Eyyy I'm LW I shirk from labels because I think they draw people towards enforcing rigid divisions between genders and sex rather than bring people together, but if I had to say, I'd say I'm a speed-strength-kinaesthetic-spatial main because it's like being a Dex build without being a filthy Dex build. GOD HATES DEX that is all even though dex build is the meta build. We have to show STR builds love otherwise they will lose their pride and become really small.
Cis-male Pansexual here, though more attracted to cis-men/trans-men on the whole.
Don't tend to keep too much of an eye on the politics side of things, but I'm fortunate enough to live in one of the most pro-LGBTQ places on the planet.
I'm keeping an eye on the politics because, being trans, I'm basically the West's political football at this moment in time. I'm having to sit around and see how the media's depicting me (Because joy of joys, some people think I'm a woman-hating rapist simply for existing) and what the political situation around me is, especially with an increasingly right wing Tory government.
Gay kaaba is a thing now. Look it up.
You know, my honest opinion about this is...Spoiler (click to show/hide)
Eyyy I'm LW I shirk from labels because I think they draw people towards enforcing rigid divisions between genders and sex rather than bring people together, but if I had to say, I'd say I'm a speed-strength-kinaesthetic-spatial main because it's like being a Dex build without being a filthy Dex build. GOD HATES DEX that is all even though dex build is the meta build. We have to show STR builds love otherwise they will lose their pride and become really small.Sure, that's how I've lived for... most of my life. As unlabeled as possible. Always different, always defining myself by what I wasn't. Indie music, neutral fashion, politically centrist.
Meetups are like, the one time a month you get to talk to normal people instead of cis people.
That's called being a human. Sometimes you feel funny and then spring a leak. The where determines whether that's crying, urination, or a stomach bug.Meetups are like, the one time a month you get to talk to normal people instead of cis people.
but i cri
I have to wonder if being on Tumblr and Bay 12 Forums both, and now especially this thread, will make my intuition of how common trans people are really estranged from the statistics of humanity as a whole. Like, I think I know most of the people I meet in real life aren't trans, but the internet places I frequent has my mind going "oh, it has to be at least a fifth of the population, everywhere, right?". Hoping this observation doesn't come off as weird.
As for another thought on LGBTQIA+ issues, I feel it's important to try to accept people even when you're not able to understand them.
I've heard that neurodivergent people are more likely than average to be LGBTQ+
Eyyy I'm LW I shirk from labels because I think they draw people towards enforcing rigid divisions between genders and sex rather than bring people together, but if I had to say, I'd say I'm a speed-strength-kinaesthetic-spatial main because it's like being a Dex build without being a filthy Dex build. GOD HATES DEX that is all even though dex build is the meta build. We have to show STR builds love otherwise they will lose their pride and become really small.
As this history shows, multiculturalism in Western countries was seen to combat racism, to protect minority communities of all types, and to undo policies that had prevented minorities from having full access to the opportunities for freedom and equality promised by the liberalism that has been the hallmark of Western societies since the Age of Enlightenment. The contact hypothesis in sociology is a well-documented phenomenon in which cooperative interactions with those from a different group than one's own reduce prejudice and inter-group hostility.Contact with different people will reduce division and increase togetherness.
Oh, on another note one of my trans friends said she found that every "ally" she had ever met eventually came out as queer. This friendship is rapidly deteriorating but I think some people do believe this statement to be true. I'm like 85% sure that it's false. If everyone who is homophobic is gay and everyone who is an ally is gay you end up with everyone is gay, which is a nonsensical idea.There's also a slight issue in that it would mean, at a minimum, 50% of my friends and acquaintances. are queer in some way or another.
I think labels are fine. Creating classifications is a normal thing to do. We classify different dogs into bull dogs, golden retrievers, chihuahuas, beagles, and so on. It's an objective fact that there is diversity within sexuality, gender, and sex. We ought to be able to classify masculinity, femininity, androgyny; endosex (I had to look this one up), intersex; binary, non-binary; cis, trans. Less labels would limit our language.You'll have to forgive me, but my perspective is vastly different. I've never been limited in language when it comes to describing anything, but these labels have limited me. As a rule I cannot talk about sex or gender or whatever IRL because it always devolves into people trying to pin me down into roles Idgaf about and I've had it up to my neck with people talking about where I'm from or where I'm really from or gushing over my "mixed blood" or "hybrid" like I'm a fucking beagle or labrador. Leave the classifications to the taxonomists and let the infinite vaguaries of human existence be not confined to a finite vocabulary only a select educated few stand a possible chance of innately recognising. Headaches upon headaches ;-;
I also do not believe that different gender and sex identities will create more division. It should make society stronger.I'm not feeling the contact hypothesis loveQuote from: https://en.wikipedia.org/wiki/Multiculturalism#SupportAs this history shows, multiculturalism in Western countries was seen to combat racism, to protect minority communities of all types, and to undo policies that had prevented minorities from having full access to the opportunities for freedom and equality promised by the liberalism that has been the hallmark of Western societies since the Age of Enlightenment. The contact hypothesis in sociology is a well-documented phenomenon in which cooperative interactions with those from a different group than one's own reduce prejudice and inter-group hostility.Contact with different people will reduce division and increase togetherness.
To be fair I'm reasonably certain I'm trans these days and even I don't understand The Trans Condition.The trans experience? Because that has more implication of condition as the human condition, rather than condition as like medical condition
Ninja edit: Perhaps "condition" isn't the right word? More like... the zeitgeist? I meant "the emotional response to the state of being trans" but "condition", uh, does not have the best implications in this context.
I'd like to have you know that there is an ever increasing amount of anti-LGBTQ+ protests throught the world, and their sentiments are getting more and more violent.ngl, wargame it out in your head based on what is plausible, rather than based on worst-case imagined scenarios only useful for spawning more anxiety and apathy. Have contingency plans and build the capabilities and relationships you need to follow them through. In the US, at the federal level, this means working out and accounting for how Obergefell, Lawrence, and Griswold being overturned could affect you in the next 5 years. At the state level, it means modifying this accounting for how these interact with state level politics to make places that are more safe and less safe; as well as at the local level. On the personal level: do you have the folks around you that you need to keep you safe in the environment you live in? How likely is it that you're actually personally exposed to these things? When it comes down to it, you won't be able to count on any cops to have your back, ever. Make sure you have people who do.
If this goes on...
Yes, that's what I meant. The trans experience.It's all right, as long as you keep communicating and you have good intent, you can always build a better relationship with others after you all come to a mutual understanding over why you accidentally offended the other and that it was an accident. A lot of magnanimity goes a long way for both sides ;D
I am terrible with words when talking about these things and it has offended people in the past, which is why I don't really like talking about them.
I suppose I may as well just ask. I know that references were made to cishet people not "Truly Getting It", and I wonder, what is "It" in this instance? It doesn't square with what I know about human nature - namely that people are individuals and no two are the same. This seems to imply there is one Trans Experience, that you either understand or don't understand, but talking to other people beforehand about this issue has brought me to the conclusion that it is a highly personal journey. I don't quite understand what was meant by this. Is it that there are common threads between all trans journies, or...?In the words of Nujabes 'you either get it or you don't though, the choice is yours!'
