that holds that potential to hold all such roles.
I wouldn't rule out nurture effects also. For tipping the post-natal potentiality one way or other from a tottering position as set up by genetics and the rest. As long as such differences have been historically an advantage to the holders (if not users) of the inbuilt likelihood, once the possibility exists then it will happen.
Not that evolution has had time to work with such influences as social media or totalitarianism, which could perhaps exagerate or prosecute such tendencies. Such things as global social evolution and possible medical interventions being something we haven't had for much of human (and precursor) history, as well as the will and opinion of heads of tribes being far less impersonal (within their own little huddle of people) than it became once there started to be kings, emperors, leaders of superpowers or indeed other political/social influencers with alternate jurisdictions to exert their power across. What may have integrated seemlessly into intrinsic human behaviour in ages past (unnoticed, because it always seemed perfectly normal to have whatever mix of personalities and social reactions one grew up amongst and lived in) now looks weird (or interesting, or terrible) as you get to notice the clumping together of meta-tribal behaviours into groups that either reinforce or seemingly destroy the place one perhaps thinks one inhabits in the world.
So is gender (in any sense) a social construct? No, I think it's probably no more that than anything else not entirely phenotypical (the purely physical sense of gender is phenotype, mostly arising from genotype; in its bare and entirely unclothed sense, in the absence of socially-inspired surgery). But I think society may amplify and even catalyse the expression and diversity of it (when not suppressed or forced into narrower expectations[2]), in a highly visible manner. Whilst the underlying cause of all this variation is down to some massively chaotic mix of long- and short-chained molecules interacting in a staggeringly huge variety of ways that tends to produce a person who is an individual l. Who is going to be unique amongst other all the other unique individuals, however you try to conveniently pigeonhole everyone (or force pegs of one shape into holes of any other).
[1] This turned out true for a friend of mine. Though as his first child was by a different mother, I can't see it counting as evidence towards the cross-placental assumption. ;)
[2] Not just towards binary, but "you're gay if you're not not straight" anti-Bi prejudice within "LG" circles, or Trans-excluding, etc.
edited for typo and minor clarification
Post by: TD1 on March 10, 2023, 09:25:49 am
Again, it comes to definitions.Of course. The rules of any game change depending on how you define the pieces. This argument pertains to the WHO definition. Other definitions bring different conclusions - for instance, the findings are mostly meaningless if one considers gender to be identical to sex.
If your definition of gender is something that looks like
Gender is norms, behaviors and roles associated with being a woman, man, girl or boy, as well as relationships with each other.
Then your study will show that norms, behaviors, and roles are mostly socially constructed with some hard-to-quantify influence of evolved behavioral patterns (aka gender according to a different definition).
But that doesn't invalidate the findings themselves, just how we interpret them.
Post by: Great Order on March 11, 2023, 07:06:47 pm
Post by: alway on March 11, 2023, 11:15:45 pm
Personally, I wasn't out at work until 6 months on hormones. At 5 months, it wasn't obvious what was changing, but it was obvious enough that something was changing for a coworker to tell me I was looking healthier lately, and asked whether I started working out or something.
At around 15 months I was starting to feel comfortable with my natural appearance; and it just kept getting better from there. 5 years in, and without any effort I get gendered in both directions by people who don't know me. (There's several fascinating tidbits about how people perceive gender I've gleaned over the years from this, such as 'people will gender you as a woman if you have a beard, so long as electrolysis makes your skin mostly clear of hair from the jaw line forwards' or 'people's gender recognition process is asynchronous, and when multiple brainparts positively identify you as different genders, they flip flop between them and panic if trying to use sir/ma'am or other gendered forms of address')
Post by: Strongpoint on March 13, 2023, 10:16:01 am
I'd like to point out that Strongpoint is arguing for access to HRT, and so is moderately [slur] on-side despite all the words we've exchanged.
Death before detransition. Literally.
I can't do it again- the decade and a half as a scared adult, repressing, or the couple months where my hormones didn't work. F'ing castor oil.
I can't do it again. I won't.
All the changes to my sex, they're just gravy.
I lived a half-life until I started hormones. So, so late.
Somehow missed this the first time around, and noticed only after rereading.
I am most definitely not against access to HRT for adults. If someone I care about would ask me if should they do HRT or not, my advice would be strong no (not going to give a breakdown why because it is a very wrong place to do for obvious reasons) but my opinion is irrelevant because A) it is not my decision. B) They know what they need for their mental health far better than I do.
Body autonomy is an important right and any mentally healthy adult person should not be denied using it. I find it especially idiotic when people are denied routine cosmetic surgeries like breast-size reduction or changing their face to a more masculine\feminine. More serious stuff like... cutting off body parts is something close to my limits of body autonomy but within it.
But the story is very different when we talk about children. They are not mentally stable enough to make such decisions. Furthermore, to know that they don't want to be of the same gender as their sex, they need to have experience of being the same gender as their sex.
Do you say you suffered? I totally believe you. Problem is that your personal experience should not be a basis of a policy. Doing it without proper care will result in the suffering of other people. Society should minimize Stories of people who transitioned and then changed their minds and went for detransitioning are also not happy and fluffy.
Teenagers are...
No, I don't trust children to make such decisions. Not at all. They feel discomfort growing as a gender they dislike. Well, growing up is always uncomfortable, we can't shield young people from all possible discomfort.
Before I approve any medical transitional steps for children, I need ways to prove that someone is trans BEYOND REASONABLE DOUBT. And I fail to see such methodology.
Post by: alway on March 13, 2023, 10:44:30 am
Post by: None on March 13, 2023, 11:05:30 am
This is really, really, really not the place to make a statement about how transfolk shouldn't have access to crucial care, nor the place to dither about whether or not gender as you understand it exists. Kindly find something else to argue about elsewhere while the community explores, celebrates, and supports who they are.
Post by: Imic on March 13, 2023, 05:42:35 pm
Post by: Rolan7 on March 13, 2023, 06:03:49 pm
I really hope the level's good this time but I don't want to nudge the result either way. Sublingual is absorbed straight into the blood like glucose, so seems like it could make a huge difference. I know for weekly injections the blood had to be taken at the "trough" when the level's lowest.
I'll also do my best to well-hydrate myself so hopefully... hopefully there aren't any problems this time.
Post by: Rose on March 13, 2023, 10:01:57 pm
Post by: bloop_bleep on March 14, 2023, 12:31:56 am
...
Teenagers are not given genital surgery. That is a misconception. They are only given puberty blockers, sometimes gender-affirming hormones, and sometimes plastic surgery to delay the onset of irreversible physiological changes they may dislike, and even then only after a lengthy consultation period with licensed practitioners where they are diagnosed with gender dysphoria.
These are procedures often done for others as well at this age range, such as those going through precocious puberty. The concern about gay people or gender role-nonconforming people mistakenly going through the transition process statistically is nonexistent after more than a year of prior observation.
Post by: Great Order on March 14, 2023, 07:49:03 am
I'll also do my best to well-hydrate myself so hopefully... hopefully there aren't any problems this time.At least a pint beforehand to make sure your blood's "properly hydrated" as it were, I was told. More is better, stagger it to about 250ml (or half a pint, it's close enough) every 15 minutes since your body can only properly take up so much water at once.
And can we stop arguing now? Or separate it into another thread? This stuff's in territory that gets very flamey very easily.
Post by: Rolan7 on March 15, 2023, 05:05:21 pm
glad that's over with. PP did great with the paperwork though- helped me out over the phone and faxed (faxed!) my info where it needed to go. And they covered the test even though it's been a month and a half since they messed up the draw.
also they called me Ro
I kinda forgot I told them that, it was an incredibly nice surprise yesterday. And an excellent start to my day when they called this morning.
Ro, Rol, Roan, Roanne... Gosh. It was like being Truenamed. Certainly felt magical <3
Edit: OH! I remember who calls me Rol! Frumple does that on this very forum! I always love that, but don't think I've mentioned it!!
Post by: Frumple on March 15, 2023, 06:24:32 pm
Post by: EuchreJack on March 19, 2023, 11:20:47 pm
Post by: Great Order on March 21, 2023, 10:00:59 pm
1) Anyone got advice for protecting breasts? Usually I'm fine, but doing martial arts means that sometimes my proto-breests get smacked, pressed on or whatever and it suuuuuuucks.
2) Any sports bra advice? They're rapidly becoming problematic when I'm jogging. There's still nothing obvious due to still having moobs, but they're large enough that they bounce kinda painfully.
Post by: Loud Whispers on March 22, 2023, 10:23:37 am
The plastron is a kind of vest that goes over the chest and covers the sword arm's bicep, and is worn over a shirt and strapped around you. It is worn under the fencing jacket and provides an extra vital layer of defence against sword strikes. It is sold in padded and unpadded forms and is fantastic protection against abrasion and sharp focused strikes. It can be worn over gym wear without looking odd or out of place, and can be worn easily underneath a martial arts uniform. Plastrons are sold padded or unpadded in unisex and gendered designs, whilst also offering full mobility compared to rigid or semi-rigid underarm protectors. Wearing a sports bra, t shirt, plastron, uniform would give you 4 layers - and whilst not immune to painful strikes, does much to protect the chest as it was designed to do, though I imagine a padded one would probably be better for protecting against punches, as a standard unpadded plastron is designed more for protecting against being pierced by a broken blade than protecting against regular blunt force.
There are also things like archery chest guards, but I don't know anything about them personally. There are also rigid and semi-rigid underarm and chest protectors, but I also don't know about them, and I wonder if there's a risk of buying a rigid chest protector and accidentally breaking someone's hand if they punch it too hard lol
Post by: Great Order on March 22, 2023, 11:22:36 am
Rigid's probably out, I'd need something more padding-esque. I'll be buying a rashguard alongside a sports bra (So as to cover up the sports bra, since one of my weekly sessions takes place at a leisure centre so we use the public changing rooms, I don't want random public to see what they think of as a dude in a bra) which will probably help a bit, but it won't help so much with compression.
Post by: Rolan7 on March 22, 2023, 12:24:53 pm
This is BY FAR my favorite bra:
https://www.walmart.com/ip/Avia-Women-s-Medium-Support-Racerback-Sports-Bra/285946494
It's light polyester-lycra with thin but firm foam inserts. The inserts verifiably protect against being poked in the chest, and they also comfortably flatten my chest. My booba is very noticeable in a non-baggy t-shirt, but with this underneath I'm completely stealth. (And I really value being able to do that). I wear this more than I don't, even sometimes to bed. I often leave the inserts out now though, for some subtle feminine curve while keeping the abrasion protection.
It doesn't feel like it's providing much support until I take it off and try to jog, or descend stairs. I can't even- I basically can't do that now, I always circle back for support. It's not the soreness of early growth, it's more about the mass moving in a weird way... so that's a nice little reality check whenever I feel like I don't have any chest.
I just measured my self at 38" band circumference, and XL fits me perfectly. It feels snug but it doesn't bite like my other bras. I guess that's the lycra, though also maybe I've stretched it slightly over the past four months of near-constant use.
So yeah I'm VERY happy with it, and it's the only one I've tried with such easily removable inserts.
https://www.walmart.com/ip/Avia-Women-s-Racerback-High-Impact-Sports-Bra/249452757
This one costs $16 instead of $10 and is "high impact" but has no inserts at all, so almost nill impact protection??? It's also uncomfortably tight in the band despite being the same size and manufacturer. It also has awkwardly big cups despite also being a "sports bra".
I use it as a backup when I need to wash my good one (I often just handwash my good one in the shower though, it's just light polyester).
I'm just now realizing why size charts have been so unhelpful to me, and why they emphasize cup size as much as band size. I have a bit of belly fat but my "band" is just my ribcage... Whereas someone with a smaller skeleton could easily reach my 38" band with soft tissue. And their "C-cup" would be a lot different from my "C-cup", shape-wise. (I measured a high B back in November and it HAS to be more, now. I'd rather not check).
Anyway, I think there's going to be some guess-and-checking. My size (for this brand) is roughly XL at 38". I tried a L that I REALLY liked the design of, but it was obviously too small so I returned it (and they did take it back!). I probably should have tried it in a changing room (even over a thin shirt?) but I wasn't brave enough, I was nervous enough anyway.
That's also why I went for the cheapest, though I'm still surprised (annoyed, honestly) that my $10 is materially better than the $16 one in every way. though maybe the larger cup size will be useful (':
(same listed size though!! Both sports bras, same brand, agh!!)
Post by: Vector on March 23, 2023, 12:16:44 am
As an AFAB martial arts person, my advice is 1. yes a sports bra to pin them down when you're running and make sure the fit is correct but also 2. I'm so sorry but in terms of sudden boob ouchies during puberty you're just going to have to deal with it. And yes, it sucks. If the problem is cloth abrasion against nipples use some athletic tape, pasties, or bandaids if you want to cover up the sensitivity zone, but in general the answer for the problem you're talking about is "Take a Deep Breath Sweetie, That's Just How It Is."
(Open to other answers of course but this is a problem for most girls in PE classes and I never talked to a single person with a solution.)
Post by: Remalle on March 24, 2023, 02:32:05 pm
Post by: Egan_BW on March 24, 2023, 02:53:33 pm
Post by: Magmacube_tr on March 24, 2023, 05:34:57 pm
Post by: Great Order on March 24, 2023, 06:44:15 pm
I'll just get a cheap one, I'll be replacing it soon enough. No point in buying one to last if I won't be wearing it in 6 months time.
Post by: Rolan7 on March 24, 2023, 06:53:32 pm
Also thanks Remalle <3
Post by: Great Order on March 24, 2023, 06:57:35 pm
Big fecking chest. As in the ribcage is big. There's a layer of flab, but pulling it tight to "simulate" losing weight only gave me an extra 1.5 inches of play room.
Like, it's not catastrophically large, we're not talking Elon Musk levels, but it's large enough that it falls into L/XL.
I'm also an A cup rather than an AA, I think because I'm still running with moobs over the top of the actual boobs.
Post by: Magmacube_tr on March 24, 2023, 07:33:29 pm
Post by: Rolan7 on March 24, 2023, 07:56:54 pm
Reminder that I have 38" band and XL is just *barely* large enough, and that's basically hugging my ribs. L is unwearable. I shouldn't have tried, but I was a bit vain :( It's nothing to be ashamed of.
Does anyone here would really like to have a partner in theory, but is absolutely horrified by the concept in reality? Can't be the only one.Mmm yeah a bit. I have a great partner (I had a nightmare about us breaking up yesterday, messed me up a bit) but it's long-distance, and I get... really awkward about being sexual with them, usually. A LOT more than I did with strangers, actually. I think there's some shame problems there.
(not the trans part, we're t4t-ish and they've been incredibly supportive and vice-versa <3)
Post by: Rockeater on March 26, 2023, 01:48:52 pm
Kinda surprised they did that actually, thought they would be busy trying to defend the not so popular attempt of takeover by the elected government, but that multitasking for you.
Post by: Doomblade187 on March 26, 2023, 04:05:31 pm
Also damn I was really hoping that the media transphobia wouldn't spread/get more pooular.
Post by: Egan_BW on March 26, 2023, 04:14:23 pm
Yay! Israel's right wing media is stocking the flames of transphobia! we are like the US or UK!
Kinda surprised they did that actually, thought they would be busy trying to defend the not so popular attempt of takeover by the elected government, but that multitasking for you.
They are defending the attempted takeover. By focusing on something else.
Post by: Great Order on March 26, 2023, 07:20:23 pm
Yay! Israel's right wing media is stocking the flames of transphobia! we are like the US or UK!Wish I could say I'm surprised but Israel's right-wing is, rather ironically, pretty damn fascist.
Kinda surprised they did that actually, thought they would be busy trying to defend the not so popular attempt of takeover by the elected government, but that multitasking for you.
Stay safe.
Post by: Imic on March 27, 2023, 03:10:59 pm
Post by: Magmacube_tr on March 28, 2023, 06:53:59 am
I need to stop using Tumblr because I enjoy the bullshittery but there is no escape from the awful news of awful things happening around the world especially to queer people and it is well meaning but by God is it exhausting
Well isn't that the truth. LGBT getting killed here, banned there. It never ends.
Post by: martinuzz on March 30, 2023, 10:31:43 am
In the statement, they expressed regret for the way that their profession has treated LGBTQ+ in the past.
Until late in the last century, LGBTQ+ were declared mentally ill (homosexuality was considered a mental disorder in our psychiatrists' handbooks up until 1973) and had to undergo horrible treatment, like castration.
The statement acknowledges that this has caused terrible harm to the persons involved.
The association hopes that their statement will support people who are coping with trauma.
This is the first time than an entire profession group explicitly expresses regret to the LGBTQ+ community.
Post by: jipehog on March 30, 2023, 11:04:48 am
Post by: martinuzz on March 30, 2023, 11:27:45 am
Post by: bloop_bleep on March 30, 2023, 02:33:27 pm
Post by: McTraveller on March 30, 2023, 02:35:54 pm
EDIT: I could've sworn I saw even in earlier medical texts some difference in ribs (I mean it's trivial to count ribs, yeah?), but now all I can find is, no, everyone1 has 24 ribs.
Apparently the difference is that the last pair of floating ribs in women is smaller and was mistaken as being missing / perpetuated as a missing rib.
1Except for some genetic anomalies, apparently as much as 0.5% of the population (which is a large absolute number!).
Post by: Frumple on March 30, 2023, 03:00:00 pm
Post by: McTraveller on March 30, 2023, 03:22:14 pm
I'm... not sure why it'd be relevant? Folks of all chromosomes end up with irregular numbers of ribs, and even non-LGBT folks occasionally get some removed for reasons varied. Rib count isn't strictly indicative of much of anything on its own.
Mostly wondering about how HRT would impact (if at all) bone structure, especially post puberty. Not just ribs, but hips, etc.
Post by: Frumple on March 30, 2023, 03:54:34 pm
Hormone therapy can do that even when it's being used for reasons other than gender affirming care, for that matter. Estrogen can strengthen bones, ferex, and is part of some contraceptive methods or menopause treatment. HRT's just one use of hormones out of several, and it's not like being used for something else somehow magically makes it function differently, y'know?
Post by: Starver on March 30, 2023, 04:27:28 pm
Generally, it narratively relates to an element (to buildings, etc) that sticks out prominently. One idea, therefore, is that it should have been the penis-bone. Which many mammals have, but man lacks. Because Adam's was removed from him, for the purposes of creating Eve, being the suggestion.
(And because God was heavily into Lamarckism, rather than being a Darwinian, in those early days. Though it's clear He has definitely changed His mind about that since.)
Post by: Vector on March 30, 2023, 06:13:16 pm
The statement acknowledges that this has caused terrible harm to the persons involved.
The association hopes that their statement will support people who are coping with trauma.
I'm not Dutch and I appreciate, a lot, that this was done. Relieved
Post by: alway on March 31, 2023, 01:18:56 pm
An article that pretty well sums up the state of things in the media currently, and how it goes hand in hand with the rise in fascist organizing for eliminationist results against transgender people.
Post by: Great Order on April 05, 2023, 03:41:04 pm
Oh hey, it's the UK's turn to get on the "Biological women ONLY!" train.
Should be noted the Equality and Human Right Commission has been given over to the TERF faction as a nice piece of Tory magnanimity towards bigots, so it's hardly doing the job its name implies.
Favourites:
Quote
On the subject of sport, the organisation said a biological definition of sex "would mean that organisers could exclude trans women from women's sport without this additional burden" of having to show it was necessary to do so in the interests of fairness or safety.AKA, "You had to provide a reason before, now we want it to be legal to exclude trans women for literally no reason."
Quote
Changing to a biological definition would also mean single-sex groups could restrict membership to biological women or men, the EHRC said, giving the example of lesbian groups or women's-only book clubs which would then be able to exclude trans people.Makes me wonder how many trans men are gonna turn up to those same lesbian groups or book clubs to prove a point (Everyone forgets about trans men).
Quote
The EHRC also said a change in the definition could be "more ambiguous or potentially disadvantageous" when it comes to equal pay provisions, direct sex discrimination and indirect sex discrimination."We're fucking you over in major ways, but we saved biological women from the horrible mean transes so hooray!"
EDIT: Oh yeah, and it turns out Kier's happy to go with the... *cough* "review". Tried to convince myself to vote for the party most likely to beat the Tories, turns out I can't because the guy running it thinks the exact same thing about me as Sunak does.
At least Sunak doesn't pretend his pro-equality veneer is anything other than a veneer.
Post by: jipehog on April 06, 2023, 11:07:50 am
QuoteOn the subject of sport, the organisation said a biological definition of sex "would mean that organisers could exclude trans women from women's sport without this additional burden" of having to show it was necessary to do so in the interests of fairness or safety.AKA, "You had to provide a reason before, now we want it to be legal to exclude trans women for literally no reason."
To be fair, in this regard they are not redefining anything, that id what it always meant. Currently we are wading in uncharted waters for competitive sports and given evidence of performance enactment (https://en.wikipedia.org/wiki/Transgender_people_in_sports#Testosterone,_athletic_ability_and_injury_risks) it make sense to wait for science around physical performance to mature and open up field as evidence becomes available.
Post by: EuchreJack on April 06, 2023, 11:11:17 am
Also: Uncharted waters? Schwarzenegger is Grandfather Age!
Post by: scriver on April 06, 2023, 11:52:13 am
I do think that this is something that needs to be thought about. I don't think the reasonable conclusion necessarily has to be "no trans athletes without exceptions" or "separate cis and trans leagues" (and I definitely does not think this should be something the government makes laws about, it should be up to the relevant sports associations to decide for their own sports).
But there is already a lot of skirting the rules going on in sports regarding enhancement which goes against the spirit of the competition. Take for example the Norwegian domination of the ski sports -- you might think to yourself, of course Norway dominates ski related competetions, they're born with skis instead of feet, and you'd be correct: Norwegians are all born with abnormal, monstrous feet, but it's also the case that all Norwegian skithletes happen to be asthmatics. Yes, that's a fact. If it seems weird to you that asthmatics can compete in athletic sports on the top of the world stage then yeah, it does to me too. But according to their medical history they are asthmatics because when they go outside and work really hard in cold weather they experience asthmatic symptoms such as heavy breath, shortness of breath, and not getting enough oxygen out in the body. So their doctors prescribe them oxygen-increasing medication to ease their symptoms of asthma. And this has been investigated and deemed legit, even though to the common man, it is obvious cheating and weasling to get access to performance enhancing drugs. I am sure there are many similar practices going on in other fields and countries around the world, and it would be great if they didn't just let this happen since it definitely spoils the spirit of the competition.
And this is why hormone treatment and sports has to be thought over, in my opinion. Not from a starting point of actual transgendered athletes who take hormones because of their earnest need but from the perspective of bad faith actors who might use it to cheat under the protection of a medical label, like the Norwegians do with asthma.
Yes, I apologise, but I am making this trans issue about cis people :P
But I'm not saying "ban all transgendered athletes because of this", I'm just saying "let's think ahead about this consequence because it's extremely likely people are going to try to take advantage of this".
And then maybe we can band practises like the Norwegian asthma one too so Sweden will finally have a chance of winning again
Post by: Frumple on April 06, 2023, 01:38:07 pm
Not from a starting point of actual transgendered athletes who take hormones because of their earnest need but from the perspective of bad faith actors who might use it to cheat under the protection of a medical label, like the Norwegians do with asthma.See, this is one of those things I'd say would make more sense to worry about if it had, like. Ever? Ever. If it had ever happened. As far as I'm aware there has currently been exactly zero (0) cases of someone faking transitioning to get access to relevant hormones for a competitive advantage in sports. It's not entirely unreasonable to worry about specific expressions of bad faith, but it kinda' is unreasonable to worry about nonexistent ones, y'know?
Post by: Rolan7 on April 06, 2023, 02:15:39 pm
Yes, I apologise, but I am making this trans issue about cis people :PFairness in sports is indeed complicated (arbitrary and based more in feeling and tradition, except for obvious profit-motive). I don't like to get into it, but trans people indeed are basically unrelated to the issue.
Another issue that isn't really about trans people is bathroom bills, like just passed in Kansas (over veto) and will inevitably come back here in NC now that Tricia Cotham has joined the Republicans to bring a supermajority.
They're based on an emotional argument that "males", regardless of their actual biology, are inherently evil. (Personally I love men, most of my best friends and lovers have been men). The obvious misandry of these proposals are only exceeded by their misogyny. The primary victims, statistically, of bathroom policing are cis women. Women who don't fit the literally patriarchal expectations of appearance to exist in public are harassed and "transvestigated", even before the laws are on the books.
(Generally this is done BY women because it turns out patriarchy isn't "men do things", it's "women have rights restricted")
It is, unironically, the Stepford Wives/Handmaid's Tale/ISIL shit. Trans women are the supposed targets, and ARE targets, but truly this affects EVERYONE. Notably trans men being forced to shock women if they want to pee, but even cis men are forced to conform to gender by this sort of thing. It's hamfisted social engineering meant to preserve a rotten hierarchy, and *nobody* is truly free under it.
Anyway... It obviously doesn't protect cis women. It forces people who look like men to use the bathroom, which means that a predator could just claim to be a trans man. What are they going to do, actually investigate his genitals?
ARE they? Are we actually talking about genital inspections here?
Because if not, it's just a legal route to punish trans people and inspire gender-policing of women who don't look femme enough. *INCREASED gender policing.
Edit: We are literally talking about genital inspections for young girl athletes in... Florida, I think? Which sounds like literal pedo shit to me, but with a healthy dose of tracking their menstruation to detect whether they're exercising reproductive freedom.
this is where we're at, America.
Post by: Strongpoint on April 06, 2023, 03:17:04 pm
The main idea of sports is determining the strongest people and those, with almost no exceptions, are biological males.
But females work as hard as males to get their results! WHO CARES? Do we really consider world champions among seniors to be equal in status to young people? Do we think the same about Paralympic champions? For certain disabilities, being able to finish the distance needs more hard work and pain than a world championship (BTW, males with minor disabilities are still capable of destroying female world champions.)
There should be one true open league and as many secondary leagues as people want to create. And their eligibility criteria are their own business.
Post by: scriver on April 06, 2023, 03:22:52 pm
Not from a starting point of actual transgendered athletes who take hormones because of their earnest need but from the perspective of bad faith actors who might use it to cheat under the protection of a medical label, like the Norwegians do with asthma.See, this is one of those things I'd say would make more sense to worry about if it had, like. Ever? Ever. If it had ever happened. As far as I'm aware there has currently been exactly zero (0) cases of someone faking transitioning to get access to relevant hormones for a competitive advantage in sports. It's not entirely unreasonable to worry about specific expressions of bad faith, but it kinda' is unreasonable to worry about nonexistent ones, y'know?
There has to be some kind of opposite "slippery slope fallacy" coined for how you're acting right here. Is the example of asthma medication being abused not good enough to assume this will happen, does it have to be specifically hormones in a past were transgendered people were not seen as having any place in society and anyone attempting to use hormones regardless of reason would have been thrown out?
People won't be "faking transitioning", the Norwegians aren't faking asthma in their daily lives going around pretending to get hard of breath while in the grocers or anything. They don't need to, the asthma pretext is just on the paper. What's more likely is that they start administering hormones under one of many reasons cis people get hormone therapy and make that slip through as a "medical necessity", like how the Norwegians do with oxygen-increasing medication.
Post by: Maximum Spin on April 06, 2023, 03:41:56 pm
The main idea of sports is determining the strongest peopleIs it? For what purpose? What's the ROI?
The main idea of sports is to get people to spend money on sports, mainly by being entertaining to watch (in person or on television). It's true that, in very many cases, women's sports are loss leaders which draw much less of an audience than the corresponding men's sports and would likely never be funded if they had to stand on their own, but there are also certainly cases where women's sports get comparable or better audiences. It seems like a lot of people like women's wrestling, for example - yes, mostly men watching it for sexual reasons, but their money still spends.
Post by: McTraveller on April 06, 2023, 05:18:09 pm
Some people also like watching sports - it's amazing to watch what some people can do physically. Reaction time, endurance, sheer strength - whatever.
Thinking of things in ROI is just... too limiting.
Post by: TD1 on April 06, 2023, 05:36:06 pm
I'd personally say that the element of competition is essential to sport. Arguably, as per MS's argument, this ties into its commercial value. See, for instance, rugby. Its rules are constantly evolving to ensure that teams strive against each other. If the purpose were to determine the 'strongest,' then the constant rule-revision would be neither necessary nor conducive.
It's not competitive or compelling to watch the England rugby team play your local school's team. That doesn't mean we shouldn't have a local team, just that each should 'pick on someone their own size' :D
That way there's greater and fairer social participation in sport. Which is probably not the 'purpose' of commercialised sport, but should be.
In the case of the asthmatics, I suppose I'd operate under draconian rules. Either everyone should be given inhalers, or no one should. And if there was sufficient support for both, then two separate leagues should be established.
(In reality I doubt anyone would support an asthmatic league. For one thing, the name is ridiculous! Those justice guys do it much better. :P)
Post by: Maximum Spin on April 06, 2023, 05:37:36 pm
What? Some people just like playing sports. I like trying to challenge myself physically to play sports I enjoy. Can I get my body to do what my mind wants it to? Especially as I'm now firmly in middle age?Uh, yes, and the fact that people like you like it and will pay for it is why other people will pay to build stadiums, host sports tournaments, broadcast it, and so on. If people didn't like it, nobody would bother funding it.
Some people also like watching sports - it's amazing to watch what some people can do physically. Reaction time, endurance, sheer strength - whatever.
Thinking of things in ROI is just... too limiting.
Thinking about it in terms of ROI isn't "limiting", because that just means value, things happen because people value them.
Post by: Strongpoint on April 06, 2023, 05:47:47 pm
What? Some people just like playing sports. I like trying to challenge myself physically to play sports I enjoy. Can I get my body to do what my mind wants it to? Especially as I'm now firmly in middle age?
Your sports have little to do with fair or unfair advantage, right?
IMO, If we are talking about "transwomen shouldn't be allowed to compete in women's leagues because they have an unfair advantage", we are talking about sports as a contest for finding the best, not entertainment or self-improvement.
Ultimately speaking, commercial success is the key but if we look from this capitalistic point of view, all rules should be determined only by the whims of paying customers. It would result in stuff like - If the majority of paying customers don't want to see members of a certain race competing then... Or "no not sexy female athletes on my TV, it is not what I pay money for"!
Post by: Maximum Spin on April 06, 2023, 05:55:30 pm
Ultimately speaking, commercial success is the key but if we look from this capitalistic point of view, all rules should be determined only by the whims of paying customers. It would result in stuff like - If the majority of paying customers don't want to see members of a certain race competing then... Or "no not sexy female athletes on my TV, it is not what I pay money for"!I mean, yeah? It's not about what "the majority of paying customers want", it's about what makes the most money, so as long as the paying customers are still willing to pay you can disappoint them to whatever extent still gets you their money — but you can bet that if enough people were categorically unwilling to pay money "to see members of a certain race competing", the league would one way or another make that happen – because players need to be paid, officials and announcers need to be paid, camera crews need to be paid, uniforms need to be bought, transportation needs to be hired, and all the other employees at all levels who make the games happen all like to eat every day too, so without the money, there aren't any games.
It's not a "capitalistic point of view", it's the basic fact that people want to get value out of their own labor product.
Post by: Starver on April 06, 2023, 06:08:43 pm
Norwegians are all born with abnormal, monstrous feet, but it's also the case that all Norwegian skithletes happen to be asthmatics.If I've picked the right episode, from memory but without checking it, relevent to the above: https://www.bbc.co.uk/programmes/p0crdjjv (but maybe not to the thread - and if that's geofenced against you, there'll be a separate podcast-download you probably can find, perhaps via World Service pages...)
Post by: None on April 06, 2023, 07:21:52 pm
Like, shaving a slit into your eyebrow is apparently very gay/signaling? Or maybe it's just a coincidental style fad with my new partner's queer friends? She's very enmeshed with her local community and I got to meet a bunch of really cool people through her the other day- some mundane, some witty, some enby, and one unfathomably energetic puppy.
Perhaps it's from my point of relative ignorance, but I feel like I understand a little better how some people present or style as 'they/them' or just live their best selves with those pronouns.
Super excited to go live in a city soon with what should surely have a queer community around despite The Mormons. It'd do us well to get involved and make some friends while we're out there.
Post by: Rolan7 on April 06, 2023, 07:35:11 pm
I've heard (if I have this right) that undercuts, with the hair going to one side, are popular with NBs. Maybe because they're long been a GNC lesbian style? I keep thinking about getting a haircut- it's been years, and I love it long, but the simple ponytail exposes my forehead too much. besides, weather's getting hot :P
I'm typically wearing a nice sunhat, though, and I almost managed a couple of nice braids last month before I got distracted. I should give that another go!