I've been wondering that myself, as recently I've been thinking I actually fall into one of those. Not sure if I'm fully committed to identifying as either though. Anyway consider this speaking as an outsider.Yeah, this. I call myself bi because I like females more. Guys are hot too but not as much.
Frankly it depends on who you asked and what day it is. Part if it seems like bi has a lot of baggage/stereotypes people don't want to deal with, part of it is gender got more complicated and "binary" doesn't entirely make sense anymore.
I've heard pan basically disreguards gender entirely when it comes to potential relationships, whereas a bi person might favor masculine over feminine (or vice-versa). So I'm leaning to bi since I prefer feminine people. Although I know of a youtuber with similar preferences that identifies as pan so ¯\_(ツ)_/¯also bi has a better flag
Quote deleted, just in caseI'm a white male (sexuality is always assumed to be whatever people want to see, but it is heterosexual), so I rarely get fired due to initial or long-standing bias.
I'm a white male (sexuality is always assumed to be whatever people want to see, but it is heterosexual), so I rarely get fired due to initial or long-standing bias.Yeah life's too short to worry much too much about people who don't communicate their emotions honestly. I get tired of dealing with people who are all smiles 24/7 then they complain to me that a mutual friend's been driving them up the wall for years over a problem they could've fixed with 1 convo. Oh btw don't direct quote Vec as they like keeping a low digital footprint for safety's sakes
But I still get fired by folks. And I still wish I could be someone else. And I've been able to win over people that weren't initially thrilled with me. And I've had folks get pissed at me, then manage to "fix it". And I've gotten fired by folks that I had thought were quite happy with me. Sometimes, it's just them. Mostly, it's their loss. Usually, I'm happy to be rid of them.
I have a sexuality. Will report back if I discover I have a gender as well.Tempting to revive the "shit let's be xyz thread" to have a gender polling
I have a sexuality.
I have a sexuality.
hey, me too
It occurs to me that I have, for the most part, just been assuming I like women. But looking at the pattern of my crushes, that's probably not actually the case. Homoflexible? Pan with a strong female preference? God only knows.I put myself as bi with a heavy preference towards women after over two decades of thinking I was straight.
I detest even thinking about the sports issue, since it's almost entirely an artificial front the right to scaremonger.
I did enjoy this bit of satire, though, which points out how ridiculous the "issue" is: https://www.mcsweeneys.net/articles/guys-i-swear-im-only-transitioning-so-i-can-cheat-at-girls-sports
Kinda just nice, too.
And finally, I'm angry about all of this because it sounds like the bar for success is that an exceptional transgender woman must never appear, and perhaps worse, that an exceptional cisgender woman must never appear. Anyone who ever approaches a male level of excellence and breaks all barriers must have been cheating, and when she appears, the rules of the game must change to eliminate her from the field.
I just don't know how to fairly square "wasn't exceptional identifying as male but is exceptional identifying as female" so that cis women don't end up having their performance metrics skewed.
Because even though it is a strawman, what do we do when someone arbitrarily says they now identify as female? Who gets to make that decision on whether it's valid or not? What if a really swole dude who grinded out years in the gym really does one day decide they identify as female and they won't do HRT? Is their transition less valid? Is it still fair to the gender they now identify as? Does every sporting organization and body get to have their own standard of reasonableness? ("Must "live" as the gender they identify with.")
The same way you square "sucked as an ice skater but turned out to be really good at long jump" or any other such change of sporting targets. We wouldn't be having this conversation about trans women in gymnastics and ice skating, by the way.
There are cisgender women who produce too much testosterone by IOC standards, without intervention, all by themselves.
I'd point to the fact that male gymnasts are fuckin' ripped by and large. So how high you can fling yourself off the bars is part strength, and part power/weight ratio. I guess I can see a trans woman in gymnastics skewing things depending on what we're talking about.
It's wild knowing that you're programmed to be both a boy and a girl, and it's just a matter of a single hormone that determines which set of genes is active.
Oh yeah, loads of animals do sequential hermaphroditism. Although I have to say my favourite thing is aquatic flatworms. They're just full hermaphrodites, so they do penis fencing and whoever gets impregnated first becomes the mother and the father swims off.
On the idea of making a healthy male/female clone/offspring with just your own DNA, technically possible, biologically unwise. That said parthenogenetic reproduction works for some animals, and that's the same idea.It's unwise long-term because of diseases exploiting any flaws you have in your immune system. There could be some recessive diseases that'd crop up due to the way meiosis works* if you're a carrier, but if not you'd be fine in the short run.
"Unless you're built like Vegeta"
JOCKEYS RISE UP (https://www.youtube.com/watch?v=NVt6EvaUN6A)
Let me just get THAT right out of my Youtube history.....You mean these? My adsense recommends? My super-duper personalised marketing profile? You mean my ultra-specific demographic-oriented native content deployment stream? You mean my economy-driving shareholder arousing generic family-friendly commercialistic ultra plus oneTM targeted content relevising AI optimising course of personal history-perverting terms of conditions ignoring permissions?
You mean these? My adsense recommends? My super-duper personalised marketing profile? You mean my ultra-specific demographic-oriented native content deployment stream? You mean my economy-driving shareholder arousing generic family-friendly commercialistic ultra plus oneTM targeted content relevising AI optimising course of personal history-perverting terms of conditions ignoring permissions?
QuoteYou mean these? My adsense recommends? My super-duper personalised marketing profile? You mean my ultra-specific demographic-oriented native content deployment stream? You mean my economy-driving shareholder arousing generic family-friendly commercialistic ultra plus oneTM targeted content relevising AI optimising course of personal history-perverting terms of conditions ignoring permissions?
Yeah, that.
At worst, it's a means of accruing new labels and definitions which, through performance and conscious adherence, serve to cloud the self.
dressing like a vampire every day.
; the consequences of the French revolution upon gendered fashion for example have been a disaster to the human race
Yeah I'm also realizing a large number of people who were here five or ten years back turned out trans, so that's cool
Because trans people exist :v and the only thing that changed is either others knowing or the lessening of oppression to actually acknowledge that via others' personhood.Yeah I'm also realizing a large number of people who were here five or ten years back turned out trans, so that's cool
Yeah, people of transing their genders is a common theme here in Bay12. I wonder why?
https://nypost.com/2022/10/22/north-carolina-school-district-votes-to-forfeit-games-against-rival-after-transgender-athlete-injures-player/It's assimilation culture and the weird thing is it's a proactive driven thing very obvious in the US; they've been running these since years ago to saturate and push beliefs as distractions or conclusions to take up that mental load.
Despite my earlier position, I think this one is pretty much horseshit. Like a afab woman has never given a concussion to another afab woman who took a solid spike to the face. There's also the usual muttering about the trans athlete making other women in the locker room feel uncomfortable.
Ohh, tell me moreThroughout human history fashion has been incredibly expressive regardless of how many genders a civilisation had or whatever garments, textiles, colours or outlines were associated with whatever gender roles. Throw a dart at a global map and look into traditional clothes of the peoples who lived there, and chances are you'll find an expressive mix of cuts, materials and colours. Doesn't even really matter what time period or wherever you are; the vividness of humanity is reflected in thread and dye.
Yeah I'm also realizing a large number of people who were here five or ten years back turned out trans, so that's coolPeople unconsciously form communities with people and environments they feel safe and welcome in.
Ohh, tell me moreThat's why I think the end-goal for "gender is a social construct" is not transgender presenting as a radical act, but unfucking the social construct until there is no transgression, and however you present yourself gender-wise becomes an ordinary occurrence, not a revolutionary one. I am also optimistic, in that if fashion can change so rapidly once before, then it can also change rapidly once again. This would also be a change that benefits everyone, since everyone can appreciate more choices, even choices they have no intention of using
*Snip*
What I'd love, absolutely love to do, would be to start wearing goth platform boots. I love boots, I love 'em so much, but I have nowhere near the self confidence to overcome my anxiety and go full goth in public. I'd love to wear a skirt, and tights, and a crop top and- fuck it, a corset too, corsets are cool. But, the idea also terrifies me. Anxiety's a bitch. I guess it just makes me sad that it's socially acceptable for Women to wear Men's clothing but, yeah, the "acceptable" spectrum of Men's clothing starts at plain shirts and ends at shirts with band logos printed on them, with anything outside that spectrum being "alt".I do recommend acting on that; exploring presentation is terrifying, but quite satisfying. Learning to overcome that fear/anxiety of going against the grain of society is something I find quite beneficial in other areas of life as well, and it really is a skill that gets built up over time.
... With all that being said, I will admit to having contemplated the possibility of me being trans on more than one occasion, though I don't think it to be the case... probably.
What I'd love, absolutely love to do, would be to start wearing goth platform boots. I love boots, I love 'em so much, but I have nowhere near the self confidence to overcome my anxiety and go full goth in public. I'd love to wear a skirt, and tights, and a crop top and- fuck it, a corset too, corsets are cool. But, the idea also terrifies me. Anxiety's a bitch. I guess it just makes me sad that it's socially acceptable for Women to wear Men's clothing but, yeah, the "acceptable" spectrum of Men's clothing starts at plain shirts and ends at shirts with band logos printed on them, with anything outside that spectrum being "alt".
... With all that being said, I will admit to having contemplated the possibility of me being trans on more than one occasion, though I don't think it to be the case... probably.
Clothing has no gender and it's what people give and bring onto something that adds meaning or value. Go explore! The labels that apply are those you choose. Them stuff with yourself is trying things out, and it's better anyway the more you know because the conclusions come by you first. c:
I have no doubt that the French Revolution, and a general rebellion against nobility/aristocracy in Europe, was tributary to fashion changes. But I doubt that the French Revolution was the source.To bring up my earlier example, which is strikingly relevant here, it's rather like some of the Chinese couples I saw in Beijing wandering around in traditional Hanfu clothes. Which is to say that there exists the people and the subculture who do dress in the traditional clothes, but the effect of Western fashions has made it such that the traditional clothes are no longer a living, normal cultural construct which evolves with the times - but is instead a static thing which exists in contrast, in its own sphere where the fact of wearing it is treated as a rebellious act, and not an ordinary act. Dandies would not have been dandies just 1750s, but in the 1790s the fact that they doubled down on traditional fashion and wore lace and breeches in direct opposition to the without-breeches (https://en.wikipedia.org/wiki/Sans-culottes) fashion is what I mean. French rev merked fashion
Look at Oscar Wilde, for instance. Dandies were condemned for snobbery and effeminate clothing, but nevertheless there was still a cultural construct capable of maintaining their lifestyle more than a decade after the French revolution.
The French revolution, which targeted the trappings of a particular way of life, came at the same time as the Industrial Revolution. Things, including clothes, were made en masse - and capitalists love shaving pennies off the cost of production. Goodbye lace, embroidery, decoration. These were all time consuming, produced by hand and expensive.I'll have to agree with you, since the perspective you advocate is full of such wisdom and sagacity as to be without counter-argument. The only exception perhaps is that industrialisation actually increased the demand for luxurious fashion. One of the fondest things I ever studied at University was the history of the rise of conspicuous consumers in London - which arguably featured the first community of non-aristocratic but wealthy wastrels whose sole vocation was to be seen spending money. Moroccan leather, Chinese silk damascs, Italian lace and Indian wool & cotton were all in incredibly high demand by conspicuous consumers - one amazing dress in the London history museum made 400 years ago was made for a lady by Chinese tailors using measurements made to order and shipped to the UK, taking 2 years to arrive. The importation of so many foreign textiles upended the English wool industry which had hitherto been the backbone of English industry & taxation since the time of the Normans (I exaggerate, but it was a major source of income and tax revenues for people and King), and a lot of the peoples involved in the wool trade were inevitably threatened by changing tastes of fashion. In one amusing incident, a very well-off lady was wandering around in her fine Chinese silks, when two wool spinners picked her up and nailed her dress to a post in protest! However the ire of the wool tradesmen soon died down when they began embracing changes in industrial looming that allowed English workers to make more money working Egyptian cotton or Indian calico than they would sticking to the wool trade. I doubt the industrial revolution would necessarily have a negative or positive effect on fashion diversity, as there are industrial nations known for experimenting with fashion just as there are known for not. But what is key is that in the following centuries Western fashion was marketed as the clothes of civilisation, progress, normality, and the world has never shaken those ideas since
Another significant revolution was spiritual. The Reformation, begun in the early sixteenth century, established criticism of ornamentation and boisterous colour. This extended beyond criticism of ornate Catholic cathedrals and into critique of individual dress. Good works defined man, and the rich man could not make it through the gates of heaven. Sobriety and charity were not indicated by boisterous clothing.
The paintings of the Dutch Republic show spiritual men in sombre black.
The third revolution, and I'd argue the most significant, was in travel. Globalism established a mono-culture dominated by colonising powers such as the American and European nations. Mass-production of drab factory clothing would not have mattered were it restricted to a single nation, but it wasn't. Cheap clothing dominated the global market, undercutting clothiers everywhere.Globalism and imperialism decided that there would be one standardised fashion across the world, but it wasn't a guaranteed fact that the fashion would be so boring.
Stop encouraging me, youse're gonna make me do something I won't regret :PThat goth scene got me acting unwise
I don't think I've ever gone in for a trans-only internet space myself though, I just tend to end up in a lot of spaces that happen to have a lot of us.It's interesting how that keeps happening (this community for example, as has been noted). I know of two theories I agree with:
3) There are some really awful hot takes. I still get a bit pissed off about the person who told me that I *need* to be an out-and-proud trans person or else I'm basically betraying everyone else.
[GEORGE enters apartment, sits down. JERRY is in midst of making coffee](also my liver is in great shape, which is both absurd but also maybe a sign that I've been doing better... I give HRT a lot of credit for that)
GEORGE: I got my blood test results back today.
JERRY: Oh?
GEORGE: Well first of all they got my name wrong. Again.
[JERRY makes a disappointed noise]
GEORGE: Anyway, the results said my E was very low and my T was off the charts.
GEORGE (deadpan): 10x the T levels of the average woman.