Post by: Vector on April 07, 2023, 11:55:47 pm
I can see that this turned again into the cis people arguing about trans people thread. I literally thought it was AmeriPol for a minute.
Post by: Rolan7 on April 08, 2023, 12:07:51 am
JK I did bring up a fragment of actual trans politics and I got completely ignored. Perhaps I truly am half-woman after all.
Post by: EuchreJack on April 08, 2023, 12:16:09 am
Trans Supreme Court Justice when? Even openly gay would be "progress".
*marginalized doesn't mean minority, as the unlanded, the poor, and women have also had to fight this battle.
...
Unrelated, if the "bathroom arguments" had any merit, my 90% bio female workplace would have droves of women become Trans Men for about 10 minutes each day, just to access the far greater bathroom resources they would then enjoy. I'm a little surprised not one of them has decided to go that route, as it's 100% protected under NY law.
Post by: Vector on April 08, 2023, 12:29:39 am
... we have been fighting this battle for a long fucking time. the fight has been partially made invisible by the loss of a generation due to AIDS, but we have always been here, resisting. and turning it out!
Post by: Rolan7 on April 08, 2023, 12:40:28 am
We're a long way from proportional representation in government, obviously
but it'd be nice if we weren't obviously non-starters as candidates. Someday perhaps.
As for it being our turn- sorry, literally nothing personal, but that reminded me of some liberals who tried to "comfort" me in the wake of certain deaths back in- well, it could be any month.
I marched last week but I haven't talked about it. It was mostly quite nice. We were peaceful and we were briefly attacked, but nobody received lasting injuries.
We will not be silent- Stonewall was a riot.
(And trans people led the charge, no matter what heterosexual-led astroturf groups like LGB Alliance and GAG say. Homosexuals have always been and will always be our allies, whether in victory or as victims.)
Post by: EuchreJack on April 08, 2023, 12:53:46 am
Ideally it should include something about how it's a common struggle, solidarity, hope for the future, sympathy, etc.
I see no reason that trans should be a non-starter in at least some areas as political candidates, although incumbents always enjoy an advantage.
Oh hey, there are 77 confirmed in the US. (https://en.wikipedia.org/wiki/List_of_transgender_political_office-holders#:~:text=As%20of%202021%2C%2077%20transgender,office%20in%20the%20United%20States.)
Most relatively minor roles, but today's Town Board member could go on to higher office.
https://www.nytimes.com/2021/05/08/us/politics/rachel-levine-transgender.html
Rachel Levine's wikipedia page (https://en.wikipedia.org/wiki/Rachel_Levine)
And the Government page (https://www.hhs.gov/about/leadership/rachel-levine.html)
Impressive qualifications that should probably be mentioned more often. Sorry, I'll stop mansplaining....
Post by: Great Order on April 08, 2023, 09:26:45 am
It's definitely weird seeing the same arguments being played out though. And weirder that you point this out and the response is "Yeah but *this time* we're right about the perverts in toilets"
Post by: Frumple on April 08, 2023, 10:19:29 am
The sad thing is it seems to be getting more traction, probably just because there's so many fewer trans people. LGB are common enough interactions with them once they started coming out the closet en masse became something you'd easily trip over. T (or enby, or whatever)... not nearly as much. Makes getting a picture of them as just another neighbor more difficult.
Make no mistake, though, prior to decades of dedicated effort by LGBT folks, the sentiment against LGB was every bit as hateful and bitter as it is against trans now. Again, it's largely the same fuckers behind it, the vitriol and violence they spit back then is exactly what they're spitting now, it was just against a less vulnerable target :-\
E: It really does probably need to be mentioned again, but the reaction in the old days to stateside LGBT demographics was also genocide, just with an even higher (so far, anyway) body count. The AIDs pandemic was very, very pointedly ignored back then expressly so it would rip a black line of death through the LGBT population -- and it did. That wasn't done unknowingly, it was active malice directed against the gays, and to hell with whatever got caught as collateral. The way history rhymes is fucking depressing sometimes.
Post by: jipehog on April 08, 2023, 10:50:27 am
And this is why hormone treatment and sports has to be thought over, in my opinion. Not from a starting point of actual transgendered athletes[..]I agree with everything you said with two minor exceptions. First, I think that bearing some major event a broader discussion isn't likely to happen, and LGBTQ activist are smart to focus on their interests by pushing the envelope through legal means. Second, seems that the government got tired from getting sued for discrimination and made this legal clarification, as oppose to initiating some new legislation on the subject.
Post by: Vector on April 08, 2023, 04:12:54 pm
To me the trans rights feels a lot more bitter than the LGB rights is the thing.
I genuinely think this is because we basically don't have any offline infrastructure. There are no "trans bars" and we get most of the hate and less of the support (because there's fewer of us). Basically nothing where we have somewhere to go where we're pretty sure that nobody will hurt us.
Post by: Starver on April 08, 2023, 06:21:01 pm
Gross simplification, based upon stereotypes and the like, but that's the kind of philosophy that is involved in such prejudices. So, a scale of acceptance (possibly from "some" to "none at all") ranging between the clearly effete/butch at one end to the "totally passing" at the other.
(Possibly an awful theory. IANASociologist, etc. And I don't resemble any of the parties involved, so it's not a first-hand perspective...)
Post by: Vector on April 08, 2023, 10:41:07 pm
Theory: Once 'out', a gay person transgresses by making themselves look and act different from the 'normal' person that they should/could be. You can at least be aware of them, tolerate them as long as it suits you, you know precisely whee they are, should you have any concerns about them.. But the "ultimate point" of being trans is to be at least as much like that they are not as they can, which means that they're dangerous to the less accepting kind of worldviews.
With respect, I don't think that any of this is true... I can see why people would see it that way, but for example, for nonbinary people who don't exist, the goal may be to deliberately be/exist as openly Other.
Many binary trans people want to pass. Many also aren't that worried about it.
Post by: KittyTac on April 09, 2023, 12:22:54 am
Post by: EuchreJack on April 09, 2023, 01:51:22 am
To make things worse, the Computer systems aren't as easy to fix as paper forms. And Computers have taken over.
The Computer only accepts two answers, and fails to proceed without that answer.
Post by: alway on April 09, 2023, 02:35:43 am
Post by: Starver on April 09, 2023, 06:16:26 am
But there'll be other effects, as mentioned in response. Relative sparsity (even within a 'gay village' social centre) is probably not helpful, there may be more AA meetings than trans-support group events.
Perhaps even arising from a basis of benevolance from others. I'm now worried that while I've always(?) been happy to accept people, my not staring might be taken as passive-agressive by someone who is used to being stated at by all and sundry. Even if they'd prefer not to be. - I'd consider myself a trans-ally, but I'm not particularly good at social balancing, so what if my 'normal' stand-offishness is interpreted as an 'attitude' towards someone (even when also exhibited towards anyone else, book-ending this particular encounter). Or, through anxiety from over-thinking it[1], go into a meet-and-greet wrongly in other ways.
...I was summarising that other thing, though, and you can definitely consider it debunked, if you will. It was just a late-night jump to a rather narrow thought-experiment about what I thought was being described.
[1] It was bad enough at a 'clan meet', the other day.
Spoiler: Thread-irrelevent spiel (click to show/hide)
Post by: Magmacube_tr on April 12, 2023, 03:42:06 pm
I see those bastards who call their transphobia and bigotry as protecting children, and fume. Reaaon? I mean, what gallantry, right?
When those children who you are claiming to protect get traumatised and die because of the persecution you yourself put upon them, that is not exactly protecting them is it?
Just say you are a bloodthirsty maniac who delights in seeing children die, like you are. You are not fooling anybody
SPINELESS VERMIN
Post by: McTraveller on April 12, 2023, 03:48:12 pm
Quote
Of all tyrannies, a tyranny sincerely exercised for the good of its victims may be the most oppressive. It would be better to live under robber barons than under omnipotent moral busybodies. The robber baron's cruelty may sometimes sleep, his cupidity may at some point be satiated; but those who torment us for our own good will torment us without end for they do so with the approval of their own conscience.
Post by: alway on April 13, 2023, 06:47:36 pm
Post by: Great Order on April 13, 2023, 09:43:39 pm
It's like the abortion ban just unleashed a torrent of hateful insanity.
Post by: Frumple on April 13, 2023, 10:32:06 pm
... I'd probably expect it to get worse before it (hopefully) gets better. There's a presidential election next year, reactionary fucksticks aren't going to get quieter in the near future :-\
Post by: Vector on April 13, 2023, 10:46:31 pm
(I don't mean here. I mean IRL where they have been treating me like I am complaining about nothing for years).
Post by: Great Order on April 14, 2023, 04:27:17 pm
Screw you, Origami Customs.
Post by: EuchreJack on April 15, 2023, 06:39:27 pm
Welp, spent £100+ on tucking underwear. They arrived, and they're not really all that similar to how they appeared on the site. Made of some crappy thin material that you can literally see through that feels artificial as all hell. Took them far longer than they'd said to arrive too, and it seems unlikely I can get a refund due to them being based in a foreign country and having a no refunds policy.Looks like you got scammed.
Screw you, Origami Customs.
In the future, you'll want to stick with reputable vendors.
Best to get advice from folks before spending that kind of money.
And screw you, Origami Customs!
Oh, they're in Montreal. You can probably get a refund from them.
Protip: Complain in French, if you possess that language knowledge.
Post by: scriver on April 16, 2023, 08:25:50 am
Post by: Great Order on April 16, 2023, 01:16:39 pm
Post by: scriver on April 17, 2023, 02:08:11 am
Post by: Great Order on April 18, 2023, 05:24:42 am
Unfortunately, there's not a lot I could do. If they were UK-based I'd be able to take them to small claims but that ain't happening and it's probably not worth the effort if I could. I'll just have to be content with warding away any potential customers.
EDIT: I've found another method of attack.
Tried them on (And holy fuck are they uncomfortable. The material's bad enough, but the stitching is stiff and digs in all around the groin area), and noticed that they don't actually sit like boyshorts.
Seems they sent me the wrong product. I did a bit of examining and comparison, and I'm 95% sure they're actually hipster briefs.
Post by: Great Order on April 23, 2023, 06:34:17 pm
They're willing to send the right product. No refunds. Ever. Under any circumstances.
Fuck it, I'll take them up on that. At least it costs them more and I can find some place to donate them to. I'll take some petty revenge over nothing.
Post by: scriver on April 24, 2023, 09:27:01 am
Post by: Imic on April 25, 2023, 03:44:06 am
What's that quote from CS Lewis? Ah yes:QuoteOf all tyrannies, a tyranny sincerely exercised for the good of its victims may be the most oppressive. It would be better to live under robber barons than under omnipotent moral busybodies. The robber baron's cruelty may sometimes sleep, his cupidity may at some point be satiated; but those who torment us for our own good will torment us without end for they do so with the approval of their own conscience.
I am framing this and hanging it somewhere conspicuous in my home
Post by: Vector on May 08, 2023, 03:50:13 pm
OK, assholes. You demolished one of your own country's best and brightest after decades of very expensive training and education. Good fucking work.
I don't know whether I should become depressed or what. I can finish my degree and move to a safe city in California and find some kind of work, maybe even pretty satisfying work, but with my PTSD DX I've seen online that I wouldn't even be able to get the most basic security clearance. So realistically, I'm going to be working in education until they force me out, and then after that I'd be code monkeying. Or digging ditches, I don't give a shit.
I'm writing about this here because I want people to understand that the current situation is affecting people you know well in direct and unambiguous ways. Hi lurkers o/
Post by: TD1 on May 08, 2023, 04:12:53 pm
Post by: EuchreJack on May 08, 2023, 04:31:06 pm
I've heard bits and pieces about America's slide, but mostly revolving around 'protect the children.' Are they attacking adults' jobs now?Yeah. Conservative states are eliminating Tenure to silence teachers and professors. They've also been organizing Parent Mobs to lobby school boards against anything progressive.
Vector couldn't get a job in Florida and be themselves, for instance.
California and NY are fairly safe, but safety is relative and subjective. Both states now have expanded their State-funded Colleges to the point that private colleges are slowly but surely going out of business, unless they advertise aggressively as ultra-conservative.
Post by: MrRoboto75 on May 08, 2023, 04:40:32 pm
Post by: jipehog on May 08, 2023, 05:57:21 pm
Can you elaborate, what is this 'America's slide' and why/how Vector would be affected in finding jobs in the exact science math department?I've heard bits and pieces about America's slide, but mostly revolving around 'protect the children.' Are they attacking adults' jobs now?Yeah. Conservative states are eliminating Tenure to silence teachers and professors. They've also been organizing Parent Mobs to lobby school boards against anything progressive.
Vector couldn't get a job in Florida and be themselves, for instance.
California and NY are fairly safe, but safety is relative and subjective. Both states now have expanded their State-funded Colleges to the point that private colleges are slowly but surely going out of business, unless they advertise aggressively as ultra-conservative.
Post by: McTraveller on May 08, 2023, 08:08:30 pm
Basically “we don’t like your kind around here, good luck finding a job” stuff again. History repeating before our eyes.
Post by: jipehog on May 08, 2023, 08:22:47 pm
Post by: Great Order on May 08, 2023, 08:35:39 pm
And while NY or Cali or some other liberal state might be safe at the moment, the only private institutions are ultra-conservative (And thus unsafe) and if a Rep government gets power there or wins a national election then the public institutions are seriously at risk of also becoming unsafe. So nowhere to go after that.
Post by: bloop_bleep on May 08, 2023, 10:18:12 pm
I can assure you that the "woke liberal" strongholds like where I live, San Francisco, are only becoming more pro-trans. Your view of the country as a whole may be clouded by your local area. Come here, it's great.
Post by: EuchreJack on May 08, 2023, 11:39:46 pm
But then again, rampant crime wave.
But yeah, we're fairly short on job openings in Education. (https://www.indeed.com/jobs?q=college+professor+math&l=new+york%2C+NY&vjk=ca95b5972a343a17) To be clear, I found only 27 jobs for math professors in the majority of New York (200 miles of New York City), and most were adjunct positions.
I had a good friend die as an unemployed adjunct professor. It's not as dark as it sounds, he was old and he drank, it was his poor health and not unemployment that did him in. And he seemed happy enough, having a good run in education previously along with other hobbies to keep him busy.
But we don't have work in NY, sorry.
Post by: jipehog on May 09, 2023, 06:55:55 am
Otherwise, it is my understanding there is some problems in the social sciences which belong to the 'Railgun and Spirituality Discussion' for which both woke and evangelical are equally failing in the pursuit of truth, with some dogmas beset by weak evidence.
Post by: Strongpoint on May 09, 2023, 12:43:59 pm
Jipehog, it is basic politeness to not use words describing a group of people (ethical, political, religious, whatever) unless the very same group describes themselves as such. Even if you dislike this group or strongly disagree with it. Evangelical is fine because they call themselves that, unlike something like, hmm. Bible thumpers. Woke is really NOT fine.
Personally, I am quite annoyed even by labels that aren't really meant to be offensive and used for convenience like "cishet". Woke is actually meant to be offensive
Also, I suspect that you have no clear definition of who this woke group are.
Post by: Maximum Spin on May 09, 2023, 02:12:24 pm
Oh... Wow. The W word. In this thread."Woke" literally started as a self-description, mainly among black activists in the US.
Jipehog, it is basic politeness to not use words describing a group of people (ethical, political, religious, whatever) unless the very same group describes themselves as such. Even if you dislike this group or strongly disagree with it. Evangelical is fine because they call themselves that, unlike something like, hmm. Bible thumpers. Woke is really NOT fine.
Personally, I am quite annoyed even by labels that aren't really meant to be offensive and used for convenience like "cishet". Woke is actually meant to be offensive
Also, I suspect that you have no clear definition of who this woke group are.
Post by: Starver on May 09, 2023, 02:53:42 pm
"I'm woke" isn't a problem, "You're/they're woke" is rarely (intentionally) a complement, without circumstantially establishing the former fact about the speaker first.
And then there's the appropriation (or implied appropriation) from being a certain minority's 'thing' (like "man", between themselves, in response to the traditional punching-down/imphantalising of "boy" by their oppressors. Like, I'd like to think I'm Woke, but maybe I'm a little bit too aware that not everyone would wish me to take on the mantle (if, indeed, I'm even sufficiently enlightened to do so). Does it technically also cover other minority/discriminated groups from those that coined it?
But it does tend to highlight the kind of people who are annoyed by 'wokeness', trying to make it a general perjorative for all they fnbd wrong with their version of the world. And good for them! No, hobestlt... They don't deserve to be comfortably wallowing in their prejudices, and given that they're going to be unreconstructedly annoyed by loads of actually quite good things.
Post by: voliol on May 09, 2023, 04:25:06 pm
Vector, I can sadly not give much advice due to being not from the United States (and having little insight into the academic careers here), but I hope it works out for you in the end. Be it in your state, in Cali or some other less regressive state, or even outside the borders of the union (how's Canada?).
Post by: jipehog on May 09, 2023, 04:26:13 pm
Personally, I was mostly interested to contrast what I have been hearing with another accounts from someone from the USA. But since the second part is what caught everyone attention (if only tangentially, and to tie this to previous discussion in 'Railgun and Spirituality Discussion' @Strongpoint) i will leave this: Two incompatible sacred values in American universities (https://www.youtube.com/watch?v=Gatn5ameRr8)
What are the reasons, when someone is recoounting experiencing oppression due to being trans, in the LGBTQ+ thread, to tell them to go somewhere else?:o I think you either misread or confused me with someone else.
Post by: EuchreJack on May 09, 2023, 04:54:51 pm
Post by: bloop_bleep on May 09, 2023, 10:55:59 pm
I'm gonna miss jipehog when he gets banned...
Shush. He doesn't get into much trouble.
Post by: Strongpoint on May 09, 2023, 11:46:26 pm
"Woke" literally started as a self-description, mainly among black activists in the US.Etymology is irrelevant. Languages mutate. Also, it was a way more narrow group of people than what is meant nowadays (Not that there is a clear definition)
Post by: KittyTac on May 10, 2023, 12:49:50 am
Post by: jipehog on May 10, 2023, 03:47:13 am
Post by: Vector on May 11, 2023, 12:41:17 am
- I have been harassed in public for being suspiciously trans in California (while doing literally nothing wrong/overtly trans-flavored, i.e. no visible pride flags or whatever)
- I enjoy attending drag shows
- I enjoy reading books about and by trans people. I am a very heavy-duty library user
- I enjoy being able to use restrooms in public spaces without being worried about criminal charges or harassment. When available, I always use all-gender restrooms
- I want and need ready access to abortion. I find the concept of being pregnant kind of horrifying
- I may need access to gender-affirming care (medical transition) or tools like PreP
- If I had a trans child, I would allow them to transition, too, because jesus christ been there done that.
- I have on numerous occasions considered taking advantage of California state laws that would allow me to change my gender markers on legal documents to an X
- I, like most people, do not enjoy being misgendered, and people passing laws about it being ok to misgender schoolchildren doesn't give me the most faith in the surrounding society
- I really struggle emotionally when I experience targeted harassment and nothing about my present workplace environment makes me think that continuing in a career in the exact sciences will somehow result in an "ok" degree of harassment.
Finally, yes, trans people are a protected class in California and New York. Great! Do those protections have teeth? Do any universities there have tenure-track positions in the very specific area of mathematics in which I'm getting a degree? Can I build a national career based on postdoc positions from trans safe states only? What about the locations of where the big career-building math conferences are held? For example, is the International Congress of Mathematicians going to meet in Russia again? Will I be able to get invitations to present at seminars, over Zoom say, in unsafe states? Or will I need to lose out on those opportunities?
The point here is not to say "I know it will be like X Y or Z." The point is that a thinking person looks at this situation, says: "well, I know of two working mathematicians in the whole country who are trans and sentiment is becoming worse and worse and worse. I will have to figure out what to do next."
Post by: Rockeater on May 11, 2023, 05:19:03 pm
Post by: Great Order on May 11, 2023, 09:12:15 pm
Post by: EuchreJack on May 13, 2023, 12:07:42 am
The point is that a thinking person looks at this situation, says: "well, I know of two working mathematicians in the whole country who are trans and sentiment is becoming worse and worse and worse. I will have to figure out what to do next."How many working mathematicians in the US were openly trans 20 years ago?
How many are you likely to be unaware of, given your pool of known working mathematicians and expected total of known working mathematicians?
Post by: jipehog on May 13, 2023, 02:49:18 am
So, I'm going to clarify via a couple of bullet points:Since you didn't quoted anyone specific, i'd clarify that I am curious about the mentioned change in the last few months, labled as countrywide slide and alluded to widespread changes in univesrties (and education) system which would have wider implications. I don't belive anyone have questioned your expirences or the hardship of trans people in society as whole
Otherwise, this thread is usually more active, I hopped that by now someone with applicable experience in what you are going through would offer some advice. Best I can offer is an apology if the terminology ruckus have made you feel uncomfortable and in need to defend/educate about your position, I know this can get daunting over time.
Post by: Great Order on May 13, 2023, 04:29:32 am
I don't know if I'm looking for something so I'm imagining it, or if I'm right, but I certainly feel like my face has got a bit more feminine, especially when I smile. It's not feminine, not yet (I mean, 5 months of hormones and it's likely my testosterone hasn't dropped enough, we'll be seeing about GnRH agonists soon, but regardless I'm not expecting to look like a woman), but it's like there's the faintest ghost of a woman's face there.
Post by: Salsa Gal on May 18, 2023, 12:35:50 am
Post by: scriver on May 18, 2023, 01:24:27 am
Post by: TD1 on May 18, 2023, 06:03:39 am
Post by: Rose on May 18, 2023, 11:11:27 am
Post by: Rolan7 on May 18, 2023, 12:29:00 pm
Post by: scriver on May 18, 2023, 12:31:04 pm
Blame R2-D2 for the stress form
Though, for some reason, when I start sounding it out in my head rather than just word it out quickly, my head really wants add a second B in before the T. Elgeebee beeteequeue
Post by: Starver on May 18, 2023, 05:24:52 pm
Spoiler: I was going to line up some logos... (click to show/hide)
Post by: Frumple on May 18, 2023, 08:06:30 pm
There's days I'm kinda' disappointed GSRM/GRSM (Gender, Romantic, and Sexual Minorities) didn't catch on, though I suspect it's 'cause it's a little too broad. Could probably fix it slapping a "consensual" in there somewhere, but eh.
El jibbity's a fine compromise, though.
Post by: MrRoboto75 on May 18, 2023, 08:36:15 pm
Post by: Salsa Gal on May 18, 2023, 10:32:39 pm
There's days I'm kinda' disappointed GSRM/GRSM (Gender, Romantic, and Sexual Minorities) didn't catch on, though I suspect it's 'cause it's a little too broad. Could probably fix it slapping a "consensual" in there somewhere, but eh.
God this, I'm so mad nobody ever made this the common term, you're the first time I've seen anyone even mention it in like 4 years. It's so much better than actually trying to list everything that could be contained under the acronym. I still try to use it sometimes, but most of the time I end up having to explain what it means all over again.
Post by: scriver on May 19, 2023, 04:39:00 am
But I'm a label conservative, so take that with a grain of salt. I was just thinking when I posted my above post of how I used to belittle the plus part but over the years I've grown quite fond of it to the point where it's my default that I don't want to budge from now (frumple's * upset me ;) ). It just takes longer for me.
And, to be fair, with GRSM you could make a lot of bad GRRM-sexual puns
Post by: Starver on May 19, 2023, 05:59:07 am
(Oh the irony, that as I'm replying my tablet indicates that it has dropped out of 4G into the E signal type (missing out H+ and H, etc). And I'm not even moving about.)
And I consider myself "one of the 'A's in LGBTQIAA++", so I'm not sure GRSM is inclusive of me. I'm being oppressed!
Post by: Great Order on May 19, 2023, 07:28:25 am
Post by: Frumple on May 19, 2023, 08:03:56 am
And I consider myself "one of the 'A's in LGBTQIAA++", so I'm not sure GRSM is inclusive of me. I'm being oppressed!The As would pretty straightforwardly fall under romantic (aro) or sexual (ace) minority, wouldn't it? Unless there's a third sort of A out there.
It'd be in the sense that atheism is a position on theistic belief... which there's argument about at times from various strains of atheist, but it's probably close enough for general use.
Post by: Starver on May 19, 2023, 12:29:49 pm
Ah I'd lazily put those two together as the one A. Mark me down (primarily, and hopefully) as Ally. But that's why I preserve the plusses. ;)And I consider myself "one of the 'A's in LGBTQIAA++", so I'm not sure GRSM is inclusive of me. I'm being oppressed!The As would pretty straightforwardly fall under romantic (aro) or sexual (ace) minority, wouldn't it? Unless there's a third sort of A out there.
Quote
It'd be in the sense that atheism is a position on theistic belief... which there's argument about at times from various strains of atheist, but it's probably close enough for general use.I'm much happier arguing my triple-A position on that issue: Atheist agnostic apatheist. (Don't believe, don't see any possibility of certainty, don't think it's worth bothering about.)
Post by: Grim Portent on May 19, 2023, 01:28:38 pm
And I consider myself "one of the 'A's in LGBTQIAA++", so I'm not sure GRSM is inclusive of me. I'm being oppressed!The As would pretty straightforwardly fall under romantic (aro) or sexual (ace) minority, wouldn't it? Unless there's a third sort of A out there.
It'd be in the sense that atheism is a position on theistic belief... which there's argument about at times from various strains of atheist, but it's probably close enough for general use.
Ally is sometimes added to the A's. Depends a bit on who you ask, and also on when. The umbrella abbreviation has grown a lot over the years.
I like to include it personally, anyone who supports equality is as much a part of the community as any other member of the alphabet mafia imo. Friends are family so to speak. So I would put at least 3 A's, Asexual, Aromantic and Allies.
GRSM is a pretty good fit for a more scientific descriptor, the sort of thing you would use on a census or in a paper on systemic issues specifically focused on people who fit the criterion, but it's not really a good term for the community itself, which has a lot of people who are not themselves GRSM in it even if many are only peripherally involved. You could say GRSM and Friends, but that sounds like an old superhero cartoon.
Post by: scriver on May 19, 2023, 01:31:02 pm
Post by: Maximum Spin on May 19, 2023, 01:39:14 pm
Post by: EuchreJack on May 19, 2023, 01:46:18 pm
Why does it matter what the label does or does not include? Surely that's not the important thing here.I gather you don't work with people and groups for a living.
The whole point of labels is to divide people.
Tell the blacks, the browns, and the others that they're different, and suddenly they need a white man to unify them. Start talking about the rights of people of color, and suddenly they figure out that they can start running their own political candidates.
... actually, good point Max.
(FYI, I lump Maximum Spin, MaxtheFox, and Maxtm into one entity, generally. But Maximum Zero usually gets his own identity, because I don't like getting bodyslammed)
Post by: Maximum Spin on May 19, 2023, 02:01:56 pm
I gather you don't work with people and groups for a living.
The whole point of labels is to divide people.
Tell the blacks, the browns, and the others that they're different, and suddenly they need a white man to unify them. Start talking about the rights of people of color, and suddenly they figure out that they can start running their own political candidates.
... actually, good point Max.
So uh, I don't want to make a big deal about this again because I know you don't mean it this way, but you are basically saying that minorities are too dumb or gullible to organize politically unless white people phrase it just right.
Blacks figured out how to run their own political candidates back when they were still called 'negroes', or worse (https://en.wikipedia.org/wiki/Frederick_Douglass).
People aren't really that easily led.
Quote
(FYI, I lump Maximum Spin, MaxtheFox, and Maxtm into one entity, generally. But Maximum Zero usually gets his own identity, because I don't like getting bodyslammed)MaxtheFox is fine, but the cull:square dude called me a right-wing paleo dieter, so I'm not going to sign off on that one.
Post by: Starver on May 19, 2023, 02:13:37 pm
Why does it matter what the label does or does not include? Surely that's not the important thing here....as a more direct answer, my own 'raising' of the issue was just a flippant faux-outrage at being 'out-grouped' just because I was (adjacently) outside those various sets of people who could actually 'come out'... No real fuss, it just sparked a more semantic discussion than anticipated.
(Not that I'm seriously demanding to be part of it... I'm merely so happy for those that are that I'll readily be associated with y'all, and be an advocate, if anyone wants me to. So however anybody wants to reclassify and recombine, if there's a slot for me then I'd hope you could consider me in it.)
Post by: Strongpoint on May 19, 2023, 02:25:35 pm
Like, I dunno, a lesbian who is also a radical feminist may not want to have anything to do with T and have extremely transphobic views. Or a religious asexual may find the LGB disgusting, sinful, and worthy of execution.
Post by: Grim Portent on May 19, 2023, 02:53:54 pm
I think not all people who fall under the definition of LGBTQ+ actually want to be grouped together.
Like, I dunno, a lesbian who is also a radical feminist may not want to have anything to do with T and have extremely transphobic views. Or a religious asexual may find the LGB disgusting, sinful, and worthy of execution.
Broadly correct, indeed there's a transphobic organisation in the UK that calls itself the LGB Alliance as I recall. According to their own membership they are something like 70-80% hetero (and skew very old to my recollection,) but that still means there's some transphobic self-reported homosexuals or no-answers in there.
It's also a way to boost the visibility of the smaller groups. LGB is the biggest part of the community by a large margin, so a lot of the others would just get lumped in with us rather than being seen as their own things. Transgender people were often seen as just crossdressing homosexuals for example before some of them really pushed for recognition. Carving out their own space and recognition is something they put a lot of work into, but they are still part of our umbrella group. Same principle applies to all the others, they aren't the same thing as us, so they should get their own space on the label but we should all collectively campaign for each other's rights to be expanded and upheld.
There isn't really a good collective word for the community, it covers a huge swathe of people who are sometimes only linked in that they don't conform to traditional assumptions for their respective society, so alphabet spaghetti it is.
Post by: EuchreJack on May 19, 2023, 10:16:34 pm
I appreciate that. I recall how blacks had several members in Congress before the Ku Klux Klan started terrorizing the South post-Civil War.I gather you don't work with people and groups for a living.
The whole point of labels is to divide people.
Tell the blacks, the browns, and the others that they're different, and suddenly they need a white man to unify them. Start talking about the rights of people of color, and suddenly they figure out that they can start running their own political candidates.
... actually, good point Max.
So uh, I don't want to make a big deal about this again because I know you don't mean it this way, but you are basically saying that minorities are too dumb or gullible to organize politically unless white people phrase it just right.
Blacks figured out how to run their own political candidates back when they were still called 'negroes', or worse (https://en.wikipedia.org/wiki/Frederick_Douglass).
People aren't really that easily led.
I was more saying that white politicians like to divide up...literally everyone. And marketers, who are basically the same thing.
How dare he! We all know you would NEVER eat a salad!Quote(FYI, I lump Maximum Spin, MaxtheFox, and Maxtm into one entity, generally. But Maximum Zero usually gets his own identity, because I don't like getting bodyslammed)MaxtheFox is fine, but the cull:square dude called me a right-wing paleo dieter, so I'm not going to sign off on that one.
Post by: Salsa Gal on May 20, 2023, 02:09:23 am
And I consider myself "one of the 'A's in LGBTQIAA++", so I'm not sure GRSM is inclusive of me. I'm being oppressed!
Huh, which one? I'm only aware of asexual.
Post by: Vector on May 21, 2023, 09:20:48 pm
So, I'm going to clarify via a couple of bullet points:Since you didn't quoted anyone specific, i'd clarify that I am curious about the mentioned change in the last few months, labled as countrywide slide and alluded to widespread changes in univesrties (and education) system which would have wider implications. I don't belive anyone have questioned your expirences or the hardship of trans people in society as whole
Otherwise, this thread is usually more active, I hopped that by now someone with applicable experience in what you are going through would offer some advice. Best I can offer is an apology if the terminology ruckus have made you feel uncomfortable and in need to defend/educate about your position, I know this can get daunting over time.
Erin Reed's coverage is imperfect, but she has a fairly comprehensive (https://www.erininthemorning.com/) newsletter tracking legislative changes. There are now four states with legislation medically detransitioning adults and at least one state (Florida) with a criminal bathroom law. At the beginning of the year, there were zero.
How many working mathematicians in the US were openly trans 20 years ago?
How many are you likely to be unaware of, given your pool of known working mathematicians and expected total of known working mathematicians?
The advice that's going around from People Who Know is "just keep your head down and do the minimum right now." The current legislative movement is career-ending.
Yes, twenty years ago there were very, very few transgender mathematicians. The law and our social norms destroyed generation after generation. Ten years ago transition was almost unthinkable for a lot of people. I would know, I was looking up transition resources back then and there was literally almost nothing. "Nonbinary" was not a thing that almost any of the population had a word for. I didn't know any words for what I was; I just said I was "both and neither" and overall, in my experience, folks were unrelentingly cruel about it.