JERRY (confused): I thought that was the-
GEORGE (shouting): YES, JERRY, THAT'S THE POINT!
So, any of you saw cute boys passing by?sadly not
Honestly, our country just had another mass shooting at an LGBTQ night club last night.
sadly not
im gaywould you describe yourself as cute boy y/n
bitch, i'm adorable
hi feral im uwudr uwu I'm CIA
FIFA announced that any players wearing a 'one love' wristband at the World Cup will get a yellow card.Slave labour
They say LGBTI rights activism is a political thing that has no place in sports.
Lick Qatar anus much, that FIFA
FIFA announced that any players wearing a 'one love' wristband at the World Cup will get a yellow card....thus making the wristbands more political.
They say LGBTI rights activism is a political thing that has no place in sports.
hi gay I'm straight*
*sortaSpoiler: Colorado (click to show/hide)
"That sounds," said Scotti, searching for the appropriate word. "Like ... bunk."
"Perhaps it is," shrugged Basth. "But [they have] many rights as the Voice of the People, including the granting of foreign building and trade contracts. It's not important whether you believe us."
Reject binary gender, become tentacle-void.
Reject binary gender, become tentacle-void.
Now this is something I can get behind!
Less than a week until my endo appointment.
Given this, I'm pretty sure I've got a solid idea on what to expect from anti-androgens and hormones, but does anyone have any advice or anything that they think I might have missed? Just want to be prepared for it.
your chest area is gonna hurt like a son of a bitch. like an itchy kind of hurt. that's normal, it's growing pains.
Know of TBAS, my intent is to be a pain in the arse if it afflicts me.Less than a week until my endo appointment.
Given this, I'm pretty sure I've got a solid idea on what to expect from anti-androgens and hormones, but does anyone have any advice or anything that they think I might have missed? Just want to be prepared for it.
Depending on your location expect either great or terrible experiences going forward with healthcare. Probably already expected. Have you ever heard of trans broken arm syndrome (https://www.usatoday.com/story/life/health-wellness/2021/07/27/trans-broken-arm-syndrome-what-it-how-combat-discrimination-health-care/8042475002/)?
Depending on the anti-androgen you take (I'm thinking of spironolactone), you will begin to pee all the goddam time and it's so freaking annoying, especially when combined with general public restroom anxiety.
You will begin to study the mirror religiously while you await physical changes, and grow impatient while it appears that nothing is happening. Then suddenly it will feel like everything is changing all at once and it gets very exciting! And then years down the line you'll look at yourself now and at yourself when you thought you were experiencing a bunch of good changes and think "holy crap I thought that was great but I look so different now!"
Basically, what I'm saying is you will be impatient and it sucks, but it takes a lot of time for hormones to really kick in.
your chest area is gonna hurt like a son of a bitch. like an itchy kind of hurt. that's normal, it's growing pains.Yeah, I gathered that's one of the more sucky bits. And pets somehow always manage to do stuff like jump on your chest when you're lying down.
As an AMAB individual, Transmasc people give me gender envy. Not sure what to do with this information.
I'm not gonna lie. I... keep low-key wishing I was Transmasc.My recommendation: explore those feelings and the specific parts of them. Ask yourself why you feel gender envy, and what specific parts of it you find desirable for yourself. Is it having masculinity that was personally crafted, rather than enforced upon them? Because that's something you can explore and redefine for yourself. Is it the feeling of freedom to explore variations on gender expression/presentation? Here's someone coming to an answer that takes that to heart, basically "cis people dont need to pass": https://mobile.twitter.com/JoCat105/status/1551414701384507394
...
I'm AMAB.
...
Dunno if I've mentioned this on this thread before or not, but, uhm. Yeah. As an AMAB individual, Transmasc people give me gender envy. Not sure what to do with this information.
I'm cleared to start HRT, hopefully I'll be getting on with it by next week.Grats!
I've heard about it from other trans people. It's up in the air if that's actual changes, or a result of people being more comfortable in their bodies/overcoming internalised homophobia because you're no longer your AGAB.
I'm excited for the journey ahead of you! I'm not sure which is correct to say I'm happy you're on your way towards the best, truest, or actual form of yourself, but it makes me warm to know the barriers towards, well, you, are parting. I see it was an exciting and enabling time for Rolan, how are you feeling about it? Anxious, eager, affirming?Excited and anxious, I guess. For me those two are the same emotion, but with a positive or negative slant respectively, so it's hardly surprising that it's happening.
Sorry, I guess I don't really need an answer to say I'm happy for you!
Landed me my first bigot. Someone on Reddit DMed me saying that I'm mentally ill and no matter what I'll be a man and etc. etc.I find this inappropriately hilarious.
Mission failed, it was weirdly validating and I'm now feeling really happy that my existence upsets bigots.
Landed me my first bigot. Someone on Reddit DMed me saying that I'm mentally ill and no matter what I'll be a man and etc. etc.I find this inappropriately hilarious.
Mission failed, it was weirdly validating and I'm now feeling really happy that my existence upsets bigots.
Oh no, I'm a trans woman. The weirdly validating bit was that it feels like I've "made it" as a trans individual.
Landed me my first bigot. Someone on Reddit DMed me saying that I'm mentally ill and no matter what I'll be a man and etc. etc.You managed to upset an asshole by just existing congrats.
Mission failed, it was weirdly validating and I'm now feeling really happy that my existence upsets bigots.
Because wow there's some bits of that culture that make things so harsh that assimilation and its own culture is pretty much unseen in it. GLAD THAT GOT PARTIALLY RECOGNIZED in the WPATH Standards of Care 8 (which FINALLY has people's voices from the community compared to the rubbish 2012 version), and it's still lacking to put it lightly, but obviously very much improved.
This version of the Standards of Care is the first to be developed using an evidence-based approach.
Dad's wife poked me in the boob while complimenting my shirt. I didn't visibly react, processed it later. It's fine, it's fine. It was just unexpected. She's known me for a long time and that I don't like being touched. But I think it's probably that thing where women are more touchy with each other. That's probably it! A friend agrees, that was probably it.
I refuse to "become" a woman via HRT, that's stupid anime BS. The true me is something I found through intense meditation and, primarily, dreams. I may be genderfluid, but I don't think I'm binary. I refuse to let hormones change me. They only let me unlock my true potential. I love my body, and I guide my body. It mustn't guide me.
It's been my observation we're all broken people just trying to function as best as we're able.
"Need" is a strong word. But who doesn't enjoy a chair with wheels?It's been my observation we're all broken people just trying to function as best as we're able.
Guess everyone slightly needs a wheelchair as well?
Question for people:Oh, yeah, that can be pretty common. Everything that bothers you which your brain previously was suppressing as something impossible which couldn't be dealt with is now back to the realm of things you can do something about and thus much more at the forefront.Spoiler: A bit NSFW (click to show/hide)
First off: this thread has excellent gender, this'll go nicely in my entropy pool. Gendernoise here.Power to all those who use it/its and more c:
Meant to ask this ages and ages ago, but Tiruin, has your avatar always had the trans pride flag in it, or did I just fail to notice it until after I found out what the trans pride flag looked like?I love you noticing this, and no! I edited it in subtly just this year (or was it last year?)