I'm trying to tell you: things were better in the US. They are now bad and getting worse.
Huh, which one? I'm only aware of asexual.
AAA is usually agender, aromantic, asexual.
Post by: Salsa Gal on May 21, 2023, 10:53:34 pm
Huh, which one? I'm only aware of asexual.
AAA is usually agender, aromantic, asexual.
So yeah those are gender, romantic, or sexual minorities, so it definitely counts
Post by: EuchreJack on May 22, 2023, 10:35:52 pm
...then I remember that it's almost June (https://en.m.wikipedia.org/wiki/June).
Oh well, enjoy it while it lasts.
Post by: TD1 on May 23, 2023, 04:43:24 am
Quote from: Vector
'Legislation medically detransitioning adults'
Wait, does that mean enforced medical procedures?? Because if so, :o >:(
Or does it mean legislating for folks' rights to 'detransition'?
Post by: Great Order on May 23, 2023, 05:28:11 am
Don't think there's a lot they can do about undoing most genital surgeries. Phalloplasties are difficult enough without having had a vaginoplasty first, and the inverse is true (Although vaginoplasties are easier because it's much easier to remove tissue than add it). Breast implants can undo mastectomies though, not that the US government, let alone Republicans, would ever pay for them. If anything I expect the Reps would more likely demand you pay for it and then arrest you if you can't.
Post by: alway on May 23, 2023, 09:45:35 am
The results of this are frankly awful. It's hard to find a doc experienced with managing hormones as is; they're generally all full, so even going out of state, there's not much you can do about it.
Physically, the results of going off hormones is basically menopause combined with awful dysphoria. You know what's wrong, you know how to fix it, but are prevented from doing so, as the state has taken away your bodily autonomy. Real body horror shit.
Post by: Salsa Gal on May 24, 2023, 06:45:11 am
I wonder if Google decided to stop being evil.
Physically impossible.
Post by: MaxTheFox on May 24, 2023, 07:57:38 am
The thread title has made me realize that I am now the person who pronounces it "El Jibbitty"I do too.
Post by: Great Order on May 24, 2023, 08:09:02 am
Well, it's somewhere in the realm of random probability causing every atom in the sea to randomly move upwards into the sky simultaneously.I wonder if Google decided to stop being evil.
Physically impossible.
Post by: TD1 on May 24, 2023, 08:53:49 am
Post by: EuchreJack on May 24, 2023, 11:50:01 am
Post by: Starver on May 26, 2023, 08:21:49 am
(Though BC doesn't control all cycle-sport here, much as they like to make everyone think so. I know that at least one other governing body is in a position to quickly synchonise with BC/UCI rulings if it chooses to, quicker than it originally did to become permissive, but I'm not sure if it will tend to go back to dismissive again so automatically. It certainly ought to wait until the end of the season, though, even if the board thinks it must. And then there's time to go to the membership.)
Post by: EuchreJack on May 26, 2023, 09:16:05 am
Post by: dragdeler on May 26, 2023, 10:46:38 am
Post by: jipehog on May 26, 2023, 10:52:19 am
Or, if a rogue cycling promoter wanted to make some real money, they'd go full-inclusion in defiance of the BC decision.There is a reason such divide exist in competitive sports. An open sports events where everyone competes together means that biological female would be excluded from wining, as athletic performances clearly show that the best result female ever achieved in Olympics has been outperformed by hundreds and thousands of males tens of thousands of times.
With this in mind and current data suggesting that Trans female enjoy performance advantage, what you suggest would at best be fad, since most female (who already get payed less than males) would not choose to participate, and trans community is too small to sustain such events. So fad slogans on its own wouldn't pave the way forward but further research to figure out what fields are comparable or come up with different classifications that would be fair for everyone.
Post by: Rolan7 on May 26, 2023, 11:31:51 am
Just factually untrue. Individual women win against individual men all the time, despite professional women's sports receiving far less funding and thus training budget and general support. It is harder to be a woman athlete, and less financially rewarding, yet they still sometimes outcompete... when they're allowed to. This is actually why women's sports leagues were formed, because men couldn't handle occasionally losing to mere women.Or, if a rogue cycling promoter wanted to make some real money, they'd go full-inclusion in defiance of the BC decision.There is a reason such divide exist in competitive sports. An open sports events where everyone competes together means that biological female would be excluded from wining,
as athletic performances clearly show that the best result female ever achieved in Olympics has been outperformed by hundreds and thousands of males tens of thousands of times.The fallacy here is looking at record-setting individuals to make policy for general competition. By this logic, it's unfair for US swimmers to compete against any other swimmers because Michael Phelps is just that good.
With this in mind and current data suggesting that Trans female enjoy performance advantage,Citation needed. Here's one that acknowledges some advantage:
https://www.dw.com/en/fact-check-do-trans-athletes-have-an-advantage-in-elite-sport/a-58583988
Trans women usually have insignificant athletic advantage over cis women, if any, after enough time on HRT. There's one exception: The data suggests a permanent 10% advantage in running speed, likely due to height/bone size (after male puberty, which conservatives are forcing on trans girls).
Does that 10% justify excluding trans people from all sports, or rather height categories for track and cross-country competitions? Trick question: I don't think it justifies either. There are countless factors which are more significant.
For other sports any advantage is even less detectable. There are, in fact, physical advantages to being a woman. This is presumably why, despite incredibly dishonest rhetoric, trans people are not dominating sports at any level. If the propaganda was true then we'd be snatching up gold medals by now. We're not.
what you suggest would at best be fad, since most female (who already get payed less than males) would not choose to participate, and trans community is too small to sustain such events. So fad slogans on its own wouldn't pave the way forward but further research to figure out what fields are comparable or come up with different classifications that would be fair for everyone.The real issues facing women athletes in general are pretty important to me, as a feminist. Professional sports is designed to be resistant to change, for better or for worse, and I don't have a magic bullet to fix the deep iniquities in it.
The issue certainly isn't trans people. These "concerns" are nothing more than a cudgel used by paternalists to depict us as attacking their dainty weak women, which is all sorts of fucked up, and I'm sick to death of people peddling it.
I don't mean that personally, jipehog, as you're far from the only person who brings this issue up. I'm just completely exhausted with it. Which is EXACTLY its purpose. It's FUD, meant to keep people playing defense and radicalize credulous moderates.
I'd say I'd rather talk about the situation in Florida, or the heaps of new bills being proposed in my home state of NC, but I don't want to do that either. I just got home from three days of caring for my dad who, last night, opined that people who don't procreate are pointless and might as well die (and yeah, I'm fully out to him). This weekend I plan to love my partner, play some mindless video games, and do my level best to stay away from any alcohol because I know I'll go on a bender if I get the chance.
so sick of this sports bullshit. If people really care about sports then maybe THEY should fix them. I hate being expected to fix something I didn't break just because lying misogynists are accusing US of misogyny for trying to participate.
On the bright side I looked like crap a few days ago, after exercising (I'm sorry!! I know that's extremely political of me!!) and I got correctly gendered to my complete surprise. I really needed that.
Post by: Strongpoint on May 26, 2023, 11:48:28 am
Quote
Just factually untrue. Individual women win against individual men all the time, despite professional women's sports receiving far less funding and thus training budget and general support. It is harder to be a woman athlete, and less financially rewarding, yet they still sometimes outcompete... when they're allowed to. This is actually why women's sports leagues were formed, because men couldn't handle occasionally losing to mere women
This is some serious reality-denying stuff. No. Women can't compete with men in almost all sports. They simply can't. I am really curious to see some examples of "the Individual women win against individual men all the time"
I do agree that after a few years of HRT advantage of transwomen is minor enough to allow meaningful competition and there are enough evidence of that (like scientific studies)
Post by: EuchreJack on May 26, 2023, 11:59:38 am
Ah, but the cycling rule that allowed trans athletes did in fact have testing and rules regarding hormone levels.QuoteJust factually untrue. Individual women win against individual men all the time, despite professional women's sports receiving far less funding and thus training budget and general support. It is harder to be a woman athlete, and less financially rewarding, yet they still sometimes outcompete... when they're allowed to. This is actually why women's sports leagues were formed, because men couldn't handle occasionally losing to mere women
This is some serious reality-denying stuff. No. Women can't compete with men in almost all sports. They simply can't. I am really curious to see some examples of "the Individual women win against individual men all the time"
I do agree that after a few years of HRT advantage of transwomen is minor enough to allow meaningful competition and there are enough evidence of that (like scientific studies)
That is being Abandoned in favor of a "No Trans Allowed" rule.
Post by: jipehog on May 26, 2023, 12:30:10 pm
For other sports any advantage is even less detectable. There are, in fact, physical advantages to being a woman.
Yes, that is why I said that "further research to figure out what fields are comparable or come up with different classifications that would be fair for everyone".
Otherwise you should be mindful about the balance between faith and railguns when claiming facts, especially in new field with a lot of political interest in it. Science tend to be shaped by systematic research not headlines.
Post by: Rolan7 on May 26, 2023, 12:47:36 pm
I cited a story about it?
That's not the same as "they didn't find that men are superior yet, but we're still looking". That would be a highly unscientific conclusion to draw from the actual data.
Anyway in the meantime we're going ahead with institutional anti-trans rules because the data never actually mattered. Is was naive to think decision-makers were asking for it in good faith. People feel women can't compete (I wonder why) and must be "protected" from equality. Like they were protected from having jobs, or voting, or bodily autonomy. It's paternalism, still misogyny but extra-insidious.
Post by: EuchreJack on May 26, 2023, 01:01:25 pm
You're burden shifting.For other sports any advantage is even less detectable. There are, in fact, physical advantages to being a woman.
Yes, that is why I said that "further research to figure out what fields are comparable or come up with different classifications that would be fair for everyone".
Otherwise you should be mindful about the balance between faith and railguns when claiming facts, especially in new field with a lot of political interest in it. Science tend to be shaped by systematic research not headlines.
Putting the burden on Trans to prove beyond a reasonable doubt that in no way does them being Trans give them any advantage whatsoever.
You don't see how that is unfair?
Why not reverse it?
Why not "And Trans should be allowed as human beings with equal rights and equal protections, unless and until it is scientifically proven to a reasonable scientific consensus that Trans enjoy an unfair advantage necessitating that their rights to their own identity should be invaded in the interests of fair competition?"
Post by: Maximum Spin on May 26, 2023, 01:14:23 pm
Extensive research has demonstrated a staggering, huge difference between males and females - that is, male advantage - in most kinds of athletic performance. The strongest difference is in upper body strength, but females have ~20% less lower body strength on average as well. An important factor I also don't often see mentioned is that the female hip structure, in order to accommodate childbirth, is less efficient for walking and running by a surprising margin. However, there does seem to be a difference in liver metabolism, which doesn't look like it's been studied very much, which seems to make the curve flip in ultramarathons where energy storage becomes more important than physical ability. Still, that's not what most people typically think of as an athletic advantage, and it doesn't apply in any of the cases I have ever heard people arguing about. Even amateur sports teams of boys under 18 regularly beat professional women's teams in matches - I hear this is often done in soccer, like this example: https://www.cbssports.com/soccer/news/a-dallas-fc-under-15-boys-squad-beat-the-u-s-womens-national-team-in-a-scrimmage/
See for example:
https://law.duke.edu/sports/sex-sport/comparative-athletic-performance/
https://link.springer.com/article/10.1007/BF00235103
https://journals.physiology.org/doi/abs/10.1152/jappl.1991.71.2.644
https://pubmed.ncbi.nlm.nih.gov/17186303/
I've also heard completely unsourced claims that female joints are more flexible, supposedly giving female athletes certain advantages, but this appears to be a complete lie, since joint injuries are far more common in women than men: https://www.health.harvard.edu/blog/the-gender-gap-in-sports-injuries-201512038708 ; the reason for this seems to be that female joints are indeed less stable, meaning they move more easily, but not more flexible, meaning they can't accommodate this greater range of motion without injury. Joints may also become more flexible during pregnancy, so that the pelvis can expand; but I don't know of any studies testing how this applies to athletics, and I'm unclear on whether it actually means a reduced injury rate either, or just a wider range of motion.
There have been occasional "studies" by "researchers" that claim to find things that literally every middle school gym teacher knows aren't true - that there's no performance advantage between males and females - but this is absolutely not the scientific consensus, and these studies just don't replicate, because they're not real. Parapsychologists keep churning out studies finding evidence for psychic powers, too. It's motivated reasoning.
Why not "And Trans should be allowed as human beings with equal rights and equal protections, unless and until it is scientifically proven to a reasonable scientific consensus that Trans enjoy an unfair advantage necessitating that their rights to their own identity should be invaded in the interests of fair competition?"Well, it has been. Also, what is a "right to one's own identity"? That's a silly concept. Would you be okay with keeping the same structure, but renaming it to "genetically male" and "genetically female"?
Post by: Maximum Spin on May 26, 2023, 01:16:04 pm
ETA: By the way, it's been proven that at least the majority of these differences exist before puberty and are unrelated to testosterone and other hormones.
Post by: Starver on May 26, 2023, 01:33:08 pm
I'm anti cycling races, such a dumb sport they all stay in peloton until the last straight, and for that everybody needs to be bothered with roads closed off? Sit them on stationary bikes, measure their times and tape their mouths shut! At least there will be some variation in the ranking that way.Not all cycle events are like that. I can point you at almost 300 competitors who will be riding in nine different events across thebcountry, tomorrow, at distances from 10 to 50 miles (and more on Sunday, including at least one of 100 miles) where there'll be no group riding. In fact, that's against the rules[1]. And no need for closed roads. And there'll be more participations than that sample, but I'd need to dig about a bit for what else is on. Then there's Audax/Randoneurs and general leisure cycling which I suspect motorists will notice far more (and complain about the MAMILs, probably, causing more perceived obstruction by not racing).
But this is a secondary issue. (And a "rogue promoter" might be in difficulty. It's possible to run things not under the respective umbrella organisation's rules... and likely some do ...but they might be in trouble if (e.g.) their insurance liability needs to be tested after not running officially/properly sanctioned events. In the case of "peloton" events, they also need explicit police permission, who may or may not require the involvement of BC.)
The 'technicalities' of the change in approach insofar as LGBT+ are already being discussed, I see. But, having sparked the diversion into a totally different discriminatory territory, I can at least try to remove common misconceptions regarding cycle racing on the road. (In Britain, at least... There are both more and less cycle-friendly countries, where the balance and type of competition will differ greatly).
But also you (@dragdeler) have sort of landed on the a very real sport (https://en.wikipedia.org/wiki/Bicycle_rollers#Roller_racing), excepting the part about effectively suffocating the riders. Not so common, at present, but I think I know of a village hall back room with such a four-roller 'clock' kit in it, that might need no more than a good oil (maybe also replace some perished rubber belts, though).
[1] Except for certain events, which none of those are. Or perhaps in the case the eight riders who will be riding the four tandems, where it would be mechanically impossible not to ride together. ;)
Post by: alway on May 26, 2023, 01:59:05 pm
Post by: Maximum Spin on May 26, 2023, 02:05:48 pm
And here we see examples of why transphobia and misogyny are the Spiderman pointing meme. Anyway, it's no surprise why bills taking away trans folks' bodily autonomy go hand in hand with bills taking away women's bodily autonomy, and are passed by the same fascists. There's no real interest in "protecting women" any more than there is interest in "protecting women" from having jobs or from black people or from immigrants or from engaging in politics. It's all about reinforcing supremacist notions and status quo hierarchies. Apply transphobia to that, and well, you get this! Trans people being repeatedly misgendered by proxy. Trans women being vilified (if you assume men are strictly superior, anyone who willingly is a woman must have ulterior motives and is suspect). Trans men are ignored and patronized as victims (oh those poor inferior women who have been misled into thinking they can be something better than they are; what an admirable notion, but ultimately confused). And nonbinary folks either lumped into one of these categories or otherwise denied to exist. Our autonomy is taken away simply because cis people find us inconvenient, that our existence might somehow impinge upon them pretending we aren't people deserving to exist in public like anyone else and engage in activities like anyone else. If you can't bother to afford us basic human dignity, why the fuck are yall cis people even in this thread?I am deeply concerned if you think athletic performance is evidence of absolute "superiority". That's an incredibly sexist, racist, and generally offensive notion, even if you only hold it to make accusations at other people.
Post by: Vector on May 26, 2023, 02:13:43 pm
Post by: Maximum Spin on May 26, 2023, 02:16:27 pm
I am unbelievably pissed that once again, the LGBTQ+ thread is being used as a "but is it even possible to integrate them into normal society???" thread. Fuck all y'all.I can't speak for everyone, but I don't think anyone here thinks that's impossible or even hard.
Post by: Starver on May 26, 2023, 02:48:48 pm
Anyway, it's "elite" competition. Which generally features the best of whatever category. But women are under-represented (as with many sports) and trans individuals are even rarer so more likely to see outliers/underliers that either persuade you that the elite-level trans individual (who was decent as a male, and dedicated enough to continue even while transitioning) has an apparent advantage or (when an amateur, not outstanding beforehand and it's not the competing but the taking part that drives their attempted continued participation) is clearly not as good as their adopted class's 'mainstream' participants.
My main worry is that it puts people off. Yes, possibly some AFAB women might get put off by a trans opponent[1]. But how to balance that against the trans opponent having to directly compete with AMAB men, which must be much more offputting, on aggregate. And some people just are in a league of their own, and may just happen to also be trans to confound the issue or suggest false advantages.
Squaring that circle is gonna be a delicate process. I think the UCI were wrong in their handling, and if that made BC switch to being wrong then I've got to hope that it doesn't create further ham-fistedness beyond them. (And we can look to the athletics and swimming worlds for other zipping/unzipping of considerations that might not be right.)
...but that's just retreading already covered territory. Only restating my own mostly ambivalent position to make this not a puff-piece for either extreme opinion.
[1] For both trans-directions, technically.
Post by: Strongpoint on May 26, 2023, 03:53:22 pm
Ah, but the cycling rule that allowed trans athletes did in fact have testing and rules regarding hormone levels.
That is being Abandoned in favor of a "No Trans Allowed" rule.
Frankly speaking, it is absolutely within the rights of the sports association. I personally don't mind if transwomen with low hormone levels will be allowed because, while they undoubtedly have an advantage, this advantage doesn't prevent meaningful competition. But what I don't mind is actually unimportant, what athletes and audiences of a particular sport want is what matters. Note: athletes and audiences, - not a small minority.
The right to compete in a particular league or competition IS NOT a basic human right, sorry. It just isn't. Minorities should be guaranteed basic rights and proportional political power, not getting every wish fulfilled.
Post by: Starver on May 26, 2023, 07:24:28 pm
But what I don't mind is actually unimportant, what athletes and audiences of a particular sport want is what matters. Note: athletes and audiences, - not a small minority.From my understanding, it isn't a grass-roots will. Certainly not the 'audience', which only has a "vote with its feet" influence, but are basically as likely to have any opinion as the general population (TERFs to 'FERT's, and everything between). I've heard a nearly full range from competitors/organisers/their representatives too. Caution, naturally, but also significant support for reasonable inclusion. It was under the air of inclusion that my cycling governing body was given freedom to mirror BC[1]
It seems to be a top-down edict (from UCI, which has cascaded and toppled more dominoes as it has entered BC's top-down structure) where any accomodations that there were have now been snatched back. And one that 'helps' a few occasional cis competitors (who might or might not find that they're competing against a trans one who might or might not even be a competative threat), yet hurts nigh-on 100% of trans competitors.
Add to that any related safeguarding issues (up to and including whoever they race against, are they also put into the matching facilities?) and there's the risk that you're just going to make it not worth the bother, to put it mildly. A more nuanced and inclusive situation (as was, at least in British Cycling) might not be perfect, but it'll be better than battening down the hatches in a regressive manner.
The alternative is further segregation and/or using a ariation of the system used for classifying paracyclists (intended to level the playing field, albeit a very much smaller playing field, but with a distinctly different flavour to the context of being inclusive for those with disabilities).
It's not so much wish-fulfillment as not having unnecessary roadblocks set up (to add to all the other problems that a person might be having where the organisation concerned has no hand in easing the situation or otherwise).
[1] A rule change was voted on, by representatives. On the following advice:
Quote
In the light of the recent well publicised decisions of British Cycling and UCI as to the requirements for a transgender cyclist to be permitted to compete and the potential need for a revision and/or a decision on eligibility to be made at short notice [...some lengthy procedural language here...] it may be imperative to act swiftly to implement changes in our policies to bring them into line with those of other National Governing Bodies.
Post by: EuchreJack on May 26, 2023, 10:47:46 pm
I am unbelievably pissed that once again, the LGBTQ+ thread is being used as a "but is it even possible to integrate them into normal society???" thread. Fuck all y'all.Sports are always going to be a tough nut to crack.
They're still segregated by gender.
A change in the rules in case anyone here is into cycle-racing in the UK (https://www.bbc.co.uk/sport/cycling/65718748).Going back to this particular example, it might help to explain, in the simplest possible terms, why this is bad.
(Though BC doesn't control all cycle-sport here, much as they like to make everyone think so. I know that at least one other governing body is in a position to quickly synchonise with BC/UCI rulings if it chooses to, quicker than it originally did to become permissive, but I'm not sure if it will tend to go back to dismissive again so automatically. It certainly ought to wait until the end of the season, though, even if the board thinks it must. And then there's time to go to the membership.)
Emily Bridges identifies as female.
She was unfortunately not born as such.
She has done everything in her power to fix that, to the point that her hormone levels read 'Woman".
Under the old rules, she could participate in the league that matched her gender.
Under the rule change, she must Abandon her gender and fake the gender she was assigned at birth, or not participate.
Post by: Maximum Spin on May 26, 2023, 10:59:06 pm
They're still segregated by gender.They're segregated by sex. That isn't the same thing.
Historically, the decision was made to extend extra protection to sporting activities for female persons, who cannot compete at the same level as males in the vast majority of popular sports, and whose separate sports leagues rarely had enough interest to really justify the expense of running them, so that many sporting opportunities at the time were available only to males. If we still wish to guarantee equality of opportunity to female athletes, specifically, and not just as a side effect of their being the majority of 'women athletes', then some kind of accommodation still has to be made. In general, I don't see why anyone would think it would be wrong to support female athletes too. The problem seems to be the use of the dated terminology 'women's sports', which was understood to refer to female athletes.
I would also like to express a second time, just to be clear, that... well, first, "hormone levels read[ing] 'woman'" isn't really a thing. Hormones don't work like that. But second, more importantly, hormone levels are not significant to the difference in athletic performance, which is caused by gross skeletomuscular structural differences that cannot ever be changed.
Post by: EuchreJack on May 26, 2023, 11:13:20 pm
Your sleazy law school article from Duke has already had it's methodology questioned.They're still segregated by gender.They're segregated by sex. That isn't the same thing.
Historically, the decision was made to extend extra protection to sporting activities for female persons, who cannot compete at the same level as males in the vast majority of popular sports, and whose separate sports leagues rarely had enough interest to really justify the expense of running them, so that many sporting opportunities at the time were available only to males. If we still wish to guarantee equality of opportunity to female athletes, specifically, and not just as a side effect of their being the majority of 'women athletes', then some kind of accommodation still has to be made. In general, I don't see why anyone would think it would be wrong to support female athletes too. The problem seems to be the use of the dated terminology 'women's sports', which was understood to refer to female athletes.
I would also like to express a second time, just to be clear, that... well, first, "hormone levels read[ing] 'woman'" isn't really a thing. Hormones don't work like that. But second, more importantly, hormone levels are not significant to the difference in athletic performance, which is caused by gross skeletomuscular structural differences that cannot ever be changed.
The sample size of 8 men and women in your Springer Link article is too small.
"A cross-sectional study of muscle strength and mass in 45- to 78-yr-old men and women"...is not the age group of most athletes, and thus irrelevant.
"Hand-grip strength of young men, women and highly trained female athletes" while it's questionable why the sample size of men exceeded women by three-to-one, I am just going to say that firm handshakes do not solely define all athletic prowess, especially in cycling, and move on with my life.
Finally "But, women are actually more prone than men to suffer many of the most common sports-related injuries. There are a variety of reasons for this "gender gap," and there is much about it that remains uncertain." Does NOT justify segregation of gender in non-contact sports such as Cycling.
Got any real science to back up your junk pseudo-science beliefs?
Post by: Strongpoint on May 26, 2023, 11:15:32 pm
Quote
Under the rule change, she must Abandon her gender and fake the gender she was assigned at birth, or not participate.
It is not true. Participating in the male (by sex) league has nothing to do with her gender. Yes, she will be DEMOLISHED in the male sport but... well it is one of the effects of body autonomy. You can't do things to your body that make you a worse athlete and then expect special rules just for you. And it doesn't change if you have good reasons to do so.
And I am amazed that some people pretend that leagues are
Post by: EuchreJack on May 26, 2023, 11:22:43 pm
QuoteUnder the rule change, she must Abandon her gender and fake the gender she was assigned at birth, or not participate.
It is not true. Participating in the male (by sex) league has nothing to do with her gender. Yes, she will be DEMOLISHED in the male sport but... well it is one of the effects of body autonomy. You can't do things to your body that make you a worse athlete and then expect special rules just for you. And it doesn't change if you have good reasons to do so.
And I am amazed that some people pretend that leagues aresegregatedseparated because of misogyny.
You clearly don't get the point, and frankly should leave this thread.
Post by: Maximum Spin on May 26, 2023, 11:35:34 pm
Your sleazy law school article from Duke has already had it's methodology questioned.Do you seriously not believe there are differences in athletic output between males and females? Have you ever actually watched a sport?
The sample size of 8 men and women in your Springer Link article is too small.
"A cross-sectional study of muscle strength and mass in 45- to 78-yr-old men and women"...is not the age group of most athletes, and thus irrelevant.
"Hand-grip strength of young men, women and highly trained female athletes" while it's questionable why the sample size of men exceeded women by three-to-one, I am just going to say that firm handshakes do not solely define all athletic prowess, especially in cycling, and move on with my life.
Finally "But, women are actually more prone than men to suffer many of the most common sports-related injuries. There are a variety of reasons for this "gender gap," and there is much about it that remains uncertain." Does NOT justify segregation of gender in non-contact sports such as Cycling.
Got any real science to back up your junk pseudo-science beliefs?
https://pubmed.ncbi.nlm.nih.gov/33572280/
https://pubmed.ncbi.nlm.nih.gov/8477683/
https://pubmed.ncbi.nlm.nih.gov/8194544/
https://journals.humankinetics.com/view/journals/jab/7/1/article-p3.xml
https://www.tandfonline.com/doi/abs/10.1080/10671315.1979.10615607
https://www.tandfonline.com/doi/abs/10.1080/00140138708969760
https://journals.lww.com/acsm-msse/Abstract/1983/15030/Biological_determinants_of_the_sex_difference_in.7.aspx
https://journals.sagepub.com/doi/10.1177/036354657900700415
https://europepmc.org/article/med/1275845
https://pubmed.ncbi.nlm.nih.gov/15795811/
https://pubmed.ncbi.nlm.nih.gov/7942046/
ETA: Accidentally left off this one https://scholar.princeton.edu/sites/default/files/brzycki/files/mb-2002-01.pdf
I could keep going. The only reason I stopped after a handful of links last time is that I didn't think anyone would seriously contest one of the most replicated and, frankly, blatantly obvious effects in the field.
Post by: Strongpoint on May 26, 2023, 11:38:06 pm
QuoteUnder the rule change, she must Abandon her gender and fake the gender she was assigned at birth, or not participate.
It is not true. Participating in the male (by sex) league has nothing to do with her gender. Yes, she will be DEMOLISHED in the male sport but... well it is one of the effects of body autonomy. You can't do things to your body that make you a worse athlete and then expect special rules just for you. And it doesn't change if you have good reasons to do so.
And I am amazed that some people pretend that leagues aresegregatedseparated because of misogyny.
You clearly don't get the point, and frankly should leave this thread.
What exactly don't I get?
I should leave the thread because?
Post by: EuchreJack on May 26, 2023, 11:58:33 pm
Well, I learned one thing today.Your sleazy law school article from Duke has already had it's methodology questioned.Do you seriously not believe there are differences in athletic output between males and females? Have you ever actually watched a sport?
The sample size of 8 men and women in your Springer Link article is too small.
"A cross-sectional study of muscle strength and mass in 45- to 78-yr-old men and women"...is not the age group of most athletes, and thus irrelevant.
"Hand-grip strength of young men, women and highly trained female athletes" while it's questionable why the sample size of men exceeded women by three-to-one, I am just going to say that firm handshakes do not solely define all athletic prowess, especially in cycling, and move on with my life.
Finally "But, women are actually more prone than men to suffer many of the most common sports-related injuries. There are a variety of reasons for this "gender gap," and there is much about it that remains uncertain." Does NOT justify segregation of gender in non-contact sports such as Cycling.
Got any real science to back up your junk pseudo-science beliefs?
https://pubmed.ncbi.nlm.nih.gov/33572280/
https://pubmed.ncbi.nlm.nih.gov/8477683/
https://pubmed.ncbi.nlm.nih.gov/8194544/
https://journals.humankinetics.com/view/journals/jab/7/1/article-p3.xml
https://www.tandfonline.com/doi/abs/10.1080/10671315.1979.10615607
https://www.tandfonline.com/doi/abs/10.1080/00140138708969760
https://journals.lww.com/acsm-msse/Abstract/1983/15030/Biological_determinants_of_the_sex_difference_in.7.aspx
https://journals.sagepub.com/doi/10.1177/036354657900700415
https://europepmc.org/article/med/1275845
https://pubmed.ncbi.nlm.nih.gov/15795811/
https://pubmed.ncbi.nlm.nih.gov/7942046/
ETA: Accidentally left off this one https://scholar.princeton.edu/sites/default/files/brzycki/files/mb-2002-01.pdf
I could keep going. The only reason I stopped after a handful of links last time is that I didn't think anyone would seriously contest one of the most replicated and, frankly, blatantly obvious effects in the field.
The US Government is clearly in support of the gender divide in sports.
Post by: Maximum Spin on May 27, 2023, 12:02:33 am
Well, I learned one thing today.Well, it is mandatory under Title IX.
The US Government is clearly in support of the gender divide in sports.
Post by: EuchreJack on May 27, 2023, 12:04:15 am
What you don't get is that this is the LGBTQ+ Thread, which would appear to me to be a thread to support the LGBTQ+ community, not to attack their members.QuoteUnder the rule change, she must Abandon her gender and fake the gender she was assigned at birth, or not participate.
It is not true. Participating in the male (by sex) league has nothing to do with her gender. Yes, she will be DEMOLISHED in the male sport but... well it is one of the effects of body autonomy. You can't do things to your body that make you a worse athlete and then expect special rules just for you. And it doesn't change if you have good reasons to do so.
And I am amazed that some people pretend that leagues aresegregatedseparated because of misogyny.
You clearly don't get the point, and frankly should leave this thread.
What exactly don't I get?
I should leave the thread because?
What you don't get is that you are attacking one of their members, Emily Bridges
What you don't get is that you are LYING about their member, Emily Bridges, by stating that "she will be DEMOLISHED in the male sport" because she was excelling in the Male side until she decided she couldn't live that life anymore. You don't KNOW how she might do against the males, you just ASSUME what you WANT to assume.
YOU are committing misogyny. Hopefully unintentionally.
YOU are at risk of being banned, hence my not-so-friendly suggestion that you might want to leave this thread before Toady drops a nuke on us all.
Post by: EuchreJack on May 27, 2023, 12:10:23 am
Well, I learned one thing today.Well, it is mandatory under Title IX.
The US Government is clearly in support of the gender divide in sports.
You are mischaracterizing the law. The law clearly states:
No person in the United States shall, on the basis of sex, be excluded from participation in, be denied the benefits of, or be subjected to discrimination under any education program or activity receiving Federal financial assistance (https://www.justice.gov/crt/title-ix-education-amendments-1972)
It does NOT divide the genders. In fact, it has been used to force male teams to accept female athletes.
FAKE NEWS is YOU
Post by: EuchreJack on May 27, 2023, 12:13:40 am
Post by: MrRoboto75 on May 27, 2023, 12:15:32 am
Why is a cisgender male fighting the culture wars with two anti-woke knuckleheads at 1am?
https://www.youtube.com/watch?v=xvdBrF5qaww
Post by: EuchreJack on May 27, 2023, 12:20:19 am
LOLWhy is a cisgender male fighting the culture wars with two anti-woke knuckleheads at 1am?
https://www.youtube.com/watch?v=xvdBrF5qaww
Thanks, I needed that.
Post by: Strongpoint on May 27, 2023, 12:23:31 am
Quote
What you don't get is that this is the LGBTQ+ Thread, which would appear to me to be a thread to support the LGBTQ+ community, not to attack their members.I assume that on a public forum topics exist to... discuss topics. As long as it is done within the rules of the forum and respectfully.