Being into fitness, I can't overlook the biological differences in muscle mass and bone density living as a man for your entire teenage and most of your adult life has versus someone who was born biologically female. That muscle doesn't simple disappear overnight, the bone mass doesn't return to any level because as far as the body is concerned, you developed with male levels of hormones and that's what it should be. If someone has trained their whole life as a man, the differences magnify. If they trained their whole life as a man and used Performance Enhancing Drugs, the advantage magnifies even more.
A life-long male in their early 30s who is untrained will, statistically, be stronger in most metrics that matter to professional sports than an untrained woman of the same age. So if they transition to female with no hormone therapy, then they will by the numbers have strength and performance above the female standard. It's why we even have gender separated sports in the first place.
Throughout most of the last Century, the folks that watch, and more importantly, the folks that FUND, Sport have traditionally had ZERO interest in Female Athletes, so they were banned from playing with the Men.
Interestingly, one of the sports that also shows no difference is extreme long distance running, which is probably because after a certain point being stronger or fitter doesn't really mean much because any advantages they give you collapse in the face of 1000 miles of running. Instead, it's all about psychological resilience.
hello thread! i'm a transfem who just barely made it out of the Deep South thanks to some pals across the country. :')
i haven't already celebrated that with enough people so i'm posting here!
i've almost finalized all the moving related junk you run into in the US, including getting on the state's medicaid (and then i'll be setting up with an LGBTQ-positive nonprofit clinic)
transitioning even "just" socially has felt pretty rewarding on its own, i think i'm ok seeing myself as kinda butch? but i feel much freer to experiment and find what i'm comfortable with now that i'm in a safer and more left-leaning area of the country.
My very naive fundamental question: if being a woman isn't related to bearing children, and being a man isn't related to siring children, just what is gender anyway?
A child is taught these social constructs of "man" and "woman" and, for very complicated reasons we don't yet understand, tends towards one (usually) VERY early in development. That is a positive reaction to a cultural category. For example, choosing combat-figures over domestic dolls. Notably this response is limited by the options offered- options which are a result of culture, usually a gender binary.I'm always curious about statements like these.
Of course many people aren't ever offered this choice. They are given toys according to their sex, perhaps scolded for going after the wrong toys. But given enough freedom we see some kids express preferences that go against our expectations. This is consistent with my theory. The gender they're gravitating too is probably not a *perfect* fit, but gender never is - it's a choice between the options offered by culture.
I don't remember my life before school very well, but I think it was similar in some ways? We lived remotely and my parents were pretty egalitarian about stuff. For some of the time my dad was home more than my mom, early computer job, despite us being in the middle of some woods.Yeah, I mean, it sounds like my case was just stronger. I didn't have things like that. Anchors, I mean. I didn't have media like that, and I didn't have people who were clearly classifiable in those terms at all. Not family, friends, or neighbours. I honestly have lots of reasons to think that the environment I grew up in was particularly weird, though, so it's not much of a surprise to me.
But like, I'd visit my mom's friend's kids. And watch Sesame Street. I hadstrongandrogynous women in my life, but I also had my hyper-feminine aunts and rugged farmer men. Gender was everywhere, enough that even I saw it.
What's the modern take on use of language like "gender assigned at birth" versus simply "gonads observed at birth." Or more generally - is gender so closely tied with gonads and other presentation?1. Terminology like AMAB/AFAB are.... kinda cringe? In that way of someone explaining something badly, but not quite badly enough to call them out on it. They're generally used as stand-ins for several peices of information which may not be true, with a veneer of being polite by not talking directly about what is meant. As mentioned, current stats suggest intersex people outnumber trans people, or are at least a comparable quantity (many are both; intersex and transgender have high odds of occurring together). Birth gender assignment is either based on a very small subset of features, or is coercively applied by doctors deciding to 'fix' the ambiguity and force a child down one of two binary paths of the doctor's choosing. So people are assigned one of two labels, but those features implied by those labels may not actually be present. Of the trans folks I know, it's been like 50/50 odds on whether they even need T blockers because their bodies just don't produce it. If you need to know about biology, don't ask about gender, or even assigned gender, as they are largely orthogonal.
Or is gender orthogonal to primary and secondary sexual characteristics? Or is it sometimes orthogonal and sometimes linked?
Or the ultimate extreme - does gender matter anyway? If so, why? If not, why do we make such a big deal about it? What does "getting gender wrong" actually mean, aside from side effects like in most cultures a history of oppressing the feminine?
My very naive fundamental question: if being a woman isn't related to bearing children, and being a man isn't related to siring children, just what is gender anyway?
-lol I just remembered that Vector doesn't like to be quoted, two hours later, sorry, I always forget that, too used to quoting everything-Hm, I wouldn't have a clue where to point you to in terms of resources, but certainly, my understanding from the people I've spoken to is that they do firmly consider "intersex" to be an identity which does not apply to them. I can't speak for them in terms of whether they consider it to be a gender, though. I agree that it doesn't seem like the same thing to me. I suppose you could also use the word "label", although "identity" is the term I've seen used - it's possible to imagine that someone might not want to be labelled as a diabetic, and, if there were conditions that were in some sense like diabetes but arguably distinct - maybe diabetes insipidus could qualify? - it even makes sense to imagine someone with such a condition arguing about whether it falls under the label. In this case, the point that opens the debate is really that some of the most common DSDs are not even medically regarded as "intersex", at least not consistently, so there's certainly room to argue the label.
What's the modern take on use of language like "gender assigned at birth" versus simply "gonads observed at birth." Or more generally - is gender so closely tied with gonads and other presentation?
Or is gender orthogonal to primary and secondary sexual characteristics? Or is it sometimes orthogonal and sometimes linked?
Or the ultimate extreme - does gender matter anyway? If so, why? If not, why do we make such a big deal about it? What does "getting gender wrong" actually mean, aside from side effects like in most cultures a history of oppressing the feminine?
My very naive fundamental question: if being a woman isn't related to bearing children, and being a man isn't related to siring children, just what is gender anyway?
Re: intersex I don't know that I know any people with DSDs, but statistically I should know someone with late onset adrenal hypoplasia. Don't feel I have much to add, but it's interesting for sure.I know, right? It's interesting that it's so common. I have family members with hyperandrogenism, which might be that, but could also be caused by other conditions.
@Max Spin: *thinking noises*I'm sorry to say - I'm not interpreting this as you making any statement, I'm just using it as a convenient backreference to the conversation - that I can't give you anything more than that. Honestly, I tend to be uncomfortable speaking for other people so I probably wouldn't have brought it up at all normally, but it just happened to twig the memory for me and, already being in a little bit of an overly gregarious mood today, I thought "oh hey, I know something about this!" and felt like it was a good idea to share it, and now I'm a little uneasy about that, so uh... well, that's not your fault, that's just me, but I hope it gives some kind of context. Also, I'd like to add, not to you specifically but just in general, that I also wasn't assuming anyone meant anything harmful by raising DSDs in the first place.
went through the full(?) surgical process to a very passable trans-femaleAs another aside, most trans women don't actually get surgery to any part of them which is visible to society. It's sort of a spontaneously generated mythology built by cis people who don't understand how people can completely change their body's appearance without surgical intervention. 90% of the heavy lifting is just done by hormones: it changes skin, hair, nails, smell, facial structure and the shape of bodies on every level above the skeleton (and even a couple there), causes breast development, and so on. A good number get breast augmentation later, as wider shoulders from testosterone puberty tend to make those appear smaller; a few get FFS to shave a bit of the facial bone structure. Bottom surgery is still less common than not (though around a slim majority do want it at some point; there's a lot of hurdles for that one) But for the most part, it's just presentation and hormones. The transtimelines subreddit shows this off quite nicely if you want concrete examples.
Still trying to wrap my head around it. Mostly about terms like AGAB - because it seems to always been used in a negative connotation, when for many people the letter on their birth certificate matches how they see themselves. So it's "almost always correct" in the statistical sense (high 90s percent)... so it has always struck me as odd the way it seems to be used (and to be fair I've only encountered its use online, so...)
So yeah one of my questions was - "what does it mean if someone gets your gender wrong?" It's less clear than the question of "what does it mean if someone gets your sexuality wrong" because that clearly impacts the practicality of physical relations. I guess if people always assume your gender (appearance/behavior) matches your physical activity preferences, that's where the conflict really arises (even moreso than association with child bearing/siring)?
I just find it humourous that people are afraid to say 'man' and 'woman' now. I say this because I'm currently reading an article which references 'people who own a vagina' and 'people with a penis'That's not fear, it's accuracy. As to why this matters, here's a bit of an anecdote: I know a man who became pregnant; it was unplanned, unintended, but nonetheless something he would have been happy to take to completion and given birth to a child who would have been loved dearly by him and his partner. He found out he was pregnant when he had the miscarriage.
And I'm just like
.... lol?
As another example of this: the case of Robert Eads. He was a trans man diagnosed with ovarian cancer. He went to around 20 different doctors, all of whom refused to treat him; after all, gynecologists treat women, not men! By the time he found a doctor willing to treat his cancer an entire year later, it had already grown and was beyond what could be dealt with. He died 2 years later at age 53.
Actually maybe that post doesn't make any sense and I've been spending too much time on twitter, lemme try again:Truly, Twitter is the bane of legibility.
I've found that anti-trans people seem the most confused and reluctant to use "man" and "woman", instead talking about various physical things like vaginas or chromosomes. They're fine terms. For certain situations like reproductive health though, it's a lot more accurate *and* inclusive to describe demographics who can become pregnant or impregnate.
Even for cis people, gender is so much more than reproductive function!
They really do use phrases like that, reducing "men" and "women" to gametes.
Well, gametes ARE the most convenient way to determine if an organism is male or female.In biology, gametes are how "male" and "female" are defined. From a biological perspective, every human can be classified into one of those two categories with no overlap, based on gametes - even everyone with a DSD, since no human being has ever been found to produce both gametes, and this is almost certainly impossible because the systems that allow their production are in absolute competition. There are, of course, people who produce neither gamete for one reason or another, but it's always possible to trace the developmental pathway backward and determine what "would have been".
Pronouns "Associated With Deoxyribonucleic Acid"hi my pronouns are TACGTCAGCTGACCTACGTCAGCTCAGCACGTAACCAGCTACGACTCTGCTCCAGACATGCT / CGATGCTAGCCGTTATCGATATGAGGCTAAGCAGCGATCTCGGTCCTGTCAAGTATGCA
In biology, gametes are how "male" and "female" are defined.
So from the perspective of the study of biology you can always determine a gametic sex, sure.
I'm GATTACA Binary uwuPronouns "Associated With Deoxyribonucleic Acid"hi my pronouns are TACGTCAGCTGACCTACGTCAGCTCAGCACGTAACCAGCTACGACTCTGCTCCAGACATGCT / CGATGCTAGCCGTTATCGATATGAGGCTAAGCAGCGATCTCGGTCCTGTCAAGTATGCA
(There isn't any easter egg hidden in there I just mashed keys.)
In biology, gametes are how "male" and "female" are defined.
So from the perspective of the study of biology you can always determine a gametic sex, sure.
It is not merely from the perspective of a study of biology, it is the most common meaning of the words woman and man, one used for many thousands of years, it is probably one of the earliest to arise because it was an important concept in everyday life of tribes.
Even before people had any idea about gametes, female was one who can bear children and male was one who provides seed. And woman and man are merely words to refer to adult human male and adult human female.
Therefore, phrases like "men can be pregnant" are absurd and go against the way how a huge majority of people understand the word "man". And yes, I am fully aware that other definitions exist and are in use by a growing. Yes, I understand what someone means when they say "a pregnant man." No, I don't think they are crazy or wicked or whatever. I just don't see any sense in hijacking a word that already has a meaning and infusing it with a quite different meaning while trying to erase the previous meaning.
What the point of replacing a word "man" with "AMAB" (or similar) and not make a separate word for your new broader definition of a man? Why create confusion?
the law has to leave room for thatI mean, do note that one of the ways the law has "left room" for that historically is "non-consensual surgical procedures on children", so sometimes the room made is not exactly kind or comfortable or actually there, it can be less like a room and more like assault inflicted on infants. Sometimes humans look at something breaking their categories and choose violence :-\
Dunno about the other claims, but 9 for menarche isn't (https://pubmed.ncbi.nlm.nih.gov/12509562/) anywhere close (https://www.cdc.gov/nchs/data/nhsr/nhsr146-508.pdf) to "average", though that is about the earliest possible.
Remember that the difference between 9 and 11 is about 20% of their life at that point - hence the "not close" hyperbole.
With my limited understanding of biology I know that when a fetus forms, it's always female first. Then other hormones come in and cause male traits to develop, but the template it's using as a starting point is female biology.This is very much inaccurate. A fetus in fact starts with two sets of tubing, one male and one female, and gonads that are neither. In males, the female tubing (Muellerian ducts) is supposed to disintegrate eventually, and in females the male tubing (Wolffian ducts) is supposed to disintegrate. So in other words, the "template" or "base" isn't one or the other; it's the starting point for both but also not quite fully either (since several parts of either sex still have to grow). In some cases, some parts of the tubing fail to disintegrate fully or other parts fail to grow properly, but this isn't usually considered a DSD and is not usually externally visible (eg, many men have a small remnant of the Muellerian duct attached to the testes, it has some name I don't immediately remember). It doesn't change the gametes the gonads will develop to produce either.
[On claims about age of menarche declining]I don't think these claims were fear-mongering per se, but wild misunderstandings. At least, the ones I remember. Average age of menarche varies between ethnic groups in the US, and the changing ethnic composition WAS bringing down the overall average - but not with any particular group significantly changing. So it was probably a combination of some possible degree of racial apprehension, and just completely misunderstanding what was going on. I guess it depends what you think of as "fear-mongering", but it's not what I would call it.
Either way I'm not really thinking about genital development but brain development, if there's some underlying architectural 'XX' and 'XY' structure of the brain and how it expects the body it's piloting to be and if that could misalign with body development. If we start off as a 'blank' template that is later specialised, doesn't really change that concept...Have you ever read Testosterone Rex? As I understand it, there's considerable ongoing challenge to the idea that male and female brains differ significantly.