Quote
What you don't get is that you are attacking one of their members, Emily BridgesI didn't attack anyone. Did you miss the part where I said that I personally don't mind her participation because I don't think that potential advantage is large enough?
Quote
What you don't get is that you are LYING about their member, Emily Bridges, by stating that "she will be DEMOLISHED in the male sport" because she was excelling in the Male side until she decided she couldn't live that life anymore. You don't KNOW how she might do against the males, you just ASSUME what you WANT to assume.The key word there WAS. If she will compete with men now, after reducing her testosterone levels, she will be demolished.
Quote
YOU are committing misogyny. Hopefully unintentionally.In homo sapiens (and most mammalian species) males are physically stronger than females. It is the reality of biology. If holding this view is misogyny then I guess I am committing it.
Other than that, please, point out any example of my misogyny.
Quote
YOU are at risk of being banned, hence my not-so-friendly suggestion that you might want to leave this thread before Toady drops a nuke on us all.Banned for breaking what rules?
Post by: Maximum Spin on May 27, 2023, 12:28:26 am
You are mischaracterizing the law. The law clearly states:That is the text of the law, yes. One of the key reasons it was adopted was explicitly to force colleges to fund "women's" leagues, and that's also the most common way it was used immediately after it was passed. The argument has been that female athletes are "denied the benefits of" combined leagues because they can't compete. You can disagree with that argument, but it's what courts accepted.
No person in the United States shall, on the basis of sex, be excluded from participation in, be denied the benefits of, or be subjected to discrimination under any education program or activity receiving Federal financial assistance (https://www.justice.gov/crt/title-ix-education-amendments-1972)
It does NOT divide the genders. In fact, it has been used to force male teams to accept female athletes.
FAKE NEWS is YOU
It's not fake news if it's documented history.
Calling me "anti-woke" is just childish. I believe that respecting people as individual human beings is not only compatible with, but demands an awareness of the limitations of biology and of history.
Post by: Doomblade187 on May 27, 2023, 12:55:23 am
Post by: Strongpoint on May 27, 2023, 01:16:38 am
QuoteWhat you don't get is that you are LYING about their member, Emily Bridges, by stating that "she will be DEMOLISHED in the male sport" because she was excelling in the Male side until she decided she couldn't live that life anymore. You don't KNOW how she might do against the males, you just ASSUME what you WANT to assume.The key word there WAS. If she will compete with men now, after reducing her testosterone levels, she will be demolished.
I stand corrected. It is not will be. She did compete with men after beginning the transition
she took part in several circuit races, and her final men’s race, in September, was the Welsh National Championship road race, where she finished second to last, a full 12km lap behind the winner. Did these results make up her mind to move to women’s racing as soon as possible? “It was always the plan,” she says. “After starting hormone therapy I didn’t want to race in the male category any more than I had to – obviously, it sucks, getting dropped, racing as a man when you’re not one. It was quickly apparent that that was the wrong category for me.” -
https://www.cyclingweekly.com/fitness/i-just-want-to-be-competitive-again-trans-cyclist-emily-bridges-on-preparing-to-race-in-the-female-category
Looks like the person "I attacked" agrees that she has no chance of competing with men. Reality also agrees.
[extreme saracsm voice] She also must be misogynistic wanting to compete in the women category to match her reduced performance. We all know that thinking that women are worse in sports is misogyny, right? [/sarcasm]
Post by: scriver on May 27, 2023, 01:50:37 am
Post by: Vector on May 27, 2023, 02:05:55 am
Do you not notice how with each of these blowups the LGBTQ+ forumites basically leave the thread and stop discussing? I'm not talking about myself--I'm an idiot who is willing to keep wading back in. But all other discussion ceases during each of these conflicts. You could learn from us and potentially change your perspective, but instead you decide that beating the same old dead horse on our front porch is more important.
Pride month is going to start in a couple of days. Consider the possibility of being better allies by, at the very least, hosting your shitty fight in its own dedicated thread. Don't use the cover of our community space to hide your political intentions.
Post by: genmac on May 27, 2023, 05:15:36 am
Post by: scriver on May 27, 2023, 05:59:51 am
Regardless, we have a history here that when an argument or topic keep popping up in a thread where people don't want or that overshadows the other discussions, it is taken to a new thread if people want to keep the discussion going.
Post by: Strongpoint on May 27, 2023, 06:50:58 am
The OP literally says "Making this because I'm finding myself diving into it more and more, and I'm not wanting to derail other threads with it. General discussion, news, events, whatever's relevant."
Post by: McTraveller on May 27, 2023, 07:24:22 am
EDIT: and even I have strayed into some... too academic?... conversations here... trying to do better.
Post by: Starver on May 27, 2023, 08:25:21 am
For my part, I saw the news, and this thread had such kinds of news before. It seemed of interest, and it seemed that if I hadn't said anything then it might have gone unnoticed by those for whom it eventually directly effects. (If I'd have known it would have festured strongly on UK news for the next half day, only really overshadowed by the circumstances surrounding Philip Schofield's departure from TV, I would not have presumed that those it might effect could have missed it.)
And I don't mean to fight anyone's fight for them (unasked), just add half-considered balance where I saw it as yet unchallenged. Even/especially when I know it's been discussed before. I perhaps went on more about side-issues than I should have, while biting my tongue on the main arguments (which I didn't want to enflame, but clearly weren't cooling down on their own either - not yet anywhere near bannable level for anyone, IMO, but I'm not the best judge on that).
There should be nothing wrong with any of the presumed purposes of this thread being here in the lower-forums/General, as there are plenty of other "community, not game" things here and no official requirement to make even token Dorfy references when you have no Fortressy/Adventurey things to say. Maybe some things might verge into Life Advice sub-sub-forum version of the thread, but that could cause problems when the range inevitably weaves in and out of this narrower remit. Perhaps like the Ukraine Reporting/Emotional thread (as imperfect as that delineation is), if there's a need for a more definite split of function then you have that option?
And I'm definitely sympathetic with Vector's(/et al’s) frustrations. Which this meta isn't helping, I'm sure, but now I'm ducking out of this whole round of distraction. Hopefully.
(End Meta!)
Post by: dragdeler on May 27, 2023, 08:47:38 am
Post by: Rolan7 on May 27, 2023, 09:49:35 am
(also yes, people with testosterone tend to be stronger than people with estrogen. I'll totally concede that, since I outright said it and certainly never disagreed with it)
I would love to fill the thread with on-topic discussion but there's not too much to share. I'm being my gender and that's going well! It's going so well that it's about as unremarkable as gender is for cis people. That's a good thing, it's just not very discussion-worthy :)
There's obviously the ACTUAL politics, with hundreds of bills being pushed through to criminalize our existence, but I still don't want to talk about that here. Sure it's a lot more important than the sports smokescreen, but I'd rather put it in Ameripol instead of stinking up this thread.
So yeah, Pride month :D
This is the first year where I feel like I can actually... enjoy going as myself, rather than pretending to be something else. So I AM really looking forward to it!!
On the 3rd there's an event nearby. Looks pretty normie, but that just makes it a good way to get a sense for what to attend later. I can be almost outgoing when I'm myself! I even did a test-run last month by attending a protest/march elsewhere in my state. I was a little awkward but people were nice and I had a lot of fun. I got a pronoun wristband which I'm still wearing most of the time~ though it's kinda illegible lol, white on yellow. It's still a nice reminder/token.
Oh if nothing else I can certainly finally get some pronoun pins for my mask!! I keep meaning to do that online, but buying in person from a vendor might be cooler. I do kinda want both they and she (perhaps he?), because I'm definitely fluid. I want to fly the NB colors, too, but it'd be good to have a small pin of the trans colors too. It's so recognizable yet also vague, always appropriate even when I feel masc.
Aw, I'm excited! :)
Edit: Oh oh, and, I have a Progress Pride cloth flag that I got but didn't feel comfortable flying. I think... surely, for pride month, I can put that in my window. I think that's safe. Hell, there's a couple houses within a mile of me that have LGBT-friendly lawn signs already, surely I can do this for pride month.
Post by: Doomblade187 on May 27, 2023, 10:37:03 am
Post by: jipehog on May 27, 2023, 11:13:43 am
General rule of thumb is - just be kind in everything. Try to understand each other. Discussing things like sports... does sound more like politics, rather than trying to understand or support each other.The discussion was on topic, we were talking about the way to achieve inclusion given the reality of competitive sports, but eventually it devolved into the internets beloved tradition of 'someone is wrong'.
This isn't the first time it happens and I would suggest if people don't want to engage, simply don't. Trying to outshout others when you fail to get your opinion across, throwing insults, telling people to leave and making threats of bans are not helpful and lead to predictable results.
EDIT: Have fun with with pride month !
Post by: Maximum Spin on May 27, 2023, 01:11:12 pm
But more importantly to me, I don't like this jumping to assumptions about who people are and what they think. It's not okay.
Post by: Rolan7 on May 27, 2023, 02:04:03 pm
I'm so sorry I know that was "intolerant" of me. I'm such a hypocrite or whatever. Perhaps we should make our own thread for LGBTQIA+ issues and let this be the thread about sports categories and how weak women are.
That way you can keep discussing those issues as much as you like without implying it has anything to do with us.
EDIT: Have fun with with pride month !Thanks! :)
My complex is fairly conservative, but I have a right to be here and I don't think it's going to be a problem... fuck, I guess with a Progress flag I have more plausible deniability. If it comes to that. I'm not sure if I'm being bitter or reassuring myself.
Post by: dragdeler on May 27, 2023, 03:43:57 pm
fuck, I guess with a Progress flag I have more plausible deniability. If it comes to that. I'm not sure if I'm being bitter or reassuring myself.
Tell 'em look we got a brown line now for brown shirts, that should give you sufficient time to put some distance between you and them :P.
Post by: EuchreJack on May 27, 2023, 07:18:32 pm
Post by: Maximum Spin on May 27, 2023, 07:34:40 pm
I'm a bit worried that a couple major companies will back out of their traditional support of Pride Month.Have there been any rumblings to that effect? I would seriously doubt it. It's still a huge moneymaker.
Post by: EuchreJack on May 27, 2023, 07:41:00 pm
Live under a rock much?I'm a bit worried that a couple major companies will back out of their traditional support of Pride Month.Have there been any rumblings to that effect? I would seriously doubt it. It's still a huge moneymaker.
Target won't even sell some merchandise (https://amp.cnn.com/cnn/2023/05/23/business/target-lgbtq-merchandise/index.html)
Post by: Rolan7 on May 27, 2023, 07:46:53 pm
Target already did it with their Pride display a week before Pride even started, yeah. Not a great sign, but a good indication of the "support" of rainbow capitalism. It wasn't even the profitable move IMO... I suspect individuals at the company were scared of getting sacked like the ones at Bud Light, and betrayed their shareholders (and us, of course).
Spoiler: Terror tactics (click to show/hide)
Post by: Maximum Spin on May 27, 2023, 08:06:58 pm
Live under a rock much?I already knew about that, but that's not at all the same story. Target isn't doing away with Pride merchandise at all - they still have a ton of it. It stopped carrying a specific line because of concerns about a specific person. While I don't really agree with the concerns, that's not in and of itself different from when companies drop products associated with people accused of sexual abuse and things like that. Target as a whole is still all in on Pride Month, although I'm sure that the extent differs by location (as it always has). You're somewhere in upstate New York too, aren't you? You can check for yourself: here, it's just as much a moneymaker as ever.
Target won't even sell some merchandise (https://amp.cnn.com/cnn/2023/05/23/business/target-lgbtq-merchandise/index.html)
Post by: Rolan7 on May 27, 2023, 08:30:33 pm
As a rational, thinking person I think this has more to do with the momentum of Bud Light and Dylvan Mulvaney. I don't think the chuds have any "concerns" about fucking Satanism (well the Q cult do, but this is far more mainstream than that). I think "I don't really agree with the concerns [that the designer depicts Satan in OTHER WORKS]" is a weak-ass response to conservatives smashing up a display and the company responding by pulling it from their stores.
Grow some damn balls, dude.
Post by: EuchreJack on May 27, 2023, 08:48:06 pm
Post by: EuchreJack on May 27, 2023, 08:53:14 pm
Post by: Maximum Spin on May 27, 2023, 09:53:59 pm
The original claim was that Target was backing out of Pride. This is clearly false: they still have tons of it. The business decision to remove one dumb "Satanist" poseur's line for causing too much intentional controversy and harming their brand has nothing to do with this. Trying to argue over that is moving the goalposts.
Post by: Rolan7 on May 27, 2023, 10:21:57 pm
Can you *kindly* make another thread to "discuss" the best way to remove us from society?
Post by: Maximum Spin on May 27, 2023, 11:55:41 pm
Right. You will not stop your insincere rhetoric until they have zero pride merch, because that is your goal.I cannot believe you or anyone could seriously think this.
Can you *kindly* make another thread to "discuss" the best way to remove us from society?
I'm sorry, but this is just insane.
There will be exactly as much 'pride merch' as people want to buy. As of this moment, it looks like that's "lots". I have absolutely no problem with that! I wish everyone an abundance of the things they want. I just don't get why pretending there's a shortage is supposed to help anybody except megacorporations who really don't need the help.
Post by: Rolan7 on May 28, 2023, 12:07:21 am
If you gave a shit about freedom, you'd be supporting us.
Post by: Maximum Spin on May 28, 2023, 12:14:18 am
Cry victim all you like. No company is pulling the Gadsden flag because of violent armed mobs.I'm not crying victim. There's no victimization involved. All that happened is that a rich person chose to accept a payday from a megacorp to sell cheap tat geared toward other rich people, but spoiled the deal by acting like a petulant child trying to consternate the olds with lame fake "Satanism", pulling bad press (as intended) and the predictable response from the megacorp.
If you gave a shit about freedom, you'd be supporting us.
By the way, I haven't heard a single credible report of a display being smashed as you claimed. Searching for it now, I see zero news stories even mentioning any such thing. I'm not buying it. If it really happened, then sure, the perpetrators should be arrested for property crime and treated like any other smash-and-grab criminals. This in no way faults Target for making the business decision to pull the line.
Post by: Rolan7 on May 28, 2023, 12:20:40 am
By the way, I haven't heard a single credible report of a display being smashed as you claimed. Searching for it now, I see zero news stories even mentioning any such thing. I'm not buying it. If it really happened, then sure, the perpetrators should be arrested for property crime and treated like any other smash-and-grab criminals. This in no way faults Target for making the business decision to pull the line.https://www.youtube.com/watch?v=FscUyMuf-Fo
I'm kinda drunk but I'm not intending to "own" you, I'm legitimately saying: We're fighting for freedom. If you *actually* have a libertarian bone in your body, you should be on our side.
I guess I have a soft spot for libertarians because ONE of my family members, conservative and libertarian, is actually pretty alright to hang out with.
To be honest, most of you are full of shit.
Post by: Maximum Spin on May 28, 2023, 01:52:06 am
https://www.youtube.com/watch?v=FscUyMuf-Fo... this is supposed to be a "smash"? That was the saddest tik-tok stunt I've ever seen, although to be fair I intentionally don't look at tik-tok stunts. I actually saw this while I was looking, and I thought, that couldn't possibly be what you mean.
By all means, if Target wants to take him to small claims court for the price of putting the cardboard flap back together and hanging it back up, I'm all for it. That's not me being glib: that was indeed a crime, and a very stupid one, and the absolutely laughable way he swaggers while doing it is just icing on the cake, and a guy like that probably doesn't have the brain cells to learn a lesson in the first place but that doesn't mean you can't try.
But, no, I don't believe for a second that that played any part in Target's decision to take down the line we were talking about, because it will have taken an employee (at minimum wage, I imagine) five seconds to put the sign back up and only served to make Target look better and its opponents look like losers. I think it's really dishonest of you to describe this as "conservatives smashing up a display and the company responding by pulling it from their stores", which, at a minimum, seems to imply some broken glass or merchandise rendered unsaleable, or at the very least something that would still be noticeable twenty minutes later. This is a question of framing: if you had just said "at least one asshole doing petty damage to a cardboard sign for social media clout" and not tried to attribute the company's decision to it, I wouldn't have a problem with it.
Look. As to the rest of your post. I don't imagine that you or anyone could "own" me, and I find your (and others') attribution of political positions to me really bizarre, and I make it a point not to talk about my own personal shit, and I don't feel that I owe you any explanation of my understanding of 'freedom', even if being up at this hour tends to make me chatty. I've been pruning away at this paragraph since I posted it, because I have this natural impulse to keep explaining my view on the whole edgelord Satanism thing, but now you seem to be trying to tell me that "fighting for freedom" somehow necessitates believing that no product line should ever be cancelled for its designer actively alienating customers by pretending to be a devil worshipper, and I just can't really muster up the energy for this. It's not like we don't know that people pretend to Satanism for the very purpose to shock and upset the kind of people this did in fact shock and upset, and that corporations don't like it when people get shocked and upset on their dime. Yes, it's ridiculous that anyone actually believes in Satanism, but we all already knew that some people do. That doesn't have any bearing on anything to do with fighting for freedom.
The source of this argument was whether or not companies were pulling pride support. As far as any indicators show, pride merchandise continues to be a huge moneymaker in most of the country (and several others), and it won't go away as long as it is a huge moneymaker. I'd think that would be something to be happy about, especially at a time when you feel attacked in general. I don't understand the pushback here.
Post by: EuchreJack on May 28, 2023, 02:31:43 am
If you had read my link to the article, you would have seen Target didn't reveal what threats were made, nor support their actions in any way with any real info.
If you had read the second link from the designer of the merchandise, you would know that he was actually pretty cool about having his merchandise pulled.
Mainly he said "Yeah, I don't want anyone getting hurt over my merchandise"
He also didn't have any Satanic merchandise for sale at Target. Both Target and him agreed that would not be a good fit for Target.
....
Anyone else think we've beaten this horse to death? Aye!
On brighter news, Disney+ will NOT be removing the documentary "Howard". (https://deadline.com/2023/05/disney-backlash-removal-howard-documentary-little-mermaid-lgbtq-1235373329/)
Post by: MaxTheFox on May 28, 2023, 02:34:55 am
Post by: Maximum Spin on May 28, 2023, 02:43:36 am
Maximum Spin, you got to start actually reading the links.I do, in fact, read the links. I never said a single word that would contradict any of those statements.
If you had read my link to the article, you would have seen Target didn't reveal what threats were made, nor support their actions in any way with any real info.
If you had read the second link from the designer of the merchandise, you would know that he was actually pretty cool about having his merchandise pulled.
Mainly he said "Yeah, I don't want anyone getting hurt over my merchandise"
He also didn't have any Satanic merchandise for sale at Target. Both Target and him agreed that would not be a good fit for Target.
I mean, I actually want to know what your thinking is here. Where do you think I said that Target revealed any threats, or that the designer had a problem with it, or that any of the silly Satanism nonsense took place at Target? You bring this all up so matter-of-factly as if it's obvious, but it doesn't seem to have anything to do with anything.
Post by: TD1 on May 28, 2023, 06:36:28 am
Post by: Starver on May 28, 2023, 06:38:17 am
(Though it should be snakes-staff-and-wings (https://en.wikipedia.org/wiki/Caduceus) (for negotiation) or snake-and-staff (https://en.wikipedia.org/wiki/Rod_of_Asclepius) (for medicine), really. It's either a very clever multi-levelled joke or a common mix-up.)
Post by: Doomblade187 on May 28, 2023, 09:00:41 am
Maybe the true Target is the Satan we made along the way
Seems fair.
Don't worry, there's always Raytheon. (Raytheon is apparently genuinely very inclusive, which is neat. Never mind the cluster bombs.)
2 days till pride month, heck yeah.
I will say despite all the shit we give megacorps, etc. about pride month, the fact that they consiser the LGBT+ market a target for money and advertising is genuinely a good sign.
Post by: Rockeater on May 28, 2023, 01:50:32 pm
"Irreversible damage" was translated to Hebrew and sold by a right wing book publisher.
The good news was they had a launch event in a place of a right wing think tank, after every less transphobic place cancelled on them and the eventual place was known like two days before, and the trans community had a protest in the place, and it was great, there were at three times more protestors then attended, probably way more I just remember the end now, they were so fuckin scared inside even though they were barley touched, they brought like 4 boarder patrol cars, they arranged themselves three ways out because non of them really looked well.
Post by: MrRoboto75 on May 28, 2023, 02:21:05 pm
if nothing else, pride month gave me the rainbow Pinkerton logo 🌈Maybe the true Target is the Satan we made along the way
Seems fair.
Don't worry, there's always Raytheon. (Raytheon is apparently genuinely very inclusive, which is neat. Never mind the cluster bombs.)
2 days till pride month, heck yeah.
I will say despite all the shit we give megacorps, etc. about pride month, the fact that they consiser the LGBT+ market a target for money and advertising is genuinely a good sign.
Post by: Rolan7 on May 28, 2023, 09:08:25 pm
"Is that supposed to be broken glass? The window barely even shattered. Really, I saw this and didn't care about it, surely you're not concerned about this. You're overreacting."https://www.youtube.com/watch?v=FscUyMuf-Fo... this is supposed to be a "smash"? That was the saddest tik-tok stunt I've ever seen, although to be fair I intentionally don't look at tik-tok stunts. I actually saw this while I was looking, and I thought, that couldn't possibly be what you mean.
Post by: MaxTheFox on May 28, 2023, 09:13:14 pm
Post by: Rolan7 on May 28, 2023, 09:15:27 pm
I listen to other women.
Post by: Great Order on May 29, 2023, 06:30:29 am
Sports discussion is banned.
Every time it comes up, things devolve into shit-slinging, either overt or hidden under the pretense of argument, and the thread veers ever closer to Toady winding up coming in and either calming everything down by deleting posts, or it getting locked and (temp) bans being put in place.
Yes, it's an important topic, especially with it being used as a wedge issue with regards to trans rights, but this isn't the place to get hotheaded over it. If it comes up, I'm temp locking the thread. Wouldn't be an issue if we could stay civil, but we can't.
And on that note:
KEEP THINGS CIVIL!
Apologies for not being here to keep on top of it, I've been away for a few days so I didn't have access to the forums.
Post by: MaxTheFox on May 29, 2023, 07:15:47 am
...that came out wrong.
Post by: bloop_bleep on May 29, 2023, 11:26:43 pm
I'm getting Ukraine flashbacks.
...that came out wrong.
You and like a million other people in 5 years...
Post by: EuchreJack on May 30, 2023, 09:29:12 am
...to bad it's in the UK.
Post by: EuchreJack on May 30, 2023, 11:38:29 am
https://www.cbsnews.com/amp/news/air-force-veteran-imprisoned-being-gay-endures-stigma-felony-record/ (https://www.cbsnews.com/amp/news/air-force-veteran-imprisoned-being-gay-endures-stigma-felony-record/)
Post by: Vector on May 30, 2023, 12:13:47 pm
It went well, she was kind to me ... ... ... she packed my lunch for the train in her deceased son's old lunchbox.
Post by: Great Order on May 30, 2023, 04:00:17 pm
This article seems fitting between Memorial Day and Pride Month: https://www.telegraph.co.uk/news/2023/05/26/gay-transgender-veterans-compensation/ (https://www.telegraph.co.uk/news/2023/05/26/gay-transgender-veterans-compensation/)I was initially thinking it'd be some sort of thing of veterans being denied pensions due to being LGBT or something, instead it's about literal torture being done on people because they were gay or trans, or even as much as suspected of it.
...to bad it's in the UK.
Six figures isn't enough for that sort of thing.
Post by: Rolan7 on May 30, 2023, 04:18:37 pm
@Vector It's so interesting what little gestures can mean the world. I'm so glad that went well. I'm planning to come out to my dad's sister sometime during June... She's always been pretty nice to me, and in general, but we're not close. I'd like for her to know.
I saw a cute bumper sticker today: "I've got my TWO moms wrapped around my little *pawprint*". With a little rainbow loop.
I don't get lesbians but they're neat! My cousin has two moms too. He asked me my pronouns in front of my dad once, heh, and dad made jokes but we literally ignored him until he moved on. The dynamic is so different when there's even one ally around.
Post by: Vector on June 01, 2023, 12:28:55 am
Post by: Rockeater on June 01, 2023, 02:42:42 am
In a partly related news, I am not sure I am trans, more accurately, I am not sure what being trans would mean for me, or what gender is.
Post by: TD1 on June 01, 2023, 05:43:19 am
Post by: Starver on June 01, 2023, 06:36:46 am
Gender is [insert thing], pretty much.Surely that's actually Sexuality? ;D
Post by: TD1 on June 01, 2023, 08:42:12 am
Post by: None on June 01, 2023, 10:35:24 am
(it seems to be a winning strategy for me)
Happy pride, y'all. Be you, stay you.
Post by: EuchreJack on June 01, 2023, 03:23:36 pm
https://www.foxnews.com/us/pride-flag-burned-elementary-school-concerns-raised-pride-event-children.amp (https://www.foxnews.com/us/pride-flag-burned-elementary-school-concerns-raised-pride-event-children.amp)
https://fox5sandiego.com/news/local-news/students-stage-walkout-over-carlsbad-school-districts-refusal-to-fly-pride-flag/amp/ (https://fox5sandiego.com/news/local-news/students-stage-walkout-over-carlsbad-school-districts-refusal-to-fly-pride-flag/amp/)
Post by: Great Order on June 02, 2023, 07:26:12 pm
Unfortunately every time it's just people pissing and shitting themselves over the fact that someone is different. It's confusing to them, so rather than learn they throw a tantrum and advocate for, at best, detransitioning or, at worst, straight up murdering us (So ranging from "forcible removal of a group" style genocide to "Systemic extermination" style genocide) while screaming that we're all paedophiles (Meanwhile religious institutions and right-wing groups tend to have issues dealing with kiddy diddlers).
It's fucking exhausting. It also makes me wonder when it's going to turn into someone going violent in retaliation. I wonder that for a lot of things really, see a group being demonised and verbally/physically attacked, and it seems weird there's not actually *more* retaliatory violence. Maybe it speaks well for humanity's ability to cooperate and search for peaceful solutions.
Post by: EuchreJack on June 02, 2023, 08:29:00 pm
https://amp.cnn.com/cnn/2023/06/01/business/pride-month-companies-reaction/index.html (https://amp.cnn.com/cnn/2023/06/01/business/pride-month-companies-reaction/index.html)
Post by: Great Order on June 02, 2023, 09:11:35 pm
Seeing the same thing as we did with LGB rights, staying the course is rewarding, reversing just pisses everyone off (And makes people think "If they walk back on that, what about things that directly affect me?"), don't be hypocritical.
Post by: None on June 02, 2023, 11:17:53 pm
it was a nice day to be out
Post by: Magmacube_tr on June 03, 2023, 05:39:06 am
I hate Islam.
Post by: None on June 07, 2023, 04:19:02 pm
Spoiler (click to show/hide)
They have zines! and flags! And stickers! I've got reading material for an upcoming van trip now, and the flag's going to be part of our dashboard screen for the thing, hopefully.
Post by: Frumple on June 09, 2023, 01:02:00 pm
Post by: Great Order on June 09, 2023, 06:08:22 pm
EDIT: Also the fucking irony of saying Islam is trying to take over governments while advocating for Christianity to do so.
Post by: Rolan7 on June 09, 2023, 06:36:38 pm
I was genuinely tickled to see multiple people briefly worry that something had happened to Robert Pattinson. Robinson deserves obscurity.
Things are going well... I went to a Pride last weekend as a gay guy, oddly. Just felt right for a couple days. Genderfluid you know? Was a nice chill time, got complimented, and for a while I liked my face with a neat NB mustache. Tuesday I recoiled from that hard. Had to shave, felt better. I need to be careful with that... I don't need to look *pretty*, but I can't pretend to be a man for more than a little while at a time.
Yesterday I got my IPL out of storage. I'd used it briefly on my arms but lost interest, since my arm hair is light and grows slowly. And I epilate my legs. This time, I used it on my neck and chin. The instructions say not to, but I found out that professional places do it all the time. I simply took excess caution in protecting my eyes, and avoided my lips. It went fine! I woke up with what felt like a very mild sunburn, and put a little aloe on from my plant. Not even visibly red, and no "eye itchiness" at all. Doing this twice a week for a while should really slow down the growth.
A trans friend shared a progress pic after "not shaving for a week" and thought her stubble was bad. It was barely visible, what I'd expect after 12 hours. I was kinda envious about that. Not in a malicious way, though, and there's so much I appreciate about my body.
Oh yeah so tomorrow is another Pokemon community day! Last one and the tournament were very affirming because people used my name and didn't gender me. I'm going to enjoy tomorrow too- particularly since it's good exercise and I find that affirming. Too bad about all the smoke, but I'll have my mask of course.
I FINALLY ordered pronoun pins and a little NB-flag moon necklace, they should arrive Wednesday! I got a set of pins so I can choose which pronouns to ask for, though I'm sure I'll stick to they/them usually. Unless she/her trip people up less, guess I'll see what works.
I let so many Prides slip me by for various reasons. This time I actually feel proud though
Post by: Eschar on June 10, 2023, 04:34:39 pm
In the opposite geographical area, I visited Salem last year and happened to stop by a Pride parade. That was nice.
Post by: Great Order on June 12, 2023, 08:41:25 pm
Post by: alway on June 12, 2023, 11:08:48 pm
Post by: Egan_BW on June 12, 2023, 11:44:56 pm
Post by: Vector on June 12, 2023, 11:55:23 pm
Post by: Rolan7 on June 13, 2023, 12:39:18 am
I am a rough, ragged, edgy person. I like to think I'm a woman, but I'm also a man sometimes. Usually I'm neither, woo!
I want to be STRONK. I want to be nice.
That's who I am.
oh no, I'm a thembo
Post by: Rolan7 on June 18, 2023, 12:52:33 pm
It was Father's Day [slightly early], and a family reunion, and finally got a voice call from my partner. They've just been busy, and they've got SO much accomplished!! And I was right, they were in a headspace to be presentable to their family. Same as I was doing yesterday.
I'm happy enough when single, but nowadays I really do rely on them emotionally and I communicated that while praising them for taking some time and doing everything they needed to :blue_heart: and we're good. So good. It's a huge relief :relieved:
Anyway I felt transmasc, getting ready. I wore my tightest sports-bra. I pulled my hair back in that boring ponytail my dad wears. Polo shirt and slacks (covering my smooth legs).
But shaved, whereas he's growing a fabulous set of whiskers. Smooth tanned arms and longish (rapidly unpainted) nails. And my NB pendant, for anyone who recognized it. AKA my younger cousins. (Nobody there was in my age group because of DNA issues, long story.)
My dad recognized the :pride_NB: and asked that I not wear it, and his wife said "What? Let him wear it, it's not a nazi sign or anything!". She's generally supportive. So is he, sometimes.
I wore it under my shirt.
I pulled it out sometimes when I felt like I needed to. Being with family sometimes feels like eroding who I am. In or out, this little necklace helped me remember myself.
Anyway it felt kinda religious and I find that interesting and potentially problematic. I'm obviously just talking about feelings here. I'm spiritual but areligious.
Thinking about the Church of Prismatic Light again.
This is deeply and spiritually important to me, and there's doctrine (though I'm heterodox (lmao))
I find myself thinking "This would be my religion except that it's true"
which uh
hm
Post by: Doomblade187 on June 21, 2023, 05:09:13 pm
Post by: Egan_BW on June 21, 2023, 05:18:14 pm
Post by: Magmacube_tr on June 25, 2023, 05:12:11 am
Yeah. No pride here.
Post by: MrRoboto75 on June 25, 2023, 12:26:14 pm
Get hype for several more days of pride month!DAY 26
GIVE IT UP FOR DAY 26
Post by: Magmacube_tr on June 25, 2023, 12:58:46 pm
Get hype for several more days of pride month!DAY 26
GIVE IT UP FOR DAY 26
████████████████████
████████████████████
████████████████████
████████████████████
████████████████████
████████████████████
Post by: Rolan7 on June 25, 2023, 01:24:29 pm
Oooh I'll have to remember that trick. Looks very nice! *sending hugs*Get hype for several more days of pride month!DAY 26
GIVE IT UP FOR DAY 26
████████████████████
████████████████████
████████████████████
████████████████████
████████████████████
████████████████████
(https://i.imgur.com/0b1jivJ.png)
(Currently displayed in my window instead of the stick, since I'm done with events for the month)
Post by: Great Order on June 26, 2023, 08:29:42 am
It's also a load of bollocks, two students were clearly shit-stirring and selectively recording a teacher who was basically telling students to stop harassing another student and getting rather exasperated by that point. The Telegraph (AKA Torygraph for good reason) saw an opportunity to make shit up and pounced, so now we've got yet another bunch of people losing their shit over the Woke Mob(TM) existing.