Conclusions. The apparent influence of early maturation on adult female overweight is largely a result of the influence of elevated relative weight on early maturation. Interventions to prevent and treat overweight should focus on girls before they begin puberty.
The study I saw on age of puberty (https://pubmed.ncbi.nlm.nih.gov/24190685/), they split it between ethic groups and it was a general trend in the USA amongst all but African Americans that it was starting earlier. It seems to be a global trend too, or at least a western one.Hm, well, okay. I remember reading that changes were nonsignificant after controlling for ethnicity, but I'm not familiar with that study.
Either way I'm not really thinking about genital development but brain development, if there's some underlying architectural 'XX' and 'XY' structure of the brain and how it expects the body it's piloting to be and if that could misalign with body development. If we start off as a 'blank' template that is later specialised, doesn't really change that concept...
tbh I'm more just thinking of a simplified model that could be used as a starting point to help cis people who are in that "I don't really get trans" category and "you don't need to get it, just accept it" doesn't work get their heads around it as a "thing that can happen".
Completely off topic, but strictly speaking is there even such a thing as a consensual surgical procedure on a child? Being a child automatically means informed consent is impossible and so it's always via a proxy such as a parent.
Really only line of debate is determining what's a reasonable thing to enforce on a child compared to what is best left delayed until they are old enough to make an informed decision and give consent. And that will always fluctuate with culture.
I especially dislike the idea of puberty blockers so a child may decide when they reach 18 years. All I can say is WTF?
Becoming an adult is not only living X years, it is also experiencing the hormonal storm and dealing with how it changes your personality.
I especially dislike the idea of puberty blockers so a child may decide when they reach 18 years. All I can say is WTF?
Becoming an adult is not only living X years, it is also experiencing the hormonal storm and dealing with how it changes your personality.
Yeah, okay, if I'm reading you right, this is an exceptionally weird take. To the point that I almost don't want to get involved.
But no, blockers are a humane, common sense, and entirely reversible way to afford trans children agency over their own bodies. Plenty of adults are insensitive to their body's hormones and don't undergo puberty, and they turn out just fine. The absence or presence of hormones and puberty don't magically turn you into a better decision maker. Ridiculous idea, and a worse policy.
(And yes, forcing trans-identified kids to undergo an unwanted puberty is not only unnecessary, but also weird and cruel.)
I'm sure it's part of the reason that cyberpunk settings are so popular with trans people. Either extensive bodymodding or "just" immersive VR (CP2077 Brain Dances). Which reminds me that I still want to get my ears pierced soon :D A friend enthuses about hir piercings a lot (and robotics work) and I love seeing someone assert ownership of hir body like that.
Quick question here.There are other reasons that potential signifiers of transness and homosexuality are concerning: eugenics.
Are we sure we want to start discussing brain development? If we are to acknowledge that the trans brain is different, doesn't that inherently mean that for some tasks, one might prefer a male brain, for others, a female, and for a third, trans? Plus at least another for the opposite trans, and whatever other genders come to the fore.
And if some brains are just better suited for certain tasks, why would it be wrong to discriminate against someone with am objectively less qualified brain? We do that all the time, right? People with test scores below a certain point are not eligible to be doctors or lawyers or engineers or rocket scientists, for example.
Is it really a good idea to stake out the position that it's perfectly reasonable and scientifically accurate to say, "The best person for this job is a man"? Or even, "Statisically, we should hire a man for this job as his brain is more likely the best for this purpose."
Don't we (theoretically) do that anyway?Sure, but we (theoretically) do it through evaluating the person rather than generalize by sex/race/whatever.
There are developmental differences but from my understanding there's no real difference in processing)That's the question. Whatever hypothetically happens in the brain development must have persistent effects, or that would not explain why trans is persistent. Without knowing what the development differences are, how could one say what else might be affected?
Good example, although not neurological, is the military. Men are on average stronger than women, which is a desirable trait in the military.Pain resistance and cooperation are also desirable traits in the military, often moreso than physical strength in a modern army, and women on average have the advantage there.
And if some brains are just better suited for certain tasks, why would it be wrong to discriminate against someone with am objectively less qualified brain?
Is it really a good idea to stake out the position that it's perfectly reasonable and scientifically accurate to say, "The best person for this job is a man"? Or even, "Statisically, we should hire a man for this job as his brain is more likely the best for this purpose."
Point of Order: It was the alleged inferiority of the female brain that was used to deny women the right to vote and the right to own property. So fuck that shit.[very sarcastic voice]
I came out as bi to my mom and she was surprisingly fine with it. :D
Possibly a more practical thing (not for the fleeting desires of society, but its longer term potential) is that if a male soldier dies, his contribution to posterity can be fulfilled equally well by any surviving male soldier at all. And, at least until it becomes a ridiculous amount, can double, triple or even far more his contributions by filling in for as many dead colleagues as are unable to return (or return 'intact') to fulfill their peace-time duties for the stay-at-home women of the nation who would be necessary to ensure that there's a future generation of the nation. And can even do their bit of non-military 'service' on a weekend pass or equivalent home-rotation. (Or, frankly, via any small container, properly handled.)Good example, although not neurological, is the military. Men are on average stronger than women, which is a desirable trait in the military.Pain resistance and cooperation are also desirable traits in the military, often moreso than physical strength in a modern army, and women on average have the advantage there.
I came out as bi to my mom and she was surprisingly fine with it. :D
I came out as bi to my mom and she was surprisingly fine with it. :DEyyyy, nice one.
I came out as bi to my mom and she was surprisingly fine with it. :D
Oh yeah, there's a reason I used theoretically in there. We're just kind of shit at being a meritocratic species.It's not as bad as you make it out to be.
We already have a large group of people who are objectively worse in most professions. - People with disabilities. But no, it doesn't mean that an employer can deny every person with a disability (ignoring their actual skills and abilities) and not be rightfully accused of discrimination.But those are physical disabilities, and legislation was passed requiring businesses to make reasonable accommodation. To the best of my knowledge, that was only applied to a few mental disabilities, and only at the margins. For example, since climbing windmill towers and radio antennae is physically demanding, the business would not have to accommodate quadriplegics. Neither were they required to accommodate those with diagnosed suicidal tendencies, at least current ones.
But those are physical disabilities, and legislation was passed requiring businesses to make reasonable accommodation. To the best of my knowledge, that was only applied to a few mental disabilities, and only at the margins.It is not what I meant. With almost any job, people with certain disabilities will be worse (on average) but no sane employer will go for something like - "you know deaf people are on average worse at doing this job and I don't give an F about your actual skills. Go away.". Doing this will be outright discrimination.
Regardless, should we be be drawing on a precedent that relies on categorizing having a trans brain as being disabled?
But whatever downstream effects there are are not known. You can assert that there are observed differences between cis female and cis male brains without also claiming that women are naturally and permanently worse, or "intended" for particular tasks. The first does not actually provide evidence for the second.The flip side is also true. Since potential downstream effects are not known, there is no rational way to say whether membership in some arbitrary group does not make one better or worse at any given task.