Post by: Starver on June 26, 2023, 09:04:35 am
(To be clear, you can perhaps be mis-woke, even fanatically over-woke, but as soon as it's a clear blanket issue describing anything woke-like as something to be railed against (especially when clearly another version of "Winterval" or "Empty bus full of Muslim women") just reflects badly on the utterer of that claim. Though if it's something like GB News, or the Telegraph, then I'm already (ironically) inclined to shun anything they say without looking for the nuances. At least wait until other outlets come out with their own interpretations and angles, to perhaps find out what specks of merit there might be...)
Post by: TD1 on June 26, 2023, 09:13:09 am
Not that what you said claims otherwise (at least, not exactly), this is just my random two cents, hah.
Post by: Loud Whispers on June 26, 2023, 09:20:07 am
Dunno if anyone's been keeping track of it, but the UK has been throwing a dicky-fit over a schoolkid identifying as a cat, to the extent that the Education Secretary has gotten involved.Police are more likely to investigate catgate than MPs get investigated for embezzlement, tax evasion, bribery or noncery
It's also a load of bollocks, two students were clearly shit-stirring and selectively recording a teacher who was basically telling students to stop harassing another student and getting rather exasperated by that point. The Telegraph (AKA Torygraph for good reason) saw an opportunity to make shit up and pounced, so now we've got yet another bunch of people losing their shit over the Woke Mob(TM) existing.
Post by: Strongpoint on June 26, 2023, 09:22:34 am
It is a genuine question, not some kind of attempt to start a debate. I kinda know how to interact with a trans person but if someone will say to me that they are a cat... I honestly have no idea and no plan. And, unlike me, teachers in schools can't even avoid such situations.
Post by: TD1 on June 26, 2023, 10:05:45 am
Post by: alway on June 26, 2023, 10:16:30 am
But what should we actually do with people who define their gender as a pony, dragon, elf, etc? Some people do this for trolling, some do it genuinely. And this is becoming more popularYou seem to have this persistent problem where you have an inability to treat people unlike yourself with dignity, respect, or as people. You should probably start by talking to your therapist about that tbh.
It is a genuine question, not some kind of attempt to start a debate. I kinda know how to interact with a trans person but if someone will say to me that they are a cat... I honestly have no idea and no plan. And, unlike me, teachers in schools can't even avoid such situations.
Post by: Great Order on June 26, 2023, 10:48:37 am
Post by: None on June 26, 2023, 10:56:39 am
But what should we actually do with people who define their gender as a pony, dragon, elf, etc? Some people do this for trolling, some do it genuinely. And this is becoming more popularKids have been pretending to be cats for decades, give me a break. And given that fursonas or otherkin haven't meaningfully shifted scientifically or socially how we understand the 'self,' I wouldn't put any concern about this.
It is a genuine question, not some kind of attempt to start a debate. I kinda know how to interact with a trans person but if someone will say to me that they are a cat... I honestly have no idea and no plan. And, unlike me, teachers in schools can't even avoid such situations.
That's also not how gender works? Typically claiming one's gender to be an inanimate object or creature is done in hyperbole to be transphobic...
Post by: Rolan7 on June 26, 2023, 12:01:34 pm
Dunno if anyone's been keeping track of it, but the UK has been throwing a dicky-fit over a schoolkid identifying as a cat, to the extent that the Education Secretary has gotten involved.It's been a thing in the US too to some extent, but with a uniquely American character:
It's also a load of bollocks, two students were clearly shit-stirring and selectively recording a teacher who was basically telling students to stop harassing another student and getting rather exasperated by that point. The Telegraph (AKA Torygraph for good reason) saw an opportunity to make shit up and pounced, so now we've got yet another bunch of people losing their shit over the Woke Mob(TM) existing.
Some US schools *do* have kitty litter.
For sheltering in place during... incidents.
And yet trolls and credulous bigots happily spun a culture-war narrative about it. Along with people demanding that we take their "concerns" seriously and be respectful.
Like no
The people spinning lies to incite hatred should be stopped. With state violence if necessary, AKA fines and whatever.
And the people who believe this shit are a combination of stupid and eager to believe hateful messaging. They don't deserve respect for that, they need deprogramming. The extent to which they actually *believe* what they're saying is debatable- they see a narrative that affirms their bigotry, they share it. Fuck'm. Kindness WILL NOT change their mind.
Obviously, if they *do* change their mind- perhaps because they're tired of being mocked for their gullibility and hatred- I fully believe in restorative justice, which in this case is just "Don't sweat it, cults are addictive, glad you're better now <3". I know many such people. Affirming and respecting their bigotry wasn't what snapped them out of it.
...I mean, I had shitty takes on trans people at first too. People were firm with me- AKA treated me with *actual* respect by calling out how I was wrong. That's been true on more political issues as well. Appeasement doesn't work and it's infantalizing.
Post by: Strongpoint on June 26, 2023, 02:43:37 pm
Your assumption is very wrong and I am really confused about what it has to do with my last message in this thread. Like really confused. It is so weird and random that I can't even see it as insulting. Also, my personality is not the subject of the thread or any discussion in the thread.But what should we actually do with people who define their gender as a pony, dragon, elf, etc? Some people do this for trolling, some do it genuinely. And this is becoming more popularYou seem to have this persistent problem where you have an inability to treat people unlike yourself with dignity, respect, or as people. You should probably start by talking to your therapist about that tbh.
It is a genuine question, not some kind of attempt to start a debate. I kinda know how to interact with a trans person but if someone will say to me that they are a cat... I honestly have no idea and no plan. And, unlike me, teachers in schools can't even avoid such situations.
But what should we actually do with people who define their gender as a pony, dragon, elf, etc? Some people do this for trolling, some do it genuinely. And this is becoming more popularKids have been pretending to be cats for decades, give me a break. And given that fursonas or otherkin haven't meaningfully shifted scientifically or socially how we understand the 'self,' I wouldn't put any concern about this.
It is a genuine question, not some kind of attempt to start a debate. I kinda know how to interact with a trans person but if someone will say to me that they are a cat... I honestly have no idea and no plan. And, unlike me, teachers in schools can't even avoid such situations.
That's also not how gender works? Typically claiming one's gender to be an inanimate object or creature is done in hyperbole to be transphobic...
Sure, the sarcastic attack helicopter meme was and is used as a way to insult. But xenogenders are a real thing some people self-identify as. The idea that male and female (+fluid, non-binary, etc) are merely the most common genders is growing in popularity.
And I already ranted in this thread that different people define gender so differently that using this word usually doesn't explain anything without further inquiry of what the person means by that. So the question "is this how gender works?" depends on the definition.
Post by: Starver on June 26, 2023, 03:36:37 pm
I'd say that "I define my gender as a <helicopter/whatever>" is often bad-faith absurdism, by those that don't believe that "◇gender≠sex" and decide to go the "by supporting gay marriage, you'll have people marrying animals/buildings next" contrary argumentation.
Separately, there is roleplay (everything from Furoticism to LARP), which is "honest deviation" across any or all boundaries (which may or may not involve some genuine personal dysphoria, but one can't assume that either).
The issue of not being able to label yourself with standard binary genders or binary-derived alternatives (not this one/the other/various proportions of both/neither/varying day-to-day or more) and deciding that the nature of a cat encompasses what you're feeling does not mean you're genetically a cat, but neither does what you feel about your gender have to match your genetic gender (and/or your physical phenotype, which can be different again).
I'd honestly consider "my gender is pony" as more in the second category, perhaps the third. I would maybe query more detail, given the opportunity, especially as actual ponies would not thenselves be single-gendered (though maybe "My Little" ones are?), and perhaps weed out the first-category type by paying attention to the context it's being put into.
But, so long as no harm happens, I don't think it's my business in what ways a person decides to shape their life. And probably the harms I need to be most concerned about are those coming directly from the "absolutely not"ists who can't even remain slightly bemused by it all but insist on 'correcting' the perceived situation.
(This was not in direct response to Strongpoint's earlier post, and indeed was just ninjaed by their latest one (wgich somehow managaged to step on some of the same stepping stones of conversation, although maybe with a different foot!) so don't take this as a response to that in any way at all. It was just a ramble around the theme to perhaps try to place my personal philosophy in context.)
[edit: Had to post first, to properly check, but I came up with the "<helicopter/whatever>" reference entirely without any mention in the recent thread. Only to find that the message above mentioning it. Which all goes to show that the (discredited) "I identify as a helicopter" meme, which I'm sure I've seen 'hovering' around such discussions for three decades (possibly more) is a rare but perrenial favourite. Perhaps even invoking some gender-discussion equivalent to Godwin's law, indicating that the conversation should now be considered over as unlikely to resolve well now that helicopters are mentioned. ;) ]
Post by: jipehog on June 27, 2023, 01:13:40 am
I'd say that "I define my gender as a <helicopter/whatever>" is often bad-faith absurdism, by those that don't believe that "◇gender≠sex" and decide to go the "by supporting gay marriage, you'll have people marrying animals/buildings next" contrary argumentation.
While I suspect that original news was precisely about that. Using absurdism is useful in many contexts (as for bad-faith I see much more on the opposite side with those with persistent problem with inability to have a conversation without attacking others)
In the case of what was discussed here, lets not mince words the underlying issue here is about rights. Unless you can came up with definition of gender that is testable, falsifiable and verifiable that can be used with existing law you going to have issues.
Post by: TD1 on June 27, 2023, 06:22:05 am
It's been a thing in the US too to some extent, but with a uniquely American character:
Some US schools *do* have kitty litter.
For sheltering in place during... incidents.
And yet trolls and credulous bigots happily spun a culture-war narrative about it. Along with people demanding that we take their "concerns" seriously and be respectful.
Like no
The people spinning lies to incite hatred should be stopped. With state violence if necessary, AKA fines and whatever.
And the people who believe this shit are a combination of stupid and eager to believe hateful messaging. They don't deserve respect for that, they need deprogramming. The extent to which they actually *believe* what they're saying is debatable- they see a narrative that affirms their bigotry, they share it. Fuck'm. Kindness WILL NOT change their mind.
Obviously, if they *do* change their mind- perhaps because they're tired of being mocked for their gullibility and hatred- I fully believe in restorative justice, which in this case is just "Don't sweat it, cults are addictive, glad you're better now <3". I know many such people. Affirming and respecting their bigotry wasn't what snapped them out of it.
...I mean, I had shitty takes on trans people at first too. People were firm with me- AKA treated me with *actual* respect by calling out how I was wrong. That's been true on more political issues as well. Appeasement doesn't work and it's infantalizing.
I find this... deeply concerning. These parts in particular.
The people spinning lies to incite hatred should be stopped. With state violence if necessary, AKA fines and whatever.
They don't deserve respect for that, they need deprogramming.
Kindness WILL NOT change their mind.
Though those advocating for it always consider it necessary, history teaches us how vile 'deprogramming' is.
Also:
Quote
Appeasement doesn't work and it's infantalizing.Yea, appeasement is infantilising and a stupid idea. It's still not as stupid, nor as infantilising, as enforcing a nanny state over thought/belief.
Frankly, your manipulative approach would probably make the issue MUCH more pronounced. A Crusade may get you Jerusalem - but not for long.
The best way to convince those willing to be convinced? Conversation, personal example, and treating people with respect - which I am going to call the 'kindness' approach.
Which seems to have been the method which worked for you, depending on the form/aggression of the 'calling out.'
Edit: I think most concerning for me is that your approach, boiled down, is 'fight hatred with hatred.'
Post by: Great Order on June 27, 2023, 07:01:01 am
And I'm iffy on the idea of not responding to certain groups/individuals with some sort of force of law. Not the "I don't like X group" types, but the "Murder X group" types, because that's basically stochastic terrorism. That would mean going "Don't kill them *wink wink nudge nudge*" as well because otherwise they'll hide behind the idea they didn't tell them to straight up murder someone so they can't be held accountable for it happening.
Post by: Strongpoint on June 27, 2023, 08:26:14 am
1. Feeling of admiration for someone who they believe has good qualities
or
2. Politness and fair treatment of someone
I had a guy living on my street who spent twenty or so years in prison for various violent crimes. In fact, my neighborhood was full of people like him, he just was quite talkative. Did I ever respect him? Of course not. Did I treat him with respect and was polite? Yes. Should I explain why?
And this experience, among other things, makes me horrified when people seriously propose to deny the second type of respect to people who are already prone to violence and conflict to "teach them a lesson", "put them in their place", or "make them understand their wrongdoings and repent". The result will NOT be pleasant. If you do that on a personal scale, you risk a knife in your guts. If you do that on a state scale, you risk an armed uprising.
Post by: None on June 27, 2023, 09:14:48 am
Post by: TD1 on June 27, 2023, 09:33:06 am
Hmm, nope. For someone whose joy is in kicking over sandcastles, I'm not giving them the politeness to handle mine. They'll find a reason whether you give them one or not.Ehhh, I agree that sometimes you need to defend yourself. In practice, though, life is full of grey areas. And sometimes, you end up attacking someone who doesn't deserve it. This (https://youtu.be/zDw-Q7P25Mo) comes to mind.
Politeness should be exercised where possible, until the alternative is forced on you.
Post by: Strongpoint on June 27, 2023, 10:46:20 am
Hmm, nope. For someone whose joy is in kicking over sandcastles, I'm not giving them the politeness to handle mine. They'll find a reason whether you give them one or not.
Being polite and refusing to defend yourself are not the same. Is it polite to punch someone in the face? No. It is extremely impolite. But if you are attacked it is not a matter of politeness.
Then, if you are attacked and defeat someone in a fistfight, you still don't have any moral grounds to do something degrading, like... let's say, stripping the person naked, and claiming that you did the right thing because they don't deserve respect.
Post by: Rolan7 on June 27, 2023, 04:48:00 pm
Calls for politeness and respectability all too often mean "accept oppression and don't complain". Making bigots feel bad is good. Bigots are cowards who crumple under criticism unless they're allowed to reach critical mass. Letting an "on the fence moderate" feel like big brained or an ally for only supporting *some* oppression is bad and insulting. Rights have never been won solely by being nice. There was always civil unrest driving authority to the table (with the nice, presentable leaders).Hmm, nope. For someone whose joy is in kicking over sandcastles, I'm not giving them the politeness to handle mine. They'll find a reason whether you give them one or not.Ehhh, I agree that sometimes you need to defend yourself. In practice, though, life is full of grey areas. And sometimes, you end up attacking someone who doesn't deserve it. This (https://youtu.be/zDw-Q7P25Mo) comes to mind.
Politeness should be exercised where possible, until the alternative is forced on you.
Things are really, really fucking bad. I still love being trans, I'm not angry all the time like bigots seem to be, but I don't owe anyone a comforting illusion about the state of transphobia right now.
Related, I'm finally going swimming at the beach with my dad next Monday. I'm going to be in a swimsuit. I've been extremely polite, always hiding my tits, and he still insists on misgendering every trans person including me and my partner.
Appeasement doesn't work yet I keep trying it. Then hating myself for it. Well too late, I've already told him I'm going to be visibly femme. "Whatever makes you comfortable" damn straight. I hate that he'll be uncomfortable but he forced the issue by failing to respect people I love, including me, despite me making it as easy on him as I could bear. And then some.
This cost me my relationship with my brother too, back in May. I thought I could trust him, he acted like an ally. Nope. Being NB was fine but being a woman disgusts him. Sucks to suck, I hope he's happier without me. Not like he EVER believed me about the anti-trans legislation, and only wanted to whine about the free speech rights of bigots.
Appeasement. Doesn't. Work.
And Nazis SHOULD be deprogrammed. That's not fuckin shock therapy or castration, you know, the stuff that was done to us and sometimes still is. It's simply making them exist around the targets of their hate until they realize their targets are human beings. This *happened*, you can look it up. Still happens for survivors of modern cults. It should have happened following the civil war too but the South won reconstruction.
No justice, no peace.
Post by: Strongpoint on June 27, 2023, 11:20:42 pm
And Nazis SHOULD be deprogrammed. That's not fuckin shock therapy or castration, you know, the stuff that was done to us and sometimes still is. It's simply making them exist around the targets of their hate until they realize their targets are human beings.
Using the word deprogrammed to describe what is essentially "being forced to tolerate a group of people, treat them fairly, respect their rights and allow them to express their opinion" is creating a wrong impression. It is not that far away from saying "racists should be genocided" meaning that you want to there be no racists in the world.
Quote
Appeasement doesn't work yet I keep trying it. Then hating myself for it. Well too lateIndeed appeasement doesn't work. But being respectful and polite is not the same as appeasement. A firm polite "no, it won't be your way" or "I believe you are wrong", or "stop doing that if you want to have good relationships with me" are neither appeasement nor disrespect.
Quote
Letting an "on the fence moderate" feel like big brained or an ally for only supporting *some* oppression is bad and insultingI am curious, how would you define "an ally of LGBTQI+ or an ally of the trans community?" What are the minimum requirements for you to consider a person an ally?
Post by: EuchreJack on June 28, 2023, 12:14:47 am
Post by: jipehog on June 29, 2023, 07:14:35 am
And Nazis SHOULD be deprogrammed.Curiously this is the same language(reformat not deprogram) that were used by Russia prior to their invasion of Ukraine.
Post by: Criptfeind on June 29, 2023, 07:23:04 am
They've also said that they are invading to stop a ongoing genocide the Russian speaking population.And Nazis SHOULD be deprogrammed.Curiously this is the same language(reformat not deprogram) that were used by Russia prior to their invasion of Ukraine.
Post by: jipehog on June 29, 2023, 07:40:39 am
Post by: Criptfeind on June 29, 2023, 07:53:38 am
Rolan (or maybe magma?) also said there is an ongoing genocide of Trans people. That why keep saying that people should not confuse the political game (with media sensationalism etc) with reality.
That's basically my point here. To spell it out, comparing what someone says to the rhetoric of a nation invading another is super disingenuous. Russia is constantly lying about their motivation and aims, so when you compare their statements to statements of others you are, at best, being pretty insulting with the comparison. And it sounds a fucking lot like you're saying "this rhetoric is bad because Russia uses it" but they also say obvious things like "genocide is bad and we should stop it" to justify their bad actions, but I doubt you'd go so far as to say means that that's a false statement.
That why keep saying that people should not confuse the political game (with media sensationalism etc) with reality.
There's some irony to this statement in particular, but instead of going after insinuations, I'll leave it to you to make actual claims if you want.
Post by: jipehog on June 29, 2023, 08:43:32 am
Post by: None on June 29, 2023, 09:06:29 am
'No appeasement' and 'deprogram Nazis' is not nearly the same as calling for genocide because queer folk who want to be the people they are without getting murdered for it are not committing mass murder. We're not calling for eradication of a people for reasons of nationalist zeal or political posturing.
And in case you forgot, the political right is literally doing just that.
'Deprogramming' isn't a call for the removal of a people. It's a call for a removal of the toxic ideologies that leads to the calls for the removal of people (queer folk) and the stochastic terrorism that the ideology results in.
We have so many better things to be doing right now than playing 'All Lives Matter' about Nazis. Allow me to be polite and suggest you find something better to do than insinuate that queer people are a skip and a hop from committing genocide or invading a neighboring country for imperialistic hubris because we don't want to play nicely with literal fucking Nazis.
Post by: TD1 on June 29, 2023, 09:47:08 am
Nazis are not an ideology. They are people. Nazism is the ideology.
Similarly, LGBTQ folk are people. Gender politics is the ideology.
I mean, y'all draw metaphorical battlefields all the time, complete with enemies and allies.
Which isn't to say that LGBTQ folk are Nazis, but both do inculcate strongly-held ideologies. And that can sometimes lead to similar methodologies of enforcement or 'deprogramming.'
XXXXXXXXXX
I'll note, with this, that I'll probably bow out of the conversation for a while until it cools down. So don't expect a reply to any comments, heh.
Post by: Great Order on June 29, 2023, 09:49:43 am
Post by: Eschar on June 29, 2023, 10:01:16 am
Post by: None on June 29, 2023, 10:14:45 am
Post by: scriver on June 29, 2023, 10:20:58 am
Post by: jipehog on June 29, 2023, 10:31:02 am
And in case you forgot, the political right is literally doing just that.This is LGBTQ thread and I am not commenting on the issues insofar that I think it could help[1]. And yes I think that the uncompromising view that everyone are either angry bigots or insulting disingenuous moderates with hidden nefarious narratives playing into your prejudice. While there is a genocide on going on is essentially a sensationalist narrative that aligns with justification of violence (they are violent, irrational, and coming for me). Personally, I don't believe this is healthy and often result in comments that for anyone else would have been cause for ban.
It doesn't mean people shouldn't fight for their rights, and I don't mean just stuff I would approve of, but they should stay grounded and find positive things about life/future (and people who explain this better than I do)
[1] I have some strong opinion about several related issues, but I don't bring them to this thread, as I doubt they will discussion will benefit my curiosity or people here.
Edit: p.s. I remember young self going on battles on Wikipedia over single words, because I felt it implied something about something, older me is different.
Post by: Rolan7 on June 29, 2023, 10:59:04 am
Some people had some really impressive outfits for it :D
I did go on the first weekend and it was pleasant. Nothing radical, just nice sanctioned Pride in a nearby college town. There's a place for that. It's a contrast to what I did for Trans Day of Visibility, which was much more exciting and fun (and onlookers cheered us on~)
The Pokemon GO Community day, where people recognized me from the tournaments and said hi! Was a Pride-like experience for me personally and very reassuring. (And sweaty haha)
(https://i.imgur.com/GcLW6UL.jpg)
I didn't have my NB necklace yet! I got to wear it to a family reunion. I *mostly* kept it under my shirt but it was still comforting.
(https://i.imgur.com/VXUYnGV.png)
Something fun I saw downtown.
(https://i.imgur.com/NFDayl2.png)
Post by: jipehog on June 29, 2023, 11:17:37 am
Post by: Great Order on June 29, 2023, 06:03:41 pm
-snip-I asked people to stop. It doesn't mean "stop after you get another word in" it means "stop before I lock the thread"
I don't want to lock this thread for a few days so people can cool off, and I want Toady stepping in, permalocking it and banning people because it's gotten out of hand even less.
Iirc this thread was created to make a place to talk outside of America. There's no need to import Ameripol here. Concurring with thread maker.More because I'd be spamming other threads with LGBTQ goings-on, and I figured a thread to contain mine and others thoughts and comments would be a good idea.
American news is fine, non-American news is fine, most topics are fine but sometimes a news article is posted or a discussion started that results in people getting heated at which point the thread starts being put in peril. Hence why the sports debate is banned, it's been done to death already and it just gets peoples tempers up with no actual benefit.
EDIT: OK, my response was maybe a bit crotchety, but the point still stands. It's not that I want to sit here being petty tyrant of a thread, just that having somewhere to discuss things like this with other people is nice and I want to keep it around.
Post by: jipehog on June 30, 2023, 01:32:01 am
regardless, just before that Strongpoint made a valuable comment about allies. Also I do think that you miss out on your community aspect, instead of sacrilege you might want to comment on NB necklace whatever that is, I suspect this will give a cold shower to all the haters and the opposite to you
Post by: Rolan7 on June 30, 2023, 08:49:09 am
No reading only posting :P
Post by: Frumple on June 30, 2023, 09:20:27 am
Post by: Great Order on June 30, 2023, 09:26:49 am
I gather it was really nice for people transitioning over covid because they could hide half their face which made them look less masculine/feminine. And for trans women it meant a good chunk of stubble was invisible.
Post by: Rolan7 on June 30, 2023, 09:45:37 am
It's not entirely about stubble though. Proper shaving, a couple weeks of IPL laser, and some basic concealer has even my rugged follicles under control when I make the effort. There's something about my face shape and I'm not conscious of what it is. I'm really awful at analyzing faces (or remembering them), so I honestly dunno what it is that seems off.
It's not a priority right now though. I'm just happy the IPL seems to be working! Aside from occasionally being oddly cute/NB, I hate my facial hair a lot and it's literally 99% of my dysphoria, so I'm glad it's getting wrekt. I'd rather rely on cosmetics as little as possible. No judgement!! I'm just not high-femme (and it's so much work and skill), and I don't mind looking plain and rugged.
There's something else at play there, too. I'm still sussing it out, but I keep making myself more feminine but then hiding it under masculine clothing. I epilate my legs then wore long pants during the summer. I almost always wear tight sports bras. I keep hiding my NB necklace in my shirt. It's like I want to present masculine for safety and because "it's what I know", but have a secret feminine side for people I trust. Someone suggested it's a control issue and that sounds right. I don't think it's directly a fear of bigots... though that's certainly a factor with certain family members sometimes.
(hopefully those family members are coming around a bit, but this stupid injury is getting in the way of finding out)
Post by: Great Order on June 30, 2023, 08:50:05 pm
Anyone got any recommendations for places that'd be available in the UK?
Post by: MaxTheFox on June 30, 2023, 11:05:59 pm
Anyways Pride is over, never participated in any events because this is Russia.
Post by: Egan_BW on June 30, 2023, 11:45:21 pm
Post by: MrRoboto75 on June 30, 2023, 11:59:47 pm
Pride June is over. Happy Pride July!
PRIDE MONTH 2!?
Post by: Egan_BW on July 01, 2023, 12:01:54 am
Post by: Cthulhu on July 01, 2023, 12:06:53 am
Of course, with newsboard posts comes newsboard comments, and I think some people are going to regret things they've said. It's kind of farcical how mad they get when their shit gets deleted. The only right a ton of people care about is "free speech" which in practice exclusively refers to the right to be a public nuisance. If you're coming into a Juneteenth discussion which celebrates the right to not be someone else's property, during pride month which celebrates the right to live authentically, and start bitching about your right to post stupid shit in the comments, you need to check your carbon monoxide detector.
Post by: EuchreJack on July 01, 2023, 12:36:33 am
Make sure to put an American Flag next to your Pride Flag, and get your rainbow fireworks ready!
Post by: bloop_bleep on July 04, 2023, 12:27:53 am
Post by: Magmacube_tr on July 06, 2023, 05:32:36 am
Post by: scriver on July 06, 2023, 06:47:52 am
Post by: saki on July 07, 2023, 03:14:35 pm
Post by: martinuzz on July 14, 2023, 04:52:03 pm
People that went for a sex change operation, people that went for HRT, or people that only had their sex changed in their passport will henceforth be considered enemy foreign agents from the West. Expect to be tortured, and sent to Siberia. Expect to be tortured until you can name people from the West who turned you into a gay.
So uh.. Max, Kitty. Right now would be a good time to flee your country and seek refuge somewhere else. Over here, in the Netherlands, persecution because of your gender or sexuality is a reasonable ground for asylum. You're welcome here.
EDIT: what I really don't understand about Russia, is that if you are a man who anal rapes men, you are considered a man. If you are a man and are anal raped by a man, you are considered a gay.
With all due respect, the man who wants to put his dick into a man is the gay, not the man who gets an unvoluntary dick up in the arse. The latter is called a rape victim.
Post by: Magmacube_tr on July 14, 2023, 05:15:13 pm
Ah, shit. MAX. MAX. RUN.
Post by: Loud Whispers on July 15, 2023, 09:46:55 pm
Post by: KittyTac on July 16, 2023, 10:12:13 am
I do have an emergency escape plan in case civil war breaks out but I'm only setting it off in that case because I don't want to bother with setting up in another country until I finish my business here or I am in direct physical danger (which this really isn't).
Post by: martinuzz on July 16, 2023, 11:20:06 am
Post by: voliol on July 16, 2023, 02:37:44 pm
In any case, consider that Bay 12 is yet on HTTP, without the S. I don't know what tapping of the lines is done in Russia, or to what resources they have to enact this law and others like it, but this is a tappable line.
Post by: Doomblade187 on July 16, 2023, 03:39:32 pm
Post by: KittyTac on July 16, 2023, 10:06:35 pm
Stay safe. Or don't stay, to be safe.They don't really do this on Western websites especially obscure ones lol. I don't use local social media.
In any case, consider that Bay 12 is yet on HTTP, without the S. I don't know what tapping of the lines is done in Russia, or to what resources they have to enact this law and others like it, but this is a tappable line.
Please stop worrying about me. Pisses me off. I'm staying no matter what.
Post by: MaxTheFox on July 16, 2023, 10:11:26 pm
Yall honestly fuck off from me and KT with this, we know EXACTLY what to do and when and it comes across as patronizing.
Post by: Rolan7 on July 18, 2023, 09:08:45 am
99.7% satisfaction over several years and almost 2000 participants. Not at all surprising, but a convenient link to share with the open-minded. Or to refute the hateful lies people and bots spam incessantly.
SRS isn't a priority for me... Although it is the biology I tend to have in my dreams, so maybe it's something I'll want eventually. I'm still more focused on my face... Home-IPL, which seems to be having gradually more long-term effect even when I skip a week. Supposedly it'll get rid of the beard shadow eventually, and in the meantime a little concealer works great.
I look nice today, even maskless, and that's happening more and more. It'll surprise me when I glance at a mirror and... not mind what I see! It's not feminine but it's not so masc either, it kinda looks... Me. :)
I remember when my whole concept of gender was "not having this face". No euphoria, only dysphoria. I've come such a long way :)
Post by: Strongpoint on July 18, 2023, 10:28:32 am
Quote
99.7% satisfaction over several years and almost 2000 participants. Not at all surprising, but a convenient link to share with the open-minded. Or to refute the hateful lies people and bots spam incessantly.It is not exactly what the article says. It says that 99.7% didn't transition back and\or didn't request surgery to undo their GAS.
Accepting the result and not trying to partially undo it is not the same as being satisfied with it.
Saying that, 0.03% detransition rate indicates good diagnosis accuracy.
Post by: Rolan7 on July 18, 2023, 11:37:03 am
I get the confusion though because that is two different data. Datum? Things
Post by: Strongpoint on July 18, 2023, 01:10:51 pm
True, but the article does say that the 99.7% also expressed satisfaction. If true (I think the study is paywalled?) They both expressed satisfaction *and* declined to detransition.
I get the confusion though because that is two different data. Datum? Things
Well, journalists often misrepresent actual scientific articles. I always seek the original, luckily this one is not paywalled (at least for me. Sometimes it wary by country)
https://journals.lww.com/plasreconsurg/Fulltext/2023/07000/Regret_after_Gender_Affirming_Surgery__A.41.aspx
That article has very few numbers and is mostly about how to deal with regret\prevent regret\mitigate regret.
The only mentioned hard data is out of their 1889 patients who underwent GAS, 6 changed their minds later + they give some info on who wanted reversal (interestingly, 5 out of 6 are AFAB.). While this data is not irrelevant, it is not exactly some kind of a nationwide study. It does indicate that OHSU is responsible and accurate in its diagnosis of gender dysphoria.
Post by: Rolan7 on July 19, 2023, 06:32:57 am
Although I do want to comment on that data when I finally get home tomorrow. Thanks for linking it, the link in the article is confusing (only on mobile?). The dataset is a bit different than I expected. It still seems to represent almost total satisfaction, but it's just surprising. The AMABs are all NB, for example? I want to look more.
Post by: Rolan7 on August 04, 2023, 11:29:10 pm
(that's the entire message, really)
I tried a HRT that's 1/4 the concentration, but doesn't have castor oil.
Which meant I had to take 4x as much
I had an allergic reaction and was a total shithead for a bit, but I was smart enough not to message my enemies.
as much as I wanted to
That was yesterday. Today I felt far better, better than I usually have with sublinguals.
I'm trying not to think about how deficient my local PP is about someone like me who needs such a high dose. (Most people don't need nearly so much).
I'm special. I also make less testosterone than most women.
That's reassuring <3
... I will be okay. I have reasonable courses of action. At least two things to try, next week.
And if I didn't...?
I would try anyway. I didn't like living. Now, I do.
I will do anything to make sure I retain this feeling.
I will do ANYTHING to retain this feeling.
"Death before detransition" is sometimes a threat, sure. But it's also literal. I will do whatever it takes to continue enjoying life.
Post by: Rolan7 on August 07, 2023, 07:03:19 pm
Maybe I shouldn't leave such emotional thoughts here, but they're real... and I'm frustrated with the lack of institutional support for HRT information.
These things are hidden from us. Deliberately.
Why?
Anyway- I have alternatives planned for the next time, and I'm doing fine. Great, actually. I love not having to take sublinguals constantly (low BMI increases the amount of estrogen needed)
Post by: Loud Whispers on August 08, 2023, 06:10:49 am
Post by: voliol on August 08, 2023, 06:53:14 am
[...] and I'm frustrated with the lack of institutional support for HRT information.
These things are hidden from us. Deliberately.
Why? [...]
There's something to be said about healthcare quality and gaps in the medical education of personnel, rather than deliberation, but honestly that likely chalks down to some kind of transphobia either way, just in the ways topics are (de)prioritized. It's not a very exciting answer. And as for those who carry the transphobic agenda, which might affect healthcare through societal pressure (I don't know how that is in North Carolina, here in Sweden we had hormone blockers restricted for teens the other year, for largely outside pressure reasons), their driving force plain hatred, and you can't really make sense of hatred.
Post by: Frumple on August 08, 2023, 06:55:02 am
Might not be hidden, HRT is a young therapy so could just be that there aren't institutions in your area with that info yetIt's... been around for about a half a century, and used pretty regularly for better than twenty years. Not sure if young is the right word for that.
Post by: TD1 on August 08, 2023, 07:44:04 am
There was a big scare over the health implications of HRT at the turn of the century, which I'd bet slowed its implementation.
The wheels of institutions turn slowly, my friend.**
**As a historian I feel I need to addend that this is assuming there are no major social or economic upheavals catalysing some form of changing institutional zeitgeist or what-have-you.
Post by: Loud Whispers on August 08, 2023, 10:07:14 am
It's... been around for about a half a century, and used pretty regularly for better than twenty years. Not sure if young is the right word for that.Basically what TD1 said. Clinical trial research isn't just testing new drugs/procedures/medicines/treatments, but also testing new applications of them/different application methods/different combinations/methodologies e.t.c.
A good example would be one biologic drug we worked on that was already approved for use in asthma, but not yet for nasal polyps. Even though the drug was approved for one use it's treated as a completely new therapy when used for a completely different purpose. Clinical trial research on HRT goes back to the 90s for post-menopausal treatment in AFAB women, 2008 for aging treatment in AMAB men in their 40s-50s, and there have been some starts from 2016 onwards into HRT for gender reassignment (FTM and MTF). Some countries have not had any trial studies done yet, and some areas of the therapy are lacking in study and attention, e.g.:
Quote from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7871443/
To date, no studies evaluating the perioperative risk of thromboembolism have been conducted in patients receiving feminizing hormone therapy.Some reasonable inferences and comparisons with other populations can be inferred, but are not sufficient, since everyone's body is unique and will respond to different therapies in different ways. Without that body of evidence it's harder to make an accurate and informed assessment over what are the most likely adverse outcomes.
Quote from: https://www.europarl.europa.eu/doceo/document/TA-8-2017-0028_EN.html
AM. whereas there is a lack of comparable data on available, accessible and quality transgender-specific healthcare, and products used in hormone replacement therapy are not properly tested and licensed;Refer to this 2017 European Parliament notice discussing various gender related issues, including the paucity of clinical trial information
Quote from: https://www.communitycare.co.uk/2020/12/11/puberty-blockers-consent-treatment-analysis-high-courts-ruling/
Clinical trials for HRT for gender reassignment started in 2019, so whether as gender identity treatment or as age/treatment/disease-related replacement therapy it's young. It's not an important distinction, and I don't know if there is any political value in a therapy being young or old, because the only value is really in as a descriptor between a therapy that has had hundreds of millions of users and generations of research in side-effects & uses like with salbutamol, versus ones where long term effects/side effects/applications are unknown and you literally just have to wait until studies are completed before you fill that blindspot, as with biologics.Spoiler (click to show/hide)
This is only compounded in the youth of clincal studies into gender dysphoria itself, which is best seen in the dramatic implosion of the Tavistock centre:
Quote from: https://www.theguardian.com/society/2023/jan/19/a-contentious-place-the-inside-story-of-tavistocks-nhs-gender-identity-clinic
Spoiler (click to show/hide)
Quote from: https://www.theguardian.com/society/2021/may/02/tavistock-trust-whistleblower-david-bell-transgender-children-gids
But Hobbs argues this criticism is based on a fundamental misunderstanding of what affirmative means. “For me, affirmative is starting from a stance that says gender diversity isn’t a disorder but has existed across cultures through history. It is saying ‘I believe you’ when you tell me about your experience. It is developing a strong relationship based on trust and mutual respect, but it doesn’t mean you don’t explore.”This is another thing that complicates how medicine & LGBTQ+ cross paths, because an endocrinologist or a gender specialist is going to be going in with the mindset of "identify pathology, identify cause(s) and come to cure" whereas for patients it's about choosing who they want to be. Which to be diplomatic, is not something someone with a "clinical" mindset may be equipped to deal with, as there's a reason why "clinical" is considered a synonym for "cold." The medical staff disagreeing even on how to identify and treat dysphoria in Tavistock is illustrative:
Spoiler (click to show/hide)
Now after all those dismal acknowledgements, I must add that the experimentality or youth of a therapy is not a black mark against a treatment. Novel therapies are exciting because they are new and offer solutions to problems where before there were none, or solutions were inadequate or came with undesirable side effects. The Covid-19 vaccines are very good recent examples of where treatments were rushed through normal clinical trial processes, did result in even lethal side effects in some cases, but the overall good rendered the cost worth it (and like HRT, was also used as a political football). Tavistock's failures were not because they used experimental treatments with side effects, it's because they ignored rules on informed consent and proper diagnostic procedures. The patient who took them to court for example was told hormone blockers and mastectomy would be reversible, and staff whistleblowers reported the same despite this just being an obvious falsehood. You would be mindful to inform a child and their parents that taking prednisolone for treating asthma could stunt their child's growth, so it's an aberration to say the least that Tavistock did not append the same caution to HRT or hormone blockers -_-
Apologies in advance if this comes off as highly critical or pessimistic. There are people honestly doing good research here that is worth reading if one is interested (https://onlinelibrary.wiley.com/doi/full/10.1111/apa.16791), and it's worth noting their methodologies, challenges, successes and failures, (https://onlinelibrary.wiley.com/doi/full/10.1111/joim.13441) since they have issues with high patient attrition rates, small patient recruitable populations. (https://pubmed.ncbi.nlm.nih.gov/31751300/) And while there is always going to be the fear that to observe negative side effects or outcomes of a treatment is to discredit it completely, this is not the case, but is a necessary duty of clinical trial workers. That is obvious for any other therapy, but obviously becomes odious if one's study observing the effects on bone density or cardiovascular health on HRT is used as "ammunition" in a culture war & trans erasure. There are those who take the view it's akin to "airing one's dirty laundry" amidst the current environment where the West is arguing over whether non-binary conforming identities are valid in the court of law and civil society, but the alternative is real people get hurt and that produces far more ammunition than any published study ever will, so morally and politically it's necessary. In an ideal world there would be more observational and randomised studies already and so people would be able to find the best treatment plan out of many options, but we're not there yet
Post by: McTraveller on August 08, 2023, 10:38:22 am
But experimenting on people is generally irreversible; almost always on an individual basis, and often on a collective basis.
Post by: TD1 on August 08, 2023, 11:52:02 am
Post by: EuchreJack on August 08, 2023, 11:07:41 pm
As a general rule I wouldn't recommend a PhD to my worst enemy, but I will say that LW would be good at one.LW probably already has one. Even if it's drawn in crayon.
Post by: alway on August 10, 2023, 11:46:09 am
Likewise, nonsense fearmongering about things like "bone density." The only loss in bone density and other issues you get is when cis doctors decide you should have lower doses than you actually need, or prevent you from going from blockers to hrt, because they are chickenshit cowards harming their patients because of fearmongering over negative effects of hrt. This is very common because of bullshit like what you're posting. That shit does real harm.
Post by: Magmacube_tr on August 13, 2023, 03:23:45 pm
It is good shit. Maybe even the best. It is just so sweet. It warmed my cold, dead haert.
Please tell me you read it. I NEED to talk about it.
Post by: Rolan7 on August 13, 2023, 04:05:53 pm
I've been eagerly consuming a lovely comic about a commoner girl who managed to become a knight despite all odds, even a famous knight, but by foul betrayal she is killed and her homeland crushed- and she reawakens in the body of a spoiled and physically frail princess of the conquering empire. It's a fascinating story of a warrior learning what it is to be a lady, despite her wishes. it's also romantic
But I'll share it after I've checked this out- I'm at an excellent stopping point where I've already gleaned some good gender <3
Thanks!
Post by: Starver on August 13, 2023, 04:28:31 pm
(I did discover the other day that there's a further novel in Ann Leckie's "Ancillary" series, that might be worth patronising my local bookstore for, after too long an absence from even a general browse. But I think I've mentioned that universe's tangential relevence to this thread, before, even if it's the scifi plot/etc that's my primary interest.)
Post by: Rolan7 on August 13, 2023, 09:59:32 pm
Do any of you know Heartstopper (https://m.tapas.io/series/Heartstopper/info)? I discovered its existence just yesterday and read ALL of it in the same day.1-8
It is good shit. Maybe even the best. It is just so sweet. It warmed my cold, dead haert.
Please tell me you read it. I NEED to talk about it.
I made a *mmph* squeal and grabbed my face, ironically enhancing the effect
You can't- you can't just do that, man!!
*blushing wildly*
1-9
"I could be anyone, you don't give a shit!" - mood
Post by: Loud Whispers on August 14, 2023, 09:08:06 am
As a general rule I wouldn't recommend a PhD to my worst enemy, but I will say that LW would be good at one.The only thing that matters for PhDs is don't bully the technicians ;-;
Post by: TD1 on August 14, 2023, 09:20:58 am
*Hides the tell-tale jangle of loose change in his pocket*
Post by: Magmacube_tr on August 14, 2023, 09:36:54 am
1-8
I made a *mmph* squeal and grabbed my face, ironically enhancing the effect
You can't- you can't just do that, man!!
*blushing wildly*
1-9
"I could be anyone, you don't give a shit!" - mood
1-10
NO CHARLIE YOU IDIOT
1-11
NO LEAVE THE SCRUNKLY ALONE YOU TIKTOKER LOOKIN BITCH
Post by: Rolan7 on August 14, 2023, 11:00:28 am
I did SUPER like
Spoiler (click to show/hide)
Post by: Magmacube_tr on August 15, 2023, 11:20:40 am
no dont cri. if u cri, i cri.
3-3
All is good.
Post by: Mech#4 on August 16, 2023, 01:14:06 am
Post by: Great Order on August 18, 2023, 02:48:54 am
FIDE decides that transitioning means that you're to be stripped of your chess titles... If you're FTM. MTF is a-ok.
Also there's a two year ban on playing chess in gendered tournaments if you transition because... reasons.
I'm genuinely confused here, is the FIDE saying that there's a difference in intelligence between the genders?
Post by: Strongpoint on August 18, 2023, 04:42:31 am
https://doc.fide.com/docs/DOC/2FC2023/CM2_2023_45.pdf
FIDE decides that transitioning means that you're to be stripped of your chess titles... If you're FTM. MTF is a-ok.
Also there's a two year ban on playing chess in gendered tournaments if you transition because... reasons.
I'm genuinely confused here, is the FIDE saying that there's a difference in intelligence between the genders?
Bolded part is factually incorrect
In the event that the gender was changed from a male to a female the player has no
right to participate in official FIDE events for women until further FIDE’s decision is
made. Such decision should be based on further analysis and shall be taken by the FIDE Council at the earliest possible time, but not longer than within 2 (two) years period.
Why they are doing this instead of allowing it instantly? Well, it is obvious. MONEY. It is better to check if some male GM is actually transitioning or decided to grab some easy cash in a women-only tournament. 2-years max is probably too much but they did write - the earliest possible time.
Is FIDE saying that women have a lower natural ability to play chess? No, it absolutely doesn't. For many years the official position of FIDE of why female players are worse on average is because they are given fewer opportunities.
But it is a damn fact that, on the top level, men play chess better than women. The highest-rated female player is 127th in the overall standing. The only thing to argue is why it is. Mysoginistic people are 100% sure that it is genetic, but Judit Polgar who was consistently in the top 10 in 1990s\2000s is good enough proof that it is unlikely a huge factor (if a factor at all)
Women-exclusive titles like WGM exist as a form of support for a marginalized group. They give access to female-only tournaments and that, among other things, means prize money.
Post by: Starver on August 18, 2023, 05:37:01 am
There are copious arguments all over the place, every which way, but given the lack of various 'key' points (alleged inherent strengths, as per the physical sports) there's a lack of reasoning here. And if there's an issue with transitioned people possibly ever detransitioning, it would seem more proportionate to nullify/footnote 'won whilst transitioned' titles as no longer consistent only upon having detransitioned, rather than "none of you now matter, like you had done - maaaybe we'll reconsider this again shortly", which was my reading on this, last night.
It just smells like conservative-reactionism, rather than any attempt to continue to adapt to unfolding reality. This is my view from outside the arena (chess, trans-ness or indeed femaleness), but the number of objections to this by actual women (including Lady Grandmasters[1]) suggests... something.
Frankly, I suspect it is (or should be) a more tactical move. But to whatever end, that's where I'm more confused.
[1] Which is a title that frankly makes me uncomfortable-by-proxy, though perhaps better than the other alternatives and I can't actually speak for the holders/aspirers for the title anyway.
Post by: Frumple on August 18, 2023, 08:17:09 am
Why they are doing this instead of allowing it instantly? Well, it is obvious. MONEY. It is better to check if some male GM is actually transitioning or decided to grab some easy cash in a women-only tournament.I mean. The eternal question pops up regarding shit propositions like that. Has that ever goddamn happened?
Has there ever, even once, been a case where a male GM decided all the abuse and frustration that comes from publicly claiming transitioning, nevermind the hellscreeching that would come from faking it, is worth the money from a tournament? Is there any grounds to think it would happen outside the delusions of transphobes?
Post by: MaxTheFox on August 18, 2023, 08:38:30 am
https://doc.fide.com/docs/DOC/2FC2023/CM2_2023_45.pdfApparently MTF isn't allowed too.
FIDE decides that transitioning means that you're to be stripped of your chess titles... If you're FTM. MTF is a-ok.
Also there's a two year ban on playing chess in gendered tournaments if you transition because... reasons.
I'm genuinely confused here, is the FIDE saying that there's a difference in intelligence between the genders?
And as a chess fan, yeah this is just FIDE being conservatoids.
Post by: Strongpoint on August 18, 2023, 09:37:54 am
Why they are doing this instead of allowing it instantly? Well, it is obvious. MONEY. It is better to check if some male GM is actually transitioning or decided to grab some easy cash in a women-only tournament.I mean. The eternal question pops up regarding shit propositions like that. Has that ever goddamn happened?
Has there ever, even once, been a case where a male GM decided all the abuse and frustration that comes from publicly claiming transitioning, nevermind the hellscreeching that would come from faking it, is worth the money from a tournament? Is there any grounds to think it would happen outside the delusions of transphobes?
So, your alternative is that everyone should be allowed to compete in the women's category after a simple "I transitioned" with no checks, no proofs, no prerequisites, no anything?
Up to 2 years to check is clearly excessive, but no checks at all is inviting chaos.
And yes, there are grounds to think that people may try to cheat where money is involved. They always do. I have witnessed people cheating with their diagnosis for Paralympic sports for quite trivial amounts of money to get into a better category.
There is also a possibility of political statement, I can totally see chess players declaring themselves women and entering a tournament for pure trolling. Why not if it is not against the rules?
_________________
Frankly speaking, I am amazed. FIDE provided clear and quite liberal rules with a transparent, completely allowed way of changing gender within FIDE rating system. Provide reasonable proof that you have transitioned and rules will apply to you according to your gender. It is all that FIDE asks for. They even said that those are early rules and they recognize that they may require improvement.
And they are still labeled as transphobic conservatoids because there are SOME rules and limitations. FIDE is treated as if they somehow made the situation worse than it was before. At least it could be "We welcome that FIDE made an important step BUT it is not enough and THIS and THAT should be done, too."
NOPE. FIDE is treated as if they did some horrible attack on trans people.
Post by: Rolan7 on August 18, 2023, 10:46:04 am
All yesterday I had to listen to people complain "Oh, it's not technically a ban" and "UP TO 2 years! It could be three days!" while also calling the "liberal coverage" biased and misleading.
It's a total mess. Maybe FIDE really thinks that a lesser women's league will work better than it did in every other sport. Running a chess tournament doesn't necessarily mean they're smart. Maybe they don't know exactly what they're doing. Same with this "waiting period". Perhaps they're just really bad at transvestigating, and honestly need 2 years.
I was happy to be corrected though- from what I heard, women are allowed to compete in the real GM league (along with the Open, of course). Apparently this is true for many sports, it's just exceptionally rare in competitive sports where even the slightest advantage means $$$. So if we ignore all the expectations and social consequences, and their treatment of trans people, this is technically only a benevolent and feminist thing to have.
(Some sports prevent trans men from competing if they're on testosterone. It doesn't matter if their T is still lower than other guys'- the fact they have to take it disqualifies them. My dad claimed this was logical and got so suddenly upset that I dropped it. A certain trans man is a sore subject for him, but I didn't realize he'd extrapolate that so much...)
Post by: Frumple on August 18, 2023, 11:01:32 am
So, your alternative is that everyone should be allowed to compete in the women's category after a simple "I transitioned" with no checks, no proofs, no prerequisites, no anything?I'd bet you 20 USD I've got laying around here somewhere it wouldn't invite chaos is they just went, "Yeah, you are what you say you are."
Up to 2 years to check is clearly excessive, but no checks at all is inviting chaos.
The "check", here, is that publicly announcing you're transitioned or transitioning is not a bloody small thing. You probably aren't going to need organizational regulations on managing that, because society is going to do that job for you well damn enough.
Post by: voliol on August 18, 2023, 11:05:50 am
And the up to 2 year wait is ridiculous. Though from an outsider's perspective it is hard to say whether this is transphobia, or if FIDE is always embarrassingly slow in its bureaucratics. Does it take up to 2 years for them to accept a membership?
Also, what does the "until further FIDE’s decision is made" in section 3 mean? That after the FIDE has approved of a gender change, another decision is needed for the now-reregistered player to be able to play in women's events? Or does the decision refer to FIDE's initial decision to reregister a player's gender with "further" being relative to their legal gender change? Either alternative makes for a weird sentence, though honestly my reading comprehension might be bull.
Post by: Starver on August 18, 2023, 11:18:52 am
As I understood it (currently can't even find the BBC article I read this on[1]) indicated that anyone of any Trans status would basically be cut off (or ignored) for up to two years. And, amongst everything else, anyone who had any ranking as a woman, while competing as a woman (and having been AFAB), but was now a trans-man would retrospectively written out. As if future masculinity should disqualify their efforts.
So great is the male-advantage that apparently not only does one's natal masculinity over-ride complete top'n'bottom surgery plus hormones in this cerebral 'sport', but that the future reality of assuming extra masculinity makes everything a woman does effectively 'cheating'(!)... That's some really complicated 5D chess (https://en.wikipedia.org/wiki/5D_Chess_with_Multiverse_Time_Travel), for certain.
(Surely there's some good way to balance (https://www.xkcd.com/1628/) or compare (https://www.xkcd.com/1392/) these things, even if that were true.)
I support women's rights (under various needs) to establish man-free enclaves for various activities, but where someone has sufficiently becomes not-a-man then they surely earn/deserve the right to similar access to man-free environment. We can (and doubtless will) argue where that line of sufficiency exists for different circumstances (powerlifting, rape-crisis support, board games, video games, etc), but I don't understand ...or I do, but am very far from agreeing with certain opinions... why it is Ok for those who are already traditionally 'othered' to blanket-'other' yet another a sub-minority who would end up effectively exiled entirely from participation in any context.
If anything, I'd suggest unifying (fairly, taking into account opportunity if that's an identified thing) chessmastery of all levels. This isn't like tennis/etc where (apparently) there's no hope for equality and 'mixed singles' matches are considered an 'entertainment' that coupd certainly be taken as a humiliation for the loser (whichever one that is (https://en.wikipedia.org/wiki/Battle_of_the_Sexes_(tennis))) if both players are even going to take it seriously. This was already a chess thing (https://en.wikipedia.org/wiki/Vera_Menchik#Vera_Menchik_Club), anyway, for better or worse.
(Solutions of trans-class competition, with all the issues of para-competition classifications for a given 'impairement' but possibly pitting M2F vs F2M of various respective degrees as well as higher/lower levels of transition mixed within either individual category, would not be an 'answer', any more than just arranging for an adjudicated handicapping[2] system to make exceptional performances stand out exactly as much as they perhaps should do.)
It's all complicated but, for chess people, surely has a better outcome than I understand is currently under advisement.
[1] Their search system is terrible, a search for FIDE brings up an actual 25-year-old news report amongst other non-newsy stuff that's irrelevent. It doesn't appear under LGBT or Women category summaries, nor the Sport side-site (I'm confident I didn't see it there anyway), and all other searches.
[2] As in golf/horse-racing/time-trialling, and as applied to para/disability sport participation but not as in the reason for para/disability participation.
Post by: Strongpoint on August 18, 2023, 11:51:54 am
So, your alternative is that everyone should be allowed to compete in the women's category after a simple "I transitioned" with no checks, no proofs, no prerequisites, no anything?I'd bet you 20 USD I've got laying around here somewhere it wouldn't invite chaos is they just went, "Yeah, you are what you say you are."
Up to 2 years to check is clearly excessive, but no checks at all is inviting chaos.
The "check", here, is that publicly announcing you're transitioned or transitioning is not a bloody small thing. You probably aren't going to need organizational regulations on managing that, because society is going to do that job for you well damn enough.
Why the hell it is not a bloody small thing? What exactly can be done to a person who will openly go "I will legally change my gender to another one for two weeks to get benefits because there are no rules prohibiting me from doing so"?
Hey, if you give me enough incentive and an easy legal procedure to do this I'll "transition" back in forth as many times as necessary
We are not talking about faking transitioning which is not without cost, we are talking about not even needing to fake it because no proof is required
Post by: Maximum Spin on August 18, 2023, 12:23:52 pm
There was a recent example a couple months ago, yes.Why they are doing this instead of allowing it instantly? Well, it is obvious. MONEY. It is better to check if some male GM is actually transitioning or decided to grab some easy cash in a women-only tournament.I mean. The eternal question pops up regarding shit propositions like that. Has that ever goddamn happened?
Has there ever, even once, been a case where a male GM decided all the abuse and frustration that comes from publicly claiming transitioning, nevermind the hellscreeching that would come from faking it, is worth the money from a tournament? Is there any grounds to think it would happen outside the delusions of transphobes?
Post by: MrRoboto75 on August 18, 2023, 01:43:15 pm
Post by: Starver on August 18, 2023, 03:11:51 pm
Why the hell it is not a bloody small thing? What exactly can be done to a person who will openly go "I will legally change my gender to another one for two weeks to get benefits because there are no rules prohibiting me from doing so"?This is when you review the 'accomplishments' of those who transitoned (to whatever degree), made good profit from it then detransitioned. There are "bringing the sport into disrepute" rules that can be activated for anybody actually taking-the-proverbial in this way.
Hey, if you give me enough incentive and an easy legal procedure to do this I'll "transition" back in forth as many times as necessary
You don't just assume assume bad intent for everyone who makes an effort to change their status.
Quote
We are not talking about faking transitioning which is not without cost, we are talking about not even needing to fake it because no proof is requiredIn the long run, the proof is in the commitment. It all is. Even self-certification (available to various degrees in various jurisdictions) isn't just a case of hand-waving your status on a whim just like choosing a different jacket according to what the weather is on any given morning.
I imagine there are indeed those who would push things beyond what is strictly necessary, or even correct (and if not this way, then however else they can). But then there are those who will hold back and not act upon their true feelings if it means not having to battle against seemingly insurmountable opposition and actually have nowhere else to go.
Post by: McTraveller on August 18, 2023, 03:41:53 pm
Interestingly this doesn't even have anything to do with sexuality, just artificial divisions/brackets in competitions.
Post by: TD1 on August 18, 2023, 04:17:43 pm
I'm more in favour of multiple competitions across the spectrum of humanity than one competition between the min-maxed of society.
As a potentially incendiary (for this thread) statement: but yea, where there are categories based on sex we shouldn't let gender determine diddly-squat.
Post by: Strongpoint on August 18, 2023, 04:23:40 pm
This is when you review the 'accomplishments' of those who transitoned (to whatever degree), made good profit from it then detransitioned. There are "bringing the sport into disrepute" rules that can be activated for anybody actually taking-the-proverbial in this way.
You don't just assume assume bad intent for everyone who makes an effort to change their status.
When someone applies for disability benefits, you don't just assume bad intent and check if they actually have a disability...
When someone applies for a position of a neurosurgeon you don't just assume a fraud, let them work, and then, if they kill somebody... After all, why would anyone pretend to be a neurosurgeon?
It is exactly the same logic.
If you claim that you are X and want to get some right, benefit or privilege associated with this status, you should prove that you are actually X. Merely stating "I am X" is not enough. It is how human society works. At least how it should work.
Post by: Starver on August 18, 2023, 05:25:00 pm
As is the continued assertion that self-certification is ever the totality of the right to access a privilidged pigeonhole. self-certification is just the statement of intent. To what extent that intent is accepted and catered for is a matter of the next stage(s) of the process, ideally. In some instances, considerations may indeed allow that person to operate within their target gender (e.g. be immediately relisted in the company directory under your new identity), in others you would be required to effectively undergo medical intervention (e.g. have sanctioned levels of the relevent hormones, at the very least, to be able to compete in physical events).
Between these, somewhere, would lie the case of chess. Should.
And the confusion seems to be as to why such apparently exclusionary (and somehow retrospective) changes are necessary. Even if you want to stop any random Hank Manly from sitting across a chessboard from Barbara Flighty and asserting that they (both) are playing for "women's points". Or however it is decided that this works.
I suggest no solutions here, but try to explain why one absolutist opinion is as ridiculous as the other.
Post by: MaxTheFox on August 18, 2023, 07:13:45 pm
I feel like the solution here is: no divisions, just a single competition environment. You aren't in the top of humanity, you aren't gonna win. Sorry if you can't compete with the pros. Basketball? Yeah sorry unless you have mad shooting skills or something you're not competing with the 7-foot giants. Chess? Unless you have a mutant brain, you aren't competing.Yeah, this.
Interestingly this doesn't even have anything to do with sexuality, just artificial divisions/brackets in competitions.
Also, becoming a super GM in chess isn't as much intelligence (though you need to have this specific kind of intelligence, pattern recognition, be above average) as playing chess for hours a day since like 4 years of age. I'd wager that parents are less likely to do that to girls than to buys for a variety of reasons. That's why there are few female super GMs.
Post by: Strongpoint on August 19, 2023, 01:07:19 am
I feel like the solution here is: no divisions, just a single competition environment. You aren't in the top of humanity, you aren't gonna win. Sorry if you can't compete with the pros. Basketball? Yeah sorry unless you have mad shooting skills or something you're not competing with the 7-foot giants. Chess? Unless you have a mutant brain, you aren't competing.
Interestingly this doesn't even have anything to do with sexuality, just artificial divisions/brackets in competitions.
It is a totalitarian "solution" that will hurt millions to... to achieve what exactly? Is it just to avoid a modest amount of problems caused by the fact that when there are categories, people will disagree on who goes into which category?
For example, as much as I dislike the corrupt mess of Paralympic sport, it is far better than saying all people with disability - Nah, guys and girls, you don't have any right to compete. And if you dare to make your own league\competition you'll deal with the Law (if you ban anything, you need to enforce it, otherwise it is not a ban)
Let's say FIDE goes tomorrow for "Alright, pals. From now on. No more women-only tournaments under FIDE." Do you think no one else will try to organize women-only tournaments? And then we'll still have transwomen wanting to compete there. Problem stays.
Post by: Frumple on August 19, 2023, 01:29:43 am
Let's say FIDE goes tomorrow for "Alright, pals. From now on. No more women-only tournaments under FIDE." Do you think no one else will try to organize women-only tournaments? And then we'll still have transwomen wanting to compete there. Problem stays.It's remarkable how difficult it would be to phrase that worse. Women wanting to compete in a competition for women is a problem, alright. Not with anyone competing or wanting to compete, but it damn sure highlights a problem :-\
Post by: Maximum Spin on August 19, 2023, 01:33:08 am
The problem is that different people mean different things by "women", and having different definitions for words isn't wrong, it just indicates you are not speaking the same dialect.Let's say FIDE goes tomorrow for "Alright, pals. From now on. No more women-only tournaments under FIDE." Do you think no one else will try to organize women-only tournaments? And then we'll still have transwomen wanting to compete there. Problem stays.It's remarkable how difficult it would be to phrase that worse. Women wanting to compete in a competition for women is a problem, alright. Not with anyone competing or wanting to compete, but it damn sure highlights a problem :-\
ETA: You know, honestly, I think the only viable conclusion to draw here is that chess is technically a sport and therefore this discussion should have been banned under the OP rules. Let me just check who's to blame for starting it... *cough*
Post by: Strongpoint on August 19, 2023, 01:55:31 am
Let's say FIDE goes tomorrow for "Alright, pals. From now on. No more women-only tournaments under FIDE." Do you think no one else will try to organize women-only tournaments? And then we'll still have transwomen wanting to compete there. Problem stays.It's remarkable how difficult it would be to phrase that worse. Women wanting to compete in a competition for women is a problem, alright. Not with anyone competing or wanting to compete, but it damn sure highlights a problem :-\
Maximum Spin answered for me. The reality is that people have different opinions of who goes into the category "women chess players". You may dislike it but it is the REALITY. And people will need to reach a compromise. Or not and then some group will stay unsatisfied believing that they deserve more. It is called politics.
If you expect that the majority will accept all demands of the minority and completely bend backward... I have news for you. It is not how human society works. Try compromises and persuasion.
And as I said, I see FIDE rules change as very pro-trans, as something that gives more opportunities for transgender chess players and something that goes against desires of a lot of national chess federations and many players. I find it INSANE that it is under flak for not going straight for "OK, anyone can change their chess gender any moment they please!"
Post by: Maximum Spin on August 19, 2023, 02:05:25 am
Edit more:
I noticed this line in the process:
FIDE decides that transitioning means that you're to be stripped of your chess titles... If you're FTM. MTF is a-ok.This is not true.
The rule says that, if you are a "woman grandmaster" (or whatever), and you choose to register as a man, then, no longer being a "woman", you cannot, obviously, be a "woman grandmaster" anymore. Since "woman grandmaster" is scored on a lower threshold than "grandmaster" due to female players having generally lower scores, you aren't a plain old unqualified "grandmaster" either, unless you have qualified for that separately. However, the "woman" category titles can be exchanged for unqualified titles of equal or lesser score; for example, a "woman grandmaster" is equal to the unqualified "FIDE master" level and can be converted into it freely. The "woman" titles are also restored if the player decides to register as a "woman" again. If the player has unqualified titles already, those titles are not changed. This is pretty straightforward and difficult to question: a "woman grandmaster" must be a "woman", by definition. There are no "man" qualified titles - the unqualified titles are actually open to anyone - so there are no titles to change if someone who was registered as a "man" becomes registered as a "woman".
Wouldn't the problem actually be if someone who was no longer registered as a "woman" were still called "woman grandmaster"?
Post by: Starver on August 19, 2023, 02:31:35 am
I find it INSANE that it is under flak for not going straight for "OK, anyone can change their chess gender any moment they please!"I find it insane that THIS is your interpretation of it. You seem convinced of it, though.
Post by: MaxTheFox on August 19, 2023, 03:00:54 am
Post by: Maximum Spin on August 19, 2023, 03:07:27 am
All this kind of discourse, over a year or so, accomplished to me is change my opinion to "there should be no gender segregation in sports altogether". Yeah it does mean that in many sports women don't have a chance to be "the best", but you don't see a separate league for short people in basketball, or slow-footed people in the 100m sprint, so why does it matter? Not everyone can be "the best", that is a fact.Paralympics too?
I mean, I'm completely fine with this in theory, but as long as there's money to be made offering female leagues — and there will definitely always be money to be made for sufficiently bouncy sports, at least — people are going to organize them, unless you plan on shooting them for it.
Post by: Strongpoint on August 19, 2023, 03:34:07 am
All this kind of discourse, over a year or so, accomplished to me is change my opinion to "there should be no gender segregation in sports altogether". Yeah it does mean that in many sports women don't have a chance to be "the best",Let's assume this will be done. The IOC will gather and say - No more male\female separation! It is an outdated sexist idea. The goal of the sport is to find the strongest among all humans.
But what do you propose to do when other entities will start organizing leagues and competitions for women? Make it illegal?
Quote
but you don't see a separate league for short people in basketball, or slow-footed people in the 100m sprint, so why does it matter? Not everyone can be "the best", that is a fact.
We do see weight categories in many sports. Exactly because otherwise a 60kg guy wouldn't be able to meaningfully compete in boxing or weightlifting. Why it is not done in more sports? Not as large of a difference and no demand from athletes and\or spectators.
Post by: MaxTheFox on August 19, 2023, 04:28:49 am
I mean, I'm completely fine with this in theory, but as long as there's money to be made offering female leagues — and there will definitely always be money to be made for sufficiently bouncy sports, at least — people are going to organize them, unless you plan on shooting them for it.
Let's assume this will be done. The IOC will gather and say - No more male\female separation! It is an outdated sexist idea. The goal of the sport is to find the strongest among all humans.Let them be, I suppose. My gut says they will have less support than the "official" option because people flock to official things. If it doesn't work out and the IOC starts falling apart then I guess go back to the drawing board. Worth a try!
But what do you propose to do when other entities will start organizing leagues and competitions for women? Make it illegal?
Paralympics too?
We do see weight categories in many sports. Exactly because otherwise a 60kg guy wouldn't be able to meaningfully compete in boxing or weightlifting. Why it is not done in more sports? Not as large of a difference and no demand from athletes and\or spectators.Paralympics are fine, most disabled athletes can't compete in any kind of entertaining or safe way against able athletes-- imagine if a soccer team had the goalie be on a wheelchair. Same for weight categories in combat sports like boxing. Real life isn't Punch Out!! and a physically small person doesn't stand a chance against a larger fighter. In other sports there's not as much of a difference, even in basketball it is mitigable to an extent (at least mitigable enough to approach fairness) unless you have dwarfism or something.
Post by: Caz on August 19, 2023, 04:55:32 am
Also what do ya'll think of Italy's "no more birth certificates you blasted homosexuals" ideas?
Post by: MaxTheFox on August 19, 2023, 05:21:37 am
Post by: Caz on August 19, 2023, 05:29:14 am
Hello Max!
Post by: Starver on August 19, 2023, 05:54:31 am
I just want to know when the gay agenda is taking over.
- To confirm the minutes of the last meeting.
- To hear the Reports from the respective Directors of the Board
- To accept and adopt the Balance Sheet and Statement Of Accounts for the prior financial year
- Election/re-election of Directors as required by retirement or rotation of position
- To maintain or appoint the official external Auditors
- Any Other Business
- To set the Date, Time and Location of the next proposed meeting
Post by: EuchreJack on August 19, 2023, 08:12:23 am
EDIT: Oh, CHESS. Not a sport. *Dodge the attack*
Moving on...
Post by: MaxTheFox on August 19, 2023, 08:40:11 am
Post by: MrRoboto75 on August 19, 2023, 09:47:30 am
Post by: Great Order on August 19, 2023, 09:51:15 am
Things do be getting heated again. Keep an eye on it people.
Post by: Caz on August 19, 2023, 10:18:34 am
Post by: Rolan7 on August 19, 2023, 10:27:36 am
I came out as "gay" to my mom over pizza, it was nice. My brother kinda arranged it and it went really well. She didn't seem surprised XD
Hope y'all have fun!! It's nice to have a celebration of something like that, it leaves a good memory. "Oh okay who cares" is valid too but feels underwhelming in my experience.
Post by: Maximum Spin on August 19, 2023, 02:01:59 pm
Also what do ya'll think of Italy's "no more birth certificates you blasted homosexuals" ideas?Could you elaborate? I haven't heard of this. I'm trying to figure out what it could mean, but I have too many guesses.
Sure, I could look it up, but where's the fun in that?
Post by: Starver on August 19, 2023, 02:11:54 pm
(The "told not to register the children of same-sex couples" bit, rather than the reported small victory against misappropriating the image. I don't know anything more about the registration thing, though.)
Post by: Maximum Spin on August 19, 2023, 03:16:34 pm
Nobody should need this to begin with. They shouldn't even be in the position to make that decision.
Post by: Magmacube_tr on August 19, 2023, 04:32:10 pm
I came out as "gay" to my mom over pizza, it was nice. My brother kinda arranged it and it went really well. She didn't seem surprised XD
If you excuse me, I will be imploding with jealousy.
Post by: None on August 19, 2023, 05:37:49 pm
More positively, I picked up a cool book titled Gay New York, it being a historical analysis of the culture of gay and queer men in New York in and around the Prohibition times. I only got a couple dozen pages in before gifting it to a gender studies librarian friend, but it had lots to say about the origins of queer terminology and how gender and sexuality were perceived differently even within the communities and how it compared by social classes.
As much as I'll miss the book, it's in better hands now.
Post by: EuchreJack on August 19, 2023, 08:32:58 pm
Sounds like it's the situation described within this news article (https://www.bbc.co.uk/news/world-europe-66502936), that I saw the other day.
(The "told not to register the children of same-sex couples" bit, rather than the reported small victory against misappropriating the image. I don't know anything more about the registration thing, though.)
I'm sorry, but let's not overlook this gem from the article:
"Brothers of Italy - Fratelli d'Italia in Italian - were ordered to pay for the "offensive use of their image" after Italian LGBT law firm Gay Lex took on the case. The party is appealing the decision."
As for WHY it matters that children of same-sex couples be entitled to the same rights as everyone else, there was another linked article that explains:
"That left a regulatory vacuum surrounding several aspects of LGBT family life, including adoption. Solutions aimed at getting around bureaucratic hurdles were reached on a case-by-case basis, as cases went to court...
Children who are denied the right to have both parents recognised on their birth certificate are left in a legal limbo.
Their families face a range of challenges. In the most extreme scenario, if the legally recognised parent were to pass away, the children could become wards of the state and face the prospect of being orphaned." (https://www.bbc.com/news/world-europe-64967517)
The Law does NOT find truth, it CREATES truth. If you have no rights under the law, you have NO rights under the law.
It's why I lose my shit when someone says "natural law". Guess what? Monkey's don't hand out parking tickets, nor hold court. Law is an inherently artificial construct that humans created to assist them in their interactions with other humans.
Now, "natural rights" is truly a thing, as humans have the same right to fight back against anything trying to kill them as any other animal.
Post by: Great Order on August 28, 2023, 09:00:52 am
Post by: Rolan7 on August 28, 2023, 12:57:52 pm
3-1(Link to Heartstopper page 1 since it has been a while: https://tapas.io/episode/428109 )
no dont cri. if u cri, i cri.
3-3
All is good.
So I'm finally all caught up now! I liked taking my time with it. I didn't realize it's ongoing, but honestly it feels like the primary narrative is complete.
The will-they-won't-they and being cute was fun, but I really appreciating them going into the dark issues in... chapter 5 I think? Seemed like a healthy portrayal of those sorts of problems.
Anyway looks like there's already a second season on Netflix! The preview clip has some Imogen chick claiming she's dating Nick, so I guess there are differences? Unless she was in the comic and I forgot XD Either way, I'm looking forward to checking it out.
Right now I'm re-listening to a podcast about Stein's Gate, a popular time-travel Visual Novel (and anime?) with a trans character. I forget the details, but I seem to remember the game going into that classic trans dream of alternate timelines.
https://www.youtube.com/watch?v=iguya5vCg8o&list=PL-DNICST8Zbx9c7VJEBldhCVWgjk3_mfH&index=63&pp=iAQB
In fact, here's a trans fic in the format of text messages along those lines. It made me cry when I first read it. sorry it's on Twitter
https://twitter.com/Azure_Writing/status/1452324640957902852
As for reading, I'm currently enjoying a classic manga called Power!! or Girl Got Game. It's a mostly-comedic and over-the-top tale that appears to be about a girl pretending to be a boy so she can play serious basketball. Her father pushed the situation on her, and Volume 2 is making it clearer that she'd rather present as a girl. (maybe that was supposed to be clear from how hard she secretly crushes on some of her male classmates, but she could have been a gay trans guy! IDK!!)
Anyway it's about sports and gender and cute guys. I found it on a site called mangatoto which I probably shouldn't link directly to
Lastly, the free online manga I originally mentioned weeks ago: From A Knight To A Lady. I'm excited to get back into it. The concept is:
A commoner girl decides to become a knight, and does so. She doesn't crossdress or anything, she just trains exceptionally hard and her nation accepts her service to defend against an expansionist empire. She even becomes a captain! Her team poke fun as soldiers do, but she pokes back and is "one of the guys" and everything's great. It's even looking like they might successfully repel the empire, thanks largely to her elite team.
Oh no she gets betrayed and fatally stabbed!!
When she wakes up, it's several years in the future. Her homeland is conquered. Bizarrely, she's in the body of a frail noble girl of the invading empire!! Almost too weak to walk, and apparently very spoiled.
That's how the story begins lol. She has to learn courtesy, hold back her rage at the empire, and hunt down her betrayer... if she can even get out of bed.
I found the concept engaging since she's clearly a woman in either form, but a lot of her GNC behaviors are particularly out of place in the body of a noble "lady". It's interesting how she rises to this challenge and even gains a grudging respect for ladies, who are suppressed by misogyny just as she had been.
Also her mysterious new attitude impresses her cute arranged fiancee and maybe they don't entirely hate each other <3
https://mangabuddy.com/from-a-knight-to-a-lady/chapter-1
oh goodness I'm only on chapter 27 out of 93 waow. A lot of stuff has happened already so I'm kinda surprised! Pleasantly.
Post by: voliol on August 28, 2023, 02:01:00 pm
In general there's a lot of gender and gay in manga and anime, since 70s shōjo manga authors started it with say The Rose of Versailles and The Heart of Thomas. Though quite a lot of it is not too great when it comes to accuracy, since the target group is as often straight cis people wrestling the claustrophobic gender roles of Japanese society, as it is LGBTQ+ people*. Most (in)famous is perhaps the yaoi/BL genre and the amount of yuri written for men, basically occupying some space ranging between gender escapism and gay/lesbian porn for straight people. But I imagine it's similar with trans characters, versus characters who have trans flair but exist to explore tight gender roles and/or a want for femboys/tomboys. Though it goes for like everywhere, that explicitly trans character are very rare. :(
*Not to say LGBTQ+ people don't consume these works. Flower Tribes and Female Desire: Complicating Early Female Consumption of Male Homosexuality in Shōjo Manga. (https://www.academia.edu/195374/_Flower_Tribes_and_Female_Desire_Complicating_Early_Female_Consumption_of_Male_Homosexuality_in_Sh%C5%8Djo_Manga_) by James Welker is a favorite paper of mine, about readers of early readers of BL who can be viewed through both a lesbian and transmasc lens. And even if bara exists as a "by gay men, for gay men" genre in parallel to the "by women, for women" of BL, that doesn't mean gay men don't read BL.
Post by: Loud Whispers on August 28, 2023, 03:32:23 pm
The hero Max and his party defeat the demon lord. Save the world. All is good.
Except the demon lord reincarnates to have a rematch with Max only to discover the world has modernised and Max is just a washed out has-been. At the start it becomes clear the demon lord has some kind of transcendental love for the hero that goes beyond gender and sexuality (love for the one person they considered a true equal), and as a demon who can change shape or reincarnate they don't really have as strong an attachment to their male identity. But then the demon lord keeps pretending to be Max's girlfriend and you can sum up their sheer awkward energy as "hahahaha wouldn't it be so stupid if we like held hands and gazed lovingly in each other's eyes hahahaha but that would be so silly... UNLESS...?"
The jokes all land pretty well and then they start involving politics and drama from old friends... And it just works
Post by: Mech#4 on August 29, 2023, 12:43:13 am
"Girl Friends" wikipedia page. (https://en.wikipedia.org/wiki/Girl_Friends_(manga))
Post by: martinuzz on August 29, 2023, 05:57:07 pm
If he is convicted, he will face the death penalty. His crime is having had sex with a 41 year old male.
The new law, which is regarded the most draconic and gruesome anti-LGBTQ+ law in the entire world, not only makes the act of homosexuality punishable by death.
Anyone deemed accomplice can face up to 7 years in prison, for example, a hotel owner renting out a room in which a homosexual act took place.
Promoting homosexuality will be punished by 20 years in prison. Unsurprisingly, activists and organisations helping LGBTQ+ can no longer operate in the country.
In response to the new law, some countries, including the Netherlands, have frozen developmental funds and partnerships, and the World Bank decided this month not to grant any new loans to Uganda, because 'the law is fundamentally in contradiction with our bank's values'.
So far to little effect. Ugandese politicians say the law is nescessary to protect Uganda from Western influences.
Sigh.. Why is LGBTQ+ acceptance becoming more and more of a casus belli for international relations :P
I guess it's nothing new. Hitler didn't only send Jews, Sinti and Roma to the gas chambers, gays were also targeted for extermination.
Post by: Great Order on August 30, 2023, 05:01:26 am
As for protecting from "Western influences", it's a post-colonial nation. They're protecting Western influences, just older ones.
Post by: Loud Whispers on August 30, 2023, 05:08:31 am
Post by: Rolan7 on August 30, 2023, 11:10:52 am
And, rather depressingly, upon being rescued from the camps anyone who was gay was immediately sent to prison.Yeah, but not even just the older ones! Evangelicals have been exporting violent homophobia into Africa in the 21rst century.
As for protecting from "Western influences", it's a post-colonial nation. They're protecting Western influences, just older ones.
https://foreignpolicy.com/2023/03/19/africa-uganda-evangelicals-homophobia-antigay-bill/
Sanctioning Uganda is probably the best bandaid *now*, but it's pretty hypocritical when we protect and respect and honor these fucking bloodthirsty racist homophobic shitheads in our own countries. We should treat them as murderers, not give them GODDAMN TAX EXEMPTIONS
This one quotes actual Zambian politicians: https://www.tampabay.com/opinion/2023/04/08/heres-what-american-christian-fundamentalists-are-exporting-africa-column/
The film God Loves Uganda covered this shit a decade ago
Yet we're supposed to treat all this as some religious liberty thing. Blood-soaked fucks. AND cultural gen- uh, "people who want to replace the culture of people they view as lesser". don't want to get controversial by using the scary phrase.
My point is that there are things we could do here at home. These people should not feel safe, and they certainly shouldn't be fucking subsidized.
Post by: Caz on August 31, 2023, 05:55:44 am
Ugandese politicians say the law is nescessary to protect Uganda from Western influences.
Didn't Ugandan homophobic beliefs stem directly from colonial Europe?
Post by: Magmacube_tr on August 31, 2023, 06:51:30 am
Ugandese politicians say the law is nescessary to protect Uganda from Western influences.
Didn't Ugandan homophobic beliefs stem directly from colonial Europe?
It did. That's the irony.
Post by: martinuzz on August 31, 2023, 11:11:29 am
Didn't Ugandan homophobic beliefs stem directly fromYes it didcolonial EuropeChristianity?
Post by: TD1 on August 31, 2023, 11:40:16 am
Post by: Loud Whispers on August 31, 2023, 01:57:21 pm
To defeat the colonial Europe... You must BECOME the colonial EuropeUgandese politicians say the law is nescessary to protect Uganda from Western influences.Didn't Ugandan homophobic beliefs stem directly from colonial Europe?
Post by: Rolan7 on August 31, 2023, 03:14:47 pm
Ohhhh, are there any pre-colonial records of Ugandan homosexual practices?The people of that area, like many in Africa (and Scandinavia), passed their histories on orally. From what we know this was very effective at keeping knowledge intact and alive in the face of centuries. It did less well against deliberate and violent procedures to wipe it out.
You might as well look at the Christian Norse writers who recorded syncretic, "corrected" versions of the old stories in order to figure out whether there were Norse Homosexual Practices.
Sorry if this comes off a bit aggressive but like... The answer is "Probably not anymore", and I'm trying to assume you somehow didn't already know that when you asked the question. Like, I don't consider myself a historian, particularly not of African history (I even just now fell in the trap of acting like the entire continent is one culture lmfao) but even I correctly guessed that Uganda did the oral history thing. I even checked :o
Anyway you know what we do have records of? The bloodthirsty fucksticks who went over there only a decade or two ago and pushed for these laws using colonial influence. I cited some of those records.
The fact that they felt the need to do that suggests to me that the Ugandans weren't sufficiently homophobic previously. Maybe that answers your question.
I'm so bad at coming out lol, but I think I stumbled into a good experience today? I barely slept last night but my mom's friend needed computer help again, so I downed a big soda and went over there. We recovered his passwords (again lol) and got all his contacts synced to a new phone, via cable, it was all very cool. He was extremely happy. I was too. He called me a "booger" and a "genius".
In my altered state I found myself immensely relieved he didn't call me a "young man" this time, and I kinda blurted that out. He didn't seem to get it. So we sat and had a nice conversation about nutrition, and diabetes, and then I explained that while most of my family takes insulin I take estrogen.
that got through lol
And he kinda reacted... perfectly?
He was a bit surprised- fair, because I've always dressed masc around him. But he didn't *say* that. He said he was happy for me, that he certainly didn't have a problem with it...
And then he started talking about how there are so many bigots these days, and (this is the part that surprised and touched me) that they don't make sense.
I kinda expected the liberal "Well I don't get it but you have a right to do whatever crazy thing" brand of tolerance. It's... not the worst. Instead he made a point that bigotry is *wrong*, and that bigots have lost sight of our common humanity.
like, waow *_*
And I got to talk about the friends I've lost to the fascist pipeline... but also how I've found new friends who *escaped* from that sort of thinking. We're faced with fear and hatred, and we offer forgiveness. Our enemies are still people with the ability to grow and change. Like many of us did.
It felt really good to get that out. I think a lot of classic-libs see bigots and queer people as two equal sides in a war- a message the fash constantly push in memes- but a bigot can always stop being a bigot. Forgiveness obviously isn't automatic but at least it's possible. Trying to ingratiate oneself to someone who hates you... goes poorly, in my experience. (and I didn't even get that sweet grift money...)
anyway I'm exhausted but I'm really glad I told him. Wasn't expecting it to go bad, but I wasn't expecting it to go so well either.
Post by: MaxTheFox on September 01, 2023, 03:26:08 am
Ohhhh, are there any pre-colonial records of Ugandan homosexual practices?Their last king before colonization was openly bi and nobody cared.
Post by: Caz on September 01, 2023, 07:55:46 am
Ohhhh, are there any pre-colonial records of Ugandan homosexual practices?The people of that area, like many in Africa (and Scandinavia), passed their histories on orally. From what we know this was very effective at keeping knowledge intact and alive in the face of centuries. It did less well against deliberate and violent procedures to wipe it out.
You might as well look at the Christian Norse writers who recorded syncretic, "corrected" versions of the old stories in order to figure out whether there were Norse Homosexual Practices.
Sorry if this comes off a bit aggressive but like... The answer is "Probably not anymore", and I'm trying to assume you somehow didn't already know that when you asked the question. Like, I don't consider myself a historian, particularly not of African history (I even just now fell in the trap of acting like the entire continent is one culture lmfao) but even I correctly guessed that Uganda did the oral history thing. I even checked :o
Anyway you know what we do have records of? The bloodthirsty fucksticks who went over there only a decade or two ago and pushed for these laws using colonial influence. I cited some of those records.
The fact that they felt the need to do that suggests to me that the Ugandans weren't sufficiently homophobic previously. Maybe that answers your question.
I'm so bad at coming out lol, but I think I stumbled into a good experience today? I barely slept last night but my mom's friend needed computer help again, so I downed a big soda and went over there. We recovered his passwords (again lol) and got all his contacts synced to a new phone, via cable, it was all very cool. He was extremely happy. I was too. He called me a "booger" and a "genius".
In my altered state I found myself immensely relieved he didn't call me a "young man" this time, and I kinda blurted that out. He didn't seem to get it. So we sat and had a nice conversation about nutrition, and diabetes, and then I explained that while most of my family takes insulin I take estrogen.
that got through lol
And he kinda reacted... perfectly?
He was a bit surprised- fair, because I've always dressed masc around him. But he didn't *say* that. He said he was happy for me, that he certainly didn't have a problem with it...
And then he started talking about how there are so many bigots these days, and (this is the part that surprised and touched me) that they don't make sense.
I kinda expected the liberal "Well I don't get it but you have a right to do whatever crazy thing" brand of tolerance. It's... not the worst. Instead he made a point that bigotry is *wrong*, and that bigots have lost sight of our common humanity.
like, waow *_*
And I got to talk about the friends I've lost to the fascist pipeline... but also how I've found new friends who *escaped* from that sort of thinking. We're faced with fear and hatred, and we offer forgiveness. Our enemies are still people with the ability to grow and change. Like many of us did.
It felt really good to get that out. I think a lot of classic-libs see bigots and queer people as two equal sides in a war- a message the fash constantly push in memes- but a bigot can always stop being a bigot. Forgiveness obviously isn't automatic but at least it's possible. Trying to ingratiate oneself to someone who hates you... goes poorly, in my experience. (and I didn't even get that sweet grift money...)
anyway I'm exhausted but I'm really glad I told him. Wasn't expecting it to go bad, but I wasn't expecting it to go so well either.
Aw that's such a nice interaction.
Post by: Great Order on September 01, 2023, 08:00:43 am
I'm uh... actually doing something to move towards femme that isn't a cheap women's jacket I keep in my closet (Ironically) or underwear. Feels less momentous than I'd imagined.
Post by: TD1 on September 01, 2023, 08:15:51 am
'Christian Norse writers' meaning the Saga writers? If it's good ole Snorri, it's hard to tell whether he let his Christianity run rampant in the Prose Edda. Undoubtedly it cropped up. I seem to recall he prefaced the Edda by saying 'hey this is Pagan malarkey but it's important to understand the kennings told here. They have literary value, whether for studying other Norse literature or creating your own, soooo....'Ohhhh, are there any pre-colonial records of Ugandan homosexual practices?You might as well look at the Christian Norse writers who recorded syncretic, "corrected" versions of the old stories in order to figure out whether there were Norse Homosexual Practices.
Which, again if I recall it correctly, suggests to me a fair degree of adherence to the original oral (or even literary, hello Poetic Edda!) sources.
Anywho, yea, some Very Serious scholars have done exactly that. Looked at Christian saga/poetry sources for evidence of Viking homosexual practices, I mean. The sources show homosexuality to be permissible if one is the 'active' partner. The sin being submission, not entirely homosexuality. Which of course is contra to Christian teaching.
Quote
Sorry if this comes off a bit aggressive but like... The answer is "Probably not anymore", and I'm trying to assume you somehow didn't already know that when you asked the question. Like, I don't consider myself a historian, particularly not of African history (I even just now fell in the trap of acting like the entire continent is one culture lmfao) but even I correctly guessed that Uganda did the oral history thing. I even checked :o
Ah! I read the tone correctly then; you were being aggressive.
I'll answer shortly, then. As a historian, I can tell you that we're capable of extracting a wonderful wealth of meaning from incredibly biased sources. Hell, the more biased the better. Though of course it takes a deft hand to tease out the information. Whoo, postmodernism.
And besides which, not all sources are textual. Though I perhaps should have used a more general term than 'records.'
Quote
Anyway you know what we do have records of? The bloodthirsty fucksticks who went over there only a decade or two ago and pushed for these laws using colonial influence. I cited some of those records.
The fact that they felt the need to do that suggests to me that the Ugandans weren't sufficiently homophobic previously. Maybe that answers your question.
Nahhh, not really mate. It touches on the edges of my question but completely misses its essence. Which is all good; text is a vague medium at best.
I'll look into it myself in a bit. Seems like an interesting rabbit hole.
Post by: Great Order on September 01, 2023, 09:17:53 am
Post by: Starver on September 01, 2023, 09:55:42 am
That said, acceptable practices probably varied decade by decade[1] and geographically[2]. "Greek and Roman" covers a lot of ground, and attitudes[3], and the baseline surely varied a lot. And then of course the individuals who were openly either staid or scandalous outliers, as I'm sure can be teased out of historic documents/fragments by any actual classicist with the yen to do so.
[1] when you had certain Emperors, fashions might change, or the stance of the various priestly authorities changed, etc, as the figureheads and authoritative trend-setters inevitably changed .
[2] Each Greek city state had - at various times - its own collection of expectations and allowances, or a Roman port might find itself generally more a syncratic mix of everything going compared to other more insular settlements.
[3] From the pious to the hedonistic. Or, because of some of the flavours of gods, piously hedonistic!
Post by: Maximum Spin on September 01, 2023, 03:33:36 pm
Their last king before colonization was openly bi and nobody cared.It's way more complicated than that. There's no evidence that it's true, he's accused of raping male peasants as part of his extensive tyranny, and it's tightly meshed with the propaganda of missionaries trying to overthrow his strongly pro-pagan administration. So the whole thing is dubious.
Hang on, wasn't the thing about "topping" being OK also present in Greek and Roman religion/culture? Like, topping is manly, but bottoming is effeminate?Roman, yes. It was actually illegal for a Roman citizen to allow himself to be penetrated. That was what foreigners were for. There are some great literary scraps about this; Martial in particular.
The Greek case is more complicated; they had a clear concept of effeminacy, the "cinaedos", but this didn't apply in the context of a 'normal' homosexual relationship, and they also considered butt stuff to be wrong in general, but not specifically unmanly. It would be mostly wrong to have the impression you described of the Greeks.
What Starver's saying is largely irrelevant.
Post by: Starver on September 01, 2023, 04:00:03 pm
What Starver's saying is largely irrelevant....but even you say that the ancient(ish) world has no monolithic sense of social mores. Please don't pretend to 'understand' what I say, as you argue against what I didn't. At least you could complain that I don't explain myself well enough and/or drift away from the point - that'd be fair enough, as I'm sure others would more readily agree, including me.
Post by: Maximum Spin on September 01, 2023, 04:08:38 pm
...but even you say that the ancient(ish) world has no monolithic sense of social mores. Please don't pretend to 'understand' what I say, as you argue against what I didn't. At least you could complain that I don't explain myself well enough and/or drift away from the point - that'd be fair enough, as I'm sure others would more readily agree, including me.Well, there is simply no monolithic ancient world in the first place (classical Greek and classical Rome aren't even the same time period), but that doesn't mean we can't say anything and don't know anything. I'm not arguing against anything you said. You don't appear to have said anything.
Post by: Strongpoint on September 01, 2023, 04:40:21 pm
Hang on, wasn't the thing about "topping" being OK also present in Greek and Roman religion/culture? Like, topping is manly, but bottoming is effeminate?
Romans yes. Greeks... it was more complicated. Especially if we remember that there was no unified Greek culture. City-states were quite different.
Post by: Maximum Spin on September 01, 2023, 05:01:57 pm
Especially if we remember that there was no unified Greek culture. City-states were quite different.Mmm, yes, this is also true, but mostly people only care about Athens because that's what we know the most about, and a lot of what we do know about the others comes from Athenians. Athenians never shut up about anything.
Post by: Loud Whispers on September 09, 2023, 05:33:40 pm
I personally think Thebes is underrated. The city was universally credited as the scummiest and most bastard-filled den of wretched villainy for centuries. But it was a military power that crushed Sparta and a cultural powerhouse that made a great deal of the poems and epics the Athenians stole the credit for, and the most ancient of the Greek city states. Xenophon's anabasis is 100% a must read for how fun he characterises each citizen of their city state. (https://www.gutenberg.org/files/1170/1170-h/1170-h.htm) The Spartan general Clearchus is so war-hungry he got exiled from Sparta, and every piece of gold he acquires he just uses to recruit more soldiers. Everyone loves him. Proxenus the Boeotian is skilled at gaining promotions but utterly indifferent to actually leading his men, and no one respects him. Menon the Thessalian is such a wretched villain, that the only reason he makes friends with anyone is because friends are really easy to rob. Xenophon the Athenian himself, wasn't even supposed to be one of the generals there, essentially going as a student on his gap year abroad (after cheating the oracle by asking when should I join the expedition rather than if I should join the expedition). But due to unfortunate circumstances Xenophon ends up winning an election. Each of the Greek city states brings their own specialties to the fore. Guys whose specialties are light infantry peltasts, cavalry specialists - even Rhodian slingers. There's so many brilliant moments.Especially if we remember that there was no unified Greek culture. City-states were quite different.Mmm, yes, this is also true, but mostly people only care about Athens because that's what we know the most about, and a lot of what we do know about the others comes from Athenians. Athenians never shut up about anything.
-A moment Cyrus, the Persian Prince, gets down in the mud to help get the wagons unstuck. His Persian nobles join him, proving they are not like his brother Artaxerces.
-A moment where a Persian noble doesn't get why Cyrus is putting this much effort into recruiting the Greeks. They have 70,000 Persian soldiers with them, so why would 10,000 Greeks matter? One of the Greek generals (I think it's Clearchus, but I may be wrong) gives the signal and the whole mood in camp changes at once. The Greeks immediately form a phalanx and at another signal, begin marching towards their Persian allies in the camp. At another signal they break into a sprint and all of their allies LEG IT. I don't remember the conversation afterwards but I imagine it had a lot of Cyrus going "I told you so lmao."
-A moment where Xenophon gets reported to the council of elected-officers to explain why he threatened to murder one of his fellow soldiers. Xenophon confesses and says he would absolutely murder him, because he caught the man trying to leave one of their wounded for dead. The elected council side with Xenophon and fine the man who accused him.
-One of the most legendary speeches ever. Spoilers:
Spoiler (click to show/hide)
-Sometimes you get really cute moments where someone proposes a really good idea. Like one lad proposed using inflatable bladders to cross the Euphrates and they all nod, doing feasibility and agreeing it could work. Then someone points out the Persians would just wait for half the army to cross and then attack, and they'd be in great danger, so they moot the idea. But I like that the Greeks are always coming with out of the box solutions, coming up with pragmatic testing of those solutions, and they're always willing to listen to literally anyone in their army because the hierarchy is very loose and even the top commander and basic soldier is just an equal amongst equals.
-The diversity of the Greeks' specialties and personalities makes their 10,000 strong army incredibly tenacious, resourceful and adaptive. No matter what problem they come up against, they always have the perspectives of soldiers, criminals, merchants, philosophers, thinkers, rulers, diplomats and tradesmen pooling all their brains together to come up with the most straightforward/cunning/decisive/fair ways to deal with a problem.
Spoiler: more spoilers (click to show/hide)
Post by: Starver on September 19, 2023, 03:49:48 am
34% deteriorated, 29% improved and 37% neither. If anything, it's strange that so many didn't (self-report, note you) any significant change. Most people have changes all the time, outwith anything so specific. It almost couldn't be more like everyone just flipping a three-sided coin (just 44 times!). How is this newsworthy (prior to peer review, of the 're-review'), but I can see it being seized upon by those who need some 'proof' of something or other.
I just want to get in there first and express my doubt that it fulfils any particular agenda. (If anything, maybe "is fairly neutral" gets a look in, but you don't really get extreme status-quoists, in this sort of debate.)
Post by: Rolan7 on September 19, 2023, 07:44:06 am
To their credit they do admit this, halfway down:
Quote
The study is small - just 44 young people. And because of the way the original study was designed - without a control group - experts can't infer cause and effect or say these changes in wellbeing were caused by being on puberty blockers.Gee, I wonder why they didn't use a control group. Could they not find trans children without PB in the UK?? (this is a joke, the NHS lets most trans kids and adults suffer in absurdly long waiting lists).
PB are not supposed to improve mood over time, they are supposed to prevent irreparable harm to trans bodies. They're better than the alternative (literal body horror), so they deliberately didn't study that. Instead they discovered that trans kids growing up in TERF Island tend to stay unhappy, wait, actually become unhappier! Wow!! so glad they dug up 12-year-old data for this.
Reminder that PB have been used on cis kids since the 1980's, yet here the BBC is quick to call them "controversial". They're only covering the discourse, right? (and lending credence to it)
Anyway, here's a 2017 study of 104 non-binary youths:
https://jamanetwork.com/journals/jamanetworkopen/fullarticle/2789423
Spoiler: For size, and it's data about thoughts of self-harm (click to show/hide)
Okay I'm actually a little overcome with emotion right now, sorry.
PB have been used since the 1980's and they don't magically become dangerous when "off-label". This "reanalysis" is a fascinating bit of political science, but PB literally save lives and improve outcomes, and they're safe.
(they also don't sterilize anyone in these doses, in case we still have to say that. You can overdose on vitamin A, dosage is important. PB don't cancel puberty, they pause it and wear off naturally.)
Post by: voliol on September 19, 2023, 09:54:25 am
Luckily this conspiratory muck has been blasted in pretty much every (https://www.aftonbladet.se/kultur/a/kEOry6/elina-pahnke-om-svt-serien-transkriget) other (https://www.svd.se/a/dw2xdO/louise-frisen-risk-att-annu-farre-far-konsbekraftande-behandling) major (https://www.dn.se/kultur/isobel-hadley-kamptz-svt-sander-propagandaprogram-mot-konskorrigerande-vard/) Swedish (https://www.etc.se/kommentar/transkriget-aer-ett-medieetiskt-haveri) news outlet (https://www.expressen.se/kultur/film--tv/transkriget-ar-en-orgie-i-skrackpropaganda/), and has been reported to the regulatory broadcasting agency over 100 times in the first week (https://www.expressen.se/noje/kritikstormen-mot-svt-serien-transkriget-/). Though like it's still up there on their website, and who knows how many people have seen it who won't see the criticism and now have a back asswards position on trans people and their right to healthcare, backed by an "impartial and objective" source (that's what they've been reported for, they legally have to be). It sucks.
Post by: TD1 on September 20, 2023, 11:41:36 am
Quote from: (googletranslated)
Trans care has become one of the most debated issues of our time. Where one side believes that care saves lives, others believe that it dissolves the boundaries between the sexes and risks causing lifelong damage. The trans care of children has come into focus as the number of diagnoses of gender dysphoria has increased exponentially and the country's clinics have more enrolled children than ever. On what grounds is trans care conducted today - and what if those responsible are wrong?
Hmmm, it sounds like they're engaging with the debate rather than taking a side in it. But my Swedish is non-existent, so I'll never know from watching it, hah.
Post by: Rolan7 on September 20, 2023, 11:58:23 am
Quote from: Engaging with the debate without taking a side
Vaccines have become one of the most debated issues of our time. Where one side believes that they save lives, others believe that they weaken the immune system and risk causing lifelong damage. The vaccination of children has come into focus as the number of diagnoses of COVID-19 has increased exponentially and the country's clinics have more enrolled children than ever. On what grounds are vaccines administered today - and what if those responsible are wrong?
Post by: TD1 on September 20, 2023, 12:08:52 pm
I'd actually be interested in watching an episode on that.
Post by: voliol on September 20, 2023, 12:46:25 pm
I'm not really interested in going through the arguments here, but if you're interested translating the linked articles above should give some insight.
Post by: TD1 on September 20, 2023, 12:49:40 pm
Post by: zhijinghaofromchina on September 23, 2023, 08:50:48 am
Is that true , do there exsit such a sharp gender struggle?
Post by: Starver on September 23, 2023, 06:06:37 pm
That's not a gender struggle. It is a rather confused joke about the struggles of gender-recognition, maybe.
But there'll both be someone to be upset by the joke and others who'll use it against others. If only for the main jibe against the 'redneck', apparently smart enough to get out of the initial situation yet dumb enough to get into it already. (If you don't mind me dissecting the frog. It's not a particularly funny/sophisticated joke, so not sure keeping it 'alive' is a priority.)
Post by: Maximum Spin on September 24, 2023, 01:01:59 am
I am not intended to offend everyone here , but today I read a post here in China ,it is a joke , one red neck was bocked in a fence , he shouted for help but failed , then he shouted there are only two genders in the word ! He was heaped , but then he got a big fight!In some places, but mostly no.
Is that true , do there exsit such a sharp gender struggle?
Post by: Caz on September 24, 2023, 06:53:32 am
Post by: zhijinghaofromchina on September 24, 2023, 08:51:41 am
(bocked==blocked, i.e. "stuck"? heaped==helped? ...if you don't mind me presuming what has been double-translated.)Sorry for my carelessness in typing English , these days I am trying to use my new English typing app , that might make me have some mistakes ....
Post by: voliol on September 25, 2023, 04:18:01 am
Tayyip Erdogan of Turkiye recently got triggered by U.N. decor (https://en.wikipedia.org/wiki/Sustainable_Development_Goals#/media/File:Sustainable_Development_Goals_logo.svg) because it reminds him of LGBT rainbow symbolism.
The man must be fuming everytime the rain clears up a sunny day
Post by: Caz on September 25, 2023, 09:40:30 am
Tayyip Erdogan of Turkiye recently got triggered by U.N. decor (https://en.wikipedia.org/wiki/Sustainable_Development_Goals#/media/File:Sustainable_Development_Goals_logo.svg) because it reminds him of LGBT rainbow symbolism.
The man must be fuming everytime the rain clears up a sunny day
There's literally Christians super angry about the LGBT flag because "rainbows were given to them by god" :D
Post by: Strongpoint on September 25, 2023, 10:16:53 am
Tayyip Erdogan of Turkiye recently got triggered by U.N. decor (https://en.wikipedia.org/wiki/Sustainable_Development_Goals#/media/File:Sustainable_Development_Goals_logo.svg) because it reminds him of LGBT rainbow symbolism.
The man must be fuming everytime the rain clears up a sunny day
There's literally Christians super angry about the LGBT flag because "rainbows were given to them by god" :D
As a reminder of a genocide! Christians love genocides
Post by: TD1 on September 25, 2023, 11:20:24 am
But they do get a buzz off relationships with extranatural beings, that is true. In that way the rainbow is God's.... wedding ring?
Post by: Grim Portent on September 25, 2023, 12:32:11 pm
Welllll, that's demonstrably false.
But they do get a buzz off relationships with extranatural beings, that is true. In that way the rainbow is God's.... wedding ring?
More analogous to an abusive spouse giving their partner gifts after they get out of the hospital imo.
'I'm sorry I killed 99.99% of you, I promise not to do it again.' Except for the part about being sorry of course.
Post by: MaxTheFox on September 26, 2023, 04:01:40 am
Post by: Starver on September 26, 2023, 07:17:20 am
But that just ends up meaning that they see passable immitations everywhere!
Post by: bloop_bleep on September 27, 2023, 02:05:37 pm
Post by: Loud Whispers on September 28, 2023, 05:36:23 am
The rainbow flag adoption was a god-tier move in retrospect. It's symbolic, original, and commonplace.Haha god tier is apt
It also has the side effect of creating magical barriers to police horses (https://youtu.be/Aj6gsKOiYBU?feature=shared)
Post by: Great Order on October 03, 2023, 12:08:15 pm
So what's the Tory government to do about it?
They're gonna segregate trans people into their own rooms, of course!
Post by: scriver on October 04, 2023, 03:48:02 am
Post by: Starver on October 04, 2023, 06:02:31 am
(Like that other thing, elsewhere, saying that 'being a woman or gay isn't reason to be given assylum', when in some circumstances it probably very much is, in others it may only be a factor to be added into the equation. But the message clearly intended to indicate slamming the door closed, on behalf of those who would be happy just to brick all the doorways up and be done with it.)
Spoiler: {Feetnete} (click to show/hide)
Post by: Caz on October 04, 2023, 06:44:14 am
Post by: Starver on October 04, 2023, 08:10:25 am
There certainly is an expectation of these not being mixed-gender (before complicating that in working with trans-gender needs, etc), though apparently not being guaranteed.
(And I don't think I've seen one (other than A&E, which is technically singular cubicles so long as it doesn't overflow into corridors) which hasn't arranged for a male/female split in different areas. Whether that be orthopedics, dementia or wherever else a spare bed has been obtained for the one who requires it. Even as a child (the longest stay in hospital that I ever had, and probably the largest 'open plan' occupancy I've experienced), it was one room (out of several) only of boys, and I must assume that there were girls' rooms elsewhere, with whom I can't remember mixing even in any additional common social area.)
News article on what is being talked about (https://www.bbc.co.uk/news/health-66994133) (which says 'wards', so...)
Post by: martinuzz on October 04, 2023, 01:20:15 pm
Jesus! Those horses are bloody colour nazis!The rainbow flag adoption was a god-tier move in retrospect. It's symbolic, original, and commonplace.Haha god tier is apt
It also has the side effect of creating magical barriers to police horses (https://youtu.be/Aj6gsKOiYBU?feature=shared)
Post by: Maximum Spin on October 04, 2023, 10:35:53 pm
I mean multi-bed dormitory(/recuperation)-room.I can say from experience that those are definitely not sex-segregated here in my part of America, so it would be surprising to me if they bothered to do it in the UK. Are you sure this is commonplace?
Post by: Grim Portent on October 05, 2023, 04:26:00 am
Hospital wards here generally have a number of 4 person dormitories branching off a hallway. I have never seen one that puts mixed genders in the same dormitory.
Post by: Starver on October 05, 2023, 06:03:37 am
The fuss 'over here' looks to me as having been not able to make it inviolably absolute (i.e. necessity putting an occasional spanner in the works, hospital facilities not being funded enough to be the ideal buffet[1]), thus having occasional breaches while shuffling is organised. And every few years there seems to be 'questions' about why it isn't 100% (at least for England/Wales, I think Scotland's ok and dunno currently about NI).
Which is the basis for whether there is or isn't a problem with/for trans individuals. If it was all omnisex wards then it'd be barely an issue, in comparison. Being separate, it therefor concerns people a lot more (both ways, according to opinion and (perceived) scenario).
[1] "If there's not too much, there isn't enough". By funding (perhaps) to cover the average resource needs over time there's always going to be blips that exceed that, which then adds backlog over the 'average times' and even eat into the dips in demand, and probably ends up costing more in the long run by not having sometimes conspicuously copious unused capacity. But very little effort has been put into sufficiently adding capacity. If, indeed, recent governments have even fulfilled the theoretical average...
Post by: Loud Whispers on October 06, 2023, 03:32:27 am
The UK's NHS is in a crisis, with strikes, crumbling infrastructure, insufficient funding, insufficient training, excessive wait times...I thought the punchline was going to be "privatise it"
So what's the Tory government to do about it?
They're gonna segregate trans people into their own rooms, of course!
Jesus! Those horses are bloody colour nazis!They're hardcore Stuart restoration monarchists (https://www.youtube.com/watch?v=NDp0cX8QtwA)
Post by: TD1 on October 06, 2023, 11:23:24 am
Fun times.
Post by: Maximum Spin on October 06, 2023, 11:27:03 am
Post by: Caz on October 06, 2023, 11:36:52 am
Might not have used the right term? I mean multi-bed dormitory(/recuperation)-room. And not whole specialist units/departments, if that's what you're thinking.
There certainly is an expectation of these not being mixed-gender (before complicating that in working with trans-gender needs, etc), though apparently not being guaranteed.
(And I don't think I've seen one (other than A&E, which is technically singular cubicles so long as it doesn't overflow into corridors) which hasn't arranged for a male/female split in different areas. Whether that be orthopedics, dementia or wherever else a spare bed has been obtained for the one who requires it. Even as a child (the longest stay in hospital that I ever had, and probably the largest 'open plan' occupancy I've experienced), it was one room (out of several) only of boys, and I must assume that there were girls' rooms elsewhere, with whom I can't remember mixing even in any additional common social area.)
News article on what is being talked about (https://www.bbc.co.uk/news/health-66994133) (which says 'wards', so...)
Weird, I've been in hospitals a lot and I've always seen both men and women in the 4-beds. Never even occurred to me that they'd be one gender only.
Post by: TD1 on October 06, 2023, 11:44:04 am
...well, are you going to have a second one?No. Though it was nice that he bought the popcorn and drinks.
Post by: Magmacube_tr on October 06, 2023, 12:28:40 pm
...well, are you going to have a second one?No. Though it was nice that he bought the popcorn and drinks.
Haha lol.
Post by: Starver on October 06, 2023, 01:27:16 pm
Weird, I've been in hospitals a lot [...]Thankfully, not so much for me[1], so I had definitely been hoping some of the actual NHS(ish) forum-members (that I think are occasionally hovering around this parish) would pipe up and be authoritatively "Yeah, we like have to shuffle someone into the 'wrong' ward every now and again, still, but policy is that..." or something. Not that gender-specific (sub)wards are the issue here, save that it creates the situation of what you can/should do once you get into nonbinary territory, and invoke these further inevitably controversial decisions.
Can't speak at all for anywhere at all outside of (mainland) Britain... Nearly went to hospital on the Isle Of Man, but that's another story. (And increasingly irrelevent. I'll shut up now. About this, anyway.)
[1] Apart from various random A&E/non-bed visits, personally one stay "with my nose", one for my appendix (I wasn't even born in a hospital). Visiting, a few more times as family members/other associates have been in-patients for a wide variety of medical reasons of greater or lesser seriousness. But
Post by: Great Order on October 25, 2023, 10:18:28 pm
Post by: Calech on October 26, 2023, 12:17:34 pm
Weird question, anyone know any cheap thigh-high trans flag sock manufacturers that sell to the UK? I'm planning on taking a joke stereotypical-as-possible-trans-woman picture. Outside of that, I don't plan to wear them so I don't give a damn if they're so cheap they'll fall apart after one wear.
As a UK-based trans woman who is quite fond of appropriately-themed clothing (even if I don't necessarily wear it all that often, as I'm not really socially transitioned yet), the first place I thought to look was Etsy - a search for 'trans flag socks' shows a couple of options, although I suspect only one is about the right length. I should probably note that I don't have any of these myself and so this is not necessarily an endorsement, but could be a good place to start.
Post by: alway on October 27, 2023, 05:03:23 pm
Post by: voliol on October 28, 2023, 06:46:03 am
Post by: Frumple on October 28, 2023, 07:17:56 am
Which I guess isn't... completely insane, exactly? 15-20 bucks for a pair of socks is enough to give me sticker shock, personally, but it's objectively a meal or two at a restaurant or whatever, one non-discounted mid-line priced video game, etc. It's like a third or fourth the price of actual high-end online-available ones that go between like 45-70 USD.
But I'm definitely remembering lyrics from Thrift Shop looking at it, heh.
Post by: Rolan7 on November 16, 2023, 10:48:47 am
I've been playing with more femme looks but this feels more me, so yay! It's fun to experiment. I am keeping she/they though (both are fine but I feel like an NB woman rather than a femme NB, now).
I guess I'm also butch xD Which is no surprise when I always dreamed of being a heroine/lady knight. I just gotta beat this pneumonia so I can get back to working out. It's a constant struggle to build strength under E, but I'm still in better shape because I care about myself enough to do the work.
(7.5 weeks sober too- that's been getting easier. Usually. Certainly not going to drink during Awareness week.)
Spoiler: Hi :D (click to show/hide)
Post by: Great Order on November 16, 2023, 11:21:21 am
Post by: Rolan7 on November 20, 2023, 09:33:23 am
Said to be more gay than trans but I consider it both. I am very good at media literacy: I can read trans gender in ANYTHING :D /j
Post by: Magmacube_tr on November 23, 2023, 11:02:28 am
Post by: Great Order on November 23, 2023, 01:24:44 pm
The gender euphoria looking in the mirror with something that brought in my lower rib/upper belly was like being slapped in the face.
I need to lose weight still, my belly's got a very male appearance to it, but it's still nice overall.
Post by: Egan_BW on November 23, 2023, 01:27:23 pm
Did you guys see any cute boys recently?I don't really go outside much, so no.
Post by: MaxTheFox on November 23, 2023, 07:54:49 pm
Cute Russian mixed-media short film about the Frog Prince (https://www.youtube.com/watch?v=Xme3tNS4rno)There's a Soviet cartoon called "The Blue Puppy" (https://www.youtube.com/watch?v=Ni-ZnoJ2IvY). It's... lowkey infamous these days in the Russian internet for reasons I'll now explain lol
Said to be more gay than trans but I consider it both. I am very good at media literacy: I can read trans gender in ANYTHING :D /j
First of all, the word for blue used it "голубой", which means a more cyan kind of blue... but is also slang for a gay man. Okay that's not funny by itself as it's a common word.
Then you get to the plot. He's bullied for his fur color. Then the Evil Pirate and Cunning Cat, both with masculine vibes, capture him. But then he is rescued by a Kind Sailor... who has a very effeminate design and has a penchant for flowers (yes). The pirate is defeated and the puppy is accepted by everyone.
Since this is from the 1976 USSR, and based on an older poem, and predates the slang term becoming popular, I think this is just a weird coincidence but wow.
Post by: martinuzz on November 30, 2023, 05:29:00 am
With the new law, Russia will view being part of a lgbtq+ community as being a member of an extremist organisation, punishable by many years in prison. Activists fear that forced conversion will also become common.
Post by: MaxTheFox on November 30, 2023, 06:52:11 am
So for the love of God don't tell me and KT to leave ASAP again like the last time this happened. I refuse to leave until I finish what I started.
Post by: scriver on November 30, 2023, 11:53:20 am
Post by: None on November 30, 2023, 12:37:28 pm
I was asking a store associate for the directions to the bathroom since I had a container of fruit spontaneously deconstruct itself in the reusable bag I was shopping with and it needed to be cleaned out. They led me there, then asked which bathroom I preferred (they're locked), the mens' or womens'. I said mens' is fine and thanks for asking, and they were all 'of course! I mean you're clearly gay, so it was worth asking.' The associate looked very nonbinary and had a pride pin in their cap. I agreed that I was definitely some kind of queer (I was shopping with my partner, with whom I'm in a cisgender heterosexual relationship) and was just generally touched about how nice the whole situation was.
I'm very queer-coded, it seems!
We refer to ourselves as partners to destigmatize the use and challenge the queer connotations, since we do present as a cisgender heterosexual couple, but it's a little funny in that we mostly reverse gender roles in the household. She's had coworkers assume that her partner (me) is a woman in conversations she's had with them with how the term 'partner' is used, which is a little fun between us again because of how we invert roles at home.
We also had a nice conversation about gender identity while driving around- she remarked about how queer/gender identity kind of pervades a person's entire sense of self, with which I somewhat disagreed since I don't think much about my gender at all and it broadly has little bearing on my sense of self if we decouple the self from the body, and how we have terms like 'genderfluid' or 'nonbinary' to describe that, and how some people either find liberation in having a term to associate to the feeling or chafed/boxed in by needing to apply a label to that feeling. I think I generally settle for 'cisgenderqueer' as a blanket term for myself.
Post by: Great Order on December 13, 2023, 10:25:45 pm
Post by: Magmacube_tr on January 25, 2024, 01:03:09 pm
I don't know what it is with me. It feels incomplete. I feel like I am missing something, some crucial component that makes it all click. Everyone else seems to have it all figured out. But not me.
You guys are all old, you would know. Did this happened to you as well?
Post by: Maximum Spin on January 25, 2024, 03:07:25 pm
You know how catterpillars melt down to reform into butterflies? If an LGBT person's sexuality is like that, I think mine came out all wrong. It is like this half-baked, ungainly abomination sprawled on the floor that sometimes has screaming fits of agony.Uh, no, that does not sound normal. That sounds like you might be clinically depressed.
I don't know what it is with me. It feels incomplete. I feel like I am missing something, some crucial component that makes it all click. Everyone else seems to have it all figured out. But not me.
You guys are all old, you would know. Did this happened to you as well?
Post by: Great Order on January 25, 2024, 03:47:58 pm
You know how catterpillars melt down to reform into butterflies? If an LGBT person's sexuality is like that, I think mine came out all wrong. It is like this half-baked, ungainly abomination sprawled on the floor that sometimes has screaming fits of agony.Sort of, but I think it's internalised homophobia (I grew up in a not-very-forwards part of a country whose kids use(d? Been a while since I was in school) "gay" and "bender" as insults, so it's not too surprising). It could be anything really.
I don't know what it is with me. It feels incomplete. I feel like I am missing something, some crucial component that makes it all click. Everyone else seems to have it all figured out. But not me.
You guys are all old, you would know. Did this happened to you as well?
Post by: Maximum Spin on January 25, 2024, 04:24:50 pm
You know how catterpillars melt down to reform into butterflies? If an LGBT person's sexuality is like that,I think this whole premise, in fact, is guaranteed to lead you into misery.
There are no butterflies. There are no metamorphoses. And God helps us, "an LGBT person's sexuality" isn't "like" anything. Being gay or bi is exactly the same as being straight, but with different genitals.
What you've said in your post sounds exactly like what I've heard from many straight autistic kids who have the same feeling; it isn't about being one thing or another, it's about depression and how it can make people see only failure and decay. There's no secret you need to look for - you already are what you're "meant to be". What you are is what you're going to be.
Post by: Starver on January 25, 2024, 05:53:06 pm
Quote
Arthur Dent : You know, this explains a lot. Because all my life, I've had this unaccountable feeling in my bones that something sinister was happening in the universe and that no one would tell me what it was.
Slartibartfast : Oh, no. That's just perfectly normal paranoia. Everyone in the universe has that.
i.e. that everyone's got some form of paranoia/self-doubt/feeling-of-wrongness. What that incarnates as in any given individual just depends upon the particular hooks available to hang it upon (love, sex, money, politics, art, whatever). Which makes it no less important to pay attention to, for all that, but should not be made your be-all-and-end-all. Draw the benefits from that clear side of your personality, let it guide your wishes and aspirations, but don't allow it to submege yourself.
Maybe easier said than done, but perhaps some wider perspective/distraction can help, and work on the general combined life-aim of "better you, happier you, more honest you" from another angle which might improve the perspective.
(Insofar as my 'wisdom' is any use, as far from the model lifestyle guru as I might be.)
Post by: Magmacube_tr on January 25, 2024, 07:35:53 pm
Uh, no, that does not sound normal. That sounds like you might be clinically depressed.
Is it that obvious? I suppose I should've figured it would be, for you guys anyways. Yes, yes, I am pretty depressed. Clinically, even. I am very mentally ill actually, in all sorts of exotic, queer ways. I lowkey should be institutionalised. Or at least observed. I wish I was joking.
Before you say it, no, I absolutely cannot seek help. Mental health care here is nigh-useless. It is all either conservative muslim woman hoping score heaven points by preaching about Islam, or old hags who use papers from 1960's and classify homosexuality as a mental illness. Not to mention the waiting times. It is not an option. Turkey is not a place that values mental health. Geography is fate.
I do not feel inadequate towards the greater society as a whole. I frankly do not care about the worthless opinions of their obviously false god and con artist, pedophile prophet. I've always found it very easy to completely disregard cultural norms, too. I do not have internalised homophobia. I am sure of that.
My feelings of inadequacy come from within. I can only describe it as a hunch. An overwhelming, dysphoric feeling. It isn't paranoia. It is not a distant, unsure "what-if". It is an alarm. An alarm that says "Something's not right. Something's missing." I don't know what, but it is just that.
Maybe this means I am nuts. Runs in the family, no big deal. Or maybe my subconscious is obsessing over nothing again, perceiving things where there are none. I might even be hyperfixated on a previously miniscule feeling in my attempts to understand it, and accidentally made it larger because feelings are fractal and all that.
I am rambling now. I'll probably be marginally better come spring.
Post by: Loud Whispers on January 26, 2024, 08:46:12 am
Spoiler (click to show/hide)
Post by: Grim Portent on January 26, 2024, 09:13:36 am
Is it that obvious? I suppose I should've figured it would be, for you guys anyways. Yes, yes, I am pretty depressed. Clinically, even. I am very mentally ill actually, in all sorts of exotic, queer ways. I lowkey should be institutionalised. Or at least observed. I wish I was joking.
Before you say it, no, I absolutely cannot seek help. Mental health care here is nigh-useless. It is all either conservative muslim woman hoping score heaven points by preaching about Islam, or old hags who use papers from 1960's and classify homosexuality as a mental illness. Not to mention the waiting times. It is not an option. Turkey is not a place that values mental health. Geography is fate.
I do not feel inadequate towards the greater society as a whole. I frankly do not care about the worthless opinions of their obviously false god and con artist, pedophile prophet. I've always found it very easy to completely disregard cultural norms, too. I do not have internalised homophobia. I am sure of that.
My feelings of inadequacy come from within. I can only describe it as a hunch. An overwhelming, dysphoric feeling. It isn't paranoia. It is not a distant, unsure "what-if". It is an alarm. An alarm that says "Something's not right. Something's missing." I don't know what, but it is just that.
Maybe this means I am nuts. Runs in the family, no big deal. Or maybe my subconscious is obsessing over nothing again, perceiving things where there are none. I might even be hyperfixated on a previously miniscule feeling in my attempts to understand it, and accidentally made it larger because feelings are fractal and all that.
I am rambling now. I'll probably be marginally better come spring.
Might be worth trying to find an online counsellor. There's a quite a few organisations that cater to LGBTQ youths with mental health concerns, and they aren't going to have the cultural hangups common in Turkey.
Do you have a group of friends that you spend time with? Proper friends I mean, with common interests and open mindsets. I struggled a lot with my mental health in my teens and the start of my twenties because I didn't fit in well with my peers, and that didn't really get better until I went to University and had a lot more people my age with shared interests to hang out with. While a lot of my struggles were unrelated to my sexuality, or rather my sexuality played only a minor part in them, having more friends helped me with feeling comfortable in myself in general, including my attraction to men and prompted me to confront my longstanding depression.
Post by: Magmacube_tr on January 26, 2024, 02:03:29 pm
Might be worth trying to find an online counsellor. There's a quite a few organisations that cater to LGBTQ youths with mental health concerns, and they aren't going to have the cultural hangups common in Turkey.
I dunno... Seems sketchy. But again, most things seem like that to me, so... Maybe it could be worth a shot.
Do you have a group of friends that you spend time with? Proper friends I mean, with common interests and open mindsets. I struggled a lot with my mental health in my teens and the start of my twenties because I didn't fit in well with my peers, and that didn't really get better until I went to University and had a lot more people my age with shared interests to hang out with. While a lot of my struggles were unrelated to my sexuality, or rather my sexuality played only a minor part in them, having more friends helped me with feeling comfortable in myself in general, including my attraction to men and prompted me to confront my longstanding depression.
no
No, I dont. And I can't. Navigating neurotypical social norms is like walking on a minefield at night. They are especially unforgiving in this culture. The only way to win, is not to play.
Post by: Vector on February 18, 2024, 08:10:34 pm
- zero gel
- "one" gel [standard nonbinary transmasc dose]
- "one and a half" gel
- "two" gel [standard trans male dose]
Anyway it turns out that on "one" gel I eat and on the other amounts I don't, so I'm practicing acceptance of sloooooow change and leaning in for the long haul.
Among other things I unfortunately learned after accessing medical treatment, I'm genderfluid and rotate between various genders, preferred sexual interests, and expressions. I say "unfortunately" because I still mostly go by "they" but I suddenly unlocked both my inner scruffy masc butch and my inner high femme (and everything in-between) :P
I was worried I was gonna need a whole lot of surgery but after one month my chest is receding enough that I can get away with skipping the binder on some days, I'm pretty committed to and settled into at least the hormonal part of the transition, AND I can usually redirect my brain to think about things other than gender dysphoria when that flares up. We'll see what happens next but I feel pretty good about not making any further moves for the next two or three years.
You'd think a game about pawns becoming queens would be more accepting.
Also, this is a great quote.
Post by: Great Order on February 19, 2024, 04:07:19 pm
Post by: StrawBarrel on February 22, 2024, 02:01:39 am
Post by: Magmacube_tr on March 05, 2024, 02:54:33 pm
Post by: MaxTheFox on March 05, 2024, 10:01:06 pm
I think I am homosexual/biromantic.
Post by: EuchreJack on March 05, 2024, 10:26:15 pm
I call myself bi but I was thinking about it and I can't recall feeling any particular sexual attraction to a man ever.If you self-identify as "male" at times and as "female" at times, and are always attracted to women, then the identify of "bi" makes sense to me.
I think I am homosexual/biromantic.
Just a random thought from the peanut gallery...
Post by: MaxTheFox on March 06, 2024, 12:13:09 am
But I suppose then it'd make sense yes.
Post by: StrawBarrel on March 27, 2024, 07:39:23 pm
https://apnews.com/article/thailand-marriage-same-sex-equality-law-9a2f9da6b5b36a1cf70dee5caec70e23
Quote from: apnews
The bill amends the Civil and Commercial Code to change the words “men and women” and “husband and wife” to “individuals” and “marriage partners.” It would open up access to full legal, financial and medical rights for LGBTQ+ couples.I think it's very good to see this legislation happen in Thailand.
Post by: EuchreJack on March 29, 2024, 04:43:22 am
Lawmakers in Thailand overwhelmingly approve a bill to legalize same-sex marriageGreat law.
https://apnews.com/article/thailand-marriage-same-sex-equality-law-9a2f9da6b5b36a1cf70dee5caec70e23Quote from: apnewsThe bill amends the Civil and Commercial Code to change the words “men and women” and “husband and wife” to “individuals” and “marriage partners.” It would open up access to full legal, financial and medical rights for LGBTQ+ couples.I think it's very good to see this legislation happen in Thailand.
But we'll see if the next Military Junta keeps it, or overturns it.
It is still a sign of progress, as what happened before can more easily happen again.
Post by: StrawBarrel on March 31, 2024, 02:44:44 am
Post by: EuchreJack on March 31, 2024, 02:53:59 am
I predict this year's theme to be bunnies, since it is Easter.
Post by: Great Order on March 31, 2024, 07:11:45 am
Post by: Rolan7 on March 31, 2024, 11:14:49 am
It's also the second anniversary of my HRT consultation. I'm feeling pretty good, mostly :)
Looked at video logs from that day... I still have some face dysphoria, but I feel a lot better seeing the improvement. My face is fundamentally SO much easier to look at now.
My plan's to put in an extra effort on appearance and head downtown for a bit. I'll put my progress flag in my window too, like for Pride month. Maybe... I won't take it down this time?
For something spicier... I had an altercation with a Tate flunky in a voice chat.
Spoiler (click to show/hide)
Post by: TD1 on March 31, 2024, 04:05:01 pm
Today's theme seems to be, rather hilariously, right-wing chuds getting upset that Easter's been stolen from them.
Eh, I'm not right wing but I'd get peeved seeing 'Easter eggs' get replaced by 'Gesture eggs' too ahaha.
Post by: Starver on March 31, 2024, 04:38:15 pm
And associating a rabbit of indeterminate gender that lays multicoloured eggs (with sacharine shells) with trans issues..? It trivialises the latter, but doesn't seem any more ridiculous than any other else out there...
Spoiler: According to one random website I checked, today is... (click to show/hide)
...we're gonna need a bigger calendar!
Post by: Iris on April 18, 2024, 06:42:36 pm
Post by: MaxTheFox on April 18, 2024, 06:45:13 pm
Post by: Great Order on April 19, 2024, 07:44:40 am
Years of being fat and ashamed of my body gave me that as a natural response to moobs. Except I don't have moobs.
My hair's also returning, the minoxidil/low testosterone/both/Jesus-blessing-me-with-hair seems to be slowly working, the super fine and blonde hair on top of my head's darkened and the bald patch is slowly filling in from the sides. With luck I'll be able to grow my hair out by the end of summer with a barely-noticeable bald spot. I'll need to get bangs though, widow's peaks run through both sides of the family.
Post by: Truean on April 20, 2024, 08:54:35 am
The straight married author's book isn't about "whatever gay" things. It's banned here and basically in (much of) the state....
https://imgur.com/t/unicorn/wuJqcBM (https://imgur.com/t/unicorn/wuJqcBM)
I'm exhausted; one of the reasons I hide.... Article from 2022 (because video on news); there are many more.
Against book bans. Want a book banned? You need at least a B+ book report citing it. Problem solved.
Please do not quote me
Post by: Rolan7 on May 02, 2024, 06:48:17 pm
In fact I got the strangest sense of deja vu from the experience. I had to honestly ask my mother whether I had piercings when I was young, somehow (my memory of being a teen is VERY spotty sometimes). I guess I'm either remembering clip-ons which I left on too long, and/or a friend in high school who talked in detail about hers. I was so fascinated...
I didn't realize until afterwards that the studs have to stay in for several months (the piercer thought I was joking, heh) but that's okay. I like these. I have a pair of pink triangular ones as a... statement, but I'm mostly excited to wear a pair of fairies lounging in crescent moons. They remind me of my NB pendant (https://imgur.com/vmn7jGg).
The piercer complimented my pendant :) After the piercing, even, so it wasn't just a distraction thing (I'm so cynical). It was nice. I was in my favorite tank top, too. I look pretty great.
People were nasty to me yesterday but that doesn't matter anymore. Most people don't care or are nice. I'm not alone. I'm fine :)
I might still be a little dazed from all the hot sun and endorphins, but just, I feel really good. My ears feel so RIGHT, like they've been pierced since childhood and reality has just finally caught up.
(not that I'm poking them. I wanna but I'm not)
Post by: hector13 on May 02, 2024, 09:23:00 pm
I remember sitting in class picking at what I thought was a scab on the back of my ear and then pulling out a piece of metal :o
I still have a teeny wee scar for my troubles.
Post by: Frumple on May 03, 2024, 05:36:42 pm
One of these days I'll both find wherever I squirreled those things away and actually go through with it, heh.
Post by: Egan_BW on May 03, 2024, 06:09:58 pm
Post by: EuchreJack on May 03, 2024, 09:19:45 pm
I've... wanted to get it done for a while, but only if I could get a tiny pair of bone dice (several decades to over a century old, they've been in the family for a long while) turned into a pair of earrings (probably wrapped in copper or brass or bronze wire... whatever's in that general color direction but still easy on the ears), which never really fell through.It would be an interesting funeral request, if all else fails.
One of these days I'll both find wherever I squirreled those things away and actually go through with it, heh.
Post by: Iris on May 04, 2024, 07:35:49 pm
I've... wanted to get it done for a while, but only if I could get a tiny pair of bone dice (several decades to over a century old, they've been in the family for a long while) turned into a pair of earrings (probably wrapped in copper or brass or bronze wire... whatever's in that general color direction but still easy on the ears), which never really fell through.
One of these days I'll both find wherever I squirreled those things away and actually go through with it, heh.
That would be super cool to see, honestly.
In other news: I'm still a crumpled ball of confused dysphoria, but that's not new, so :-\ . Glad to see other people in this thread are dealing with it well, at least.