Why the extreme emotional response to discrimination? By choosing to be with Mrs. Thorfinn, I discriminate against all other potential mates, male, female, furry, whatever. I'm dead certain we all do this. I don't know anyone who objects on general principle to people hanging out with people they like. Why in this case?QuoteBut those are physical disabilities, and legislation was passed requiring businesses to make reasonable accommodation. To the best of my knowledge, that was only applied to a few mental disabilities, and only at the margins.It is not what I meant. With almost any job, people with certain disabilities will be worse (on average) but no sane employer will go for something like - "you know deaf people are on average worse at doing this job and I don't give an F about your actual skills. Go away.". Doing this will be outright discrimination.
It is like denying a woman a physical job even if she is far stronger than an average female, meets the requirements, and is no worse or even better than other available candidates.QuoteRegardless, should we be be drawing on a precedent that relies on categorizing having a trans brain as being disabled?
Hey! Don't put words in my mouth. Especially something so... gross. I used disabilities as an example that even if we know that category X is (on average) worse at doing task Y, hiring not on the basis of the merit of an individual is still discrimination.
Why the extreme emotional response to discrimination? By choosing to be with Mrs. Thorfinn, I discriminate against all other potential mates, male, female, furry, whatever.
[thicker corpus collosum in women]I just want to say that this is heavily disputed (https://pubmed.ncbi.nlm.nih.gov/9353793/) and seems to be based on studies with a very low sample size, with the original analysis having an n of 14 (https://pubmed.ncbi.nlm.nih.gov/7089533/). Results since then have occasionally gone either way, and, while it's true that the largest study I know of (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3767965/) found a difference, their result on the full set of 316 subjects was only significant at an IMO inadequate P<0.03 level. I think it's best to characterize this difference as unclear.
No, I did that. I decided to exclude from the set of prospective Mrs. Thorfinns all people with male genitalia. I also excluded all over the age of 40, all who were already married, etc. During college, I chose to spend most of my time around other science and engineering types. Yes, I discriminated against all those who were matriculating at the cosmetology institute down the street.QuoteWhy the extreme emotional response to discrimination? By choosing to be with Mrs. Thorfinn, I discriminate against all other potential mates, male, female, furry, whatever.
You are using this word in a very loose way.
to discriminate
to treat a person or a particular group of people differently, especially in a worse way from the way in which you treat other people, because of their race, gender, sexuality, etc.:
I apparently count as queer according to some because I'm asexual, so my queer experience is mostly defined by a lack of experience xD Cuddling is fucking awesome though.Ha, I resolved the grandkids issue by spending the last 7 years saying I don't want kids. Not ace in any way, I just value my free time and general freedom to do things. Having a kid pins you down for a minimum of 18 years. On top of that, I've got mental health issues that I don't want to pass on and that'd make me poorly suited to being a parent. You can't just have a depressed mope for a month or two when you're someone's primary carer.
Plus Sister having had a child has shut down the "but I want graaandchiiildddreen" from my mother. So that's nice. Because...no, not happening. Eww. Still get the occassional "but you'd be such a good father" or "maybe you'll meet someone with kids!" but like...I like being an Uncle. You get to give him back. Can't do that with your own kid...
(Well I guess technically you can but... xD)
I'm going to have to come out to my advisor as part of explaining why the likelihood of my getting a job at an R1 university or, frankly, any other university, is practically nil these days, because he's been asking me about my career interests.I don't think you have to say anything if you don't want to say anything.
I don't want to do it, as I kind of expect that this is going to be the beginning of my being gently shoved out the door. But as my mom said, I need to work on my mental health and play the game of life more aggressively. God knows I know how to play hardball. It's practically a condition of being a union organizer. But she told me to play hardball about resting and playing, and let forcing me out of the school be a task for my enemies, not for me.
(My mom's still an asshole by the way, but she spent today talking to me for an hour about me and only me, and this is practically the first time I can remember her ever doing that in the entire time I've been alive and, you know, older than 2.)
--
I briefly identified on the ace spectrum but I'm kind of convinced now that it's less about some kind of built in wiring and more about having a vanishingly small dating pool.
No pun intendedOh no, I made a gaffe!
heyyyy guys it's ya girl Iris here, what'd I miss?Nothing much, except half of the lower boards being eggs apparently
heyyyy guys it's ya girl Iris here, what'd I miss?Nothing much, except half of the lower boards being eggs apparently
I caught myself thinking the words "I wish I was nonbinary"
Like
Brain do you understand the implications of that or are you just gonna remain clueless lol
Oh yeah, the "Hang on, most men don't want to be women?" realisation was interesting.
Wondering about it's a fairly standard thing from my understanding. The general difference is that someone who's trans would very likely press a button that swapped their sex, but someone who's cis would only press it if it was temporary or reversible if they would at all.
EDIT: Also, it looks like JK Rowling has finally abandoned all pretense of her transphobia being to protect women and has fully embraced the "All trans women are paedophile rapists" style of TERFism. I can't say I'm surprised, and in fact I'm more surprised it took this long, but it's definitely no good having the rich author of something important to so many people in my generation be like this.(I have made no bones of stating that her literary work is derivative, and just somehow caught a populist zeitgeist. But this isn't where I go on about that.)
To be honest, the worst part of being trans is that everyone things that the fact you are trans is a Big Fucking Deal and not something entirely out of your control.That partily the reason I am not sure about calling myself trans in a sense, for most of the trans people I know irl being trans at least at some point had a very large impact on their life, for me it's sort of like "I don't feel gender as a particular anything, staying with man just seems kinda convenient at some point"
I have a few friends like this. It's completely fine to not have a preference about gender, and picking one/coming out to everyone is overrated. Just be yourself and do what makes you happy.To be honest, the worst part of being trans is that everyone things that the fact you are trans is a Big Fucking Deal and not something entirely out of your control.That partily the reason I am not sure about calling myself trans in a sense, for most of the trans people I know irl being trans at least at some point had a very large impact on their life, for me it's sort of like "I don't feel gender as a particular anything, staying with man just seems kinda convenient at some point"
Maybe it's because I only come out to lgbt+ people, but idk, I feel like I am not sure about something.
BY THE POWER OF PURCHASING (https://www.youtube.com/watch?v=UBftW7FzOVI)EDIT: Also, it looks like JK Rowling has finally abandoned all pretense of her transphobia being to protect women and has fully embraced the "All trans women are paedophile rapists" style of TERFism. I can't say I'm surprised, and in fact I'm more surprised it took this long, but it's definitely no good having the rich author of something important to so many people in my generation be like this.(I have made no bones of stating that her literary work is derivative, and just somehow caught a populist zeitgeist. But this isn't where I go on about that.)
So the irony here is too much not to comment on.Oh boy I can't wait to consoom
I watched that video then opened facebook. A post from The Royal Mint (sponsored): 'Celebrate 25 years of the publication of Harry Potter and the Philosopher's Stone with a coin featuring the Hogwart's Express!'
Yeah it's kind of incredible slash disturbing how much her media is still all around considering how she is as a person. It's this sort of strange thing where I'm sure most people are not as rampantly transphobic as she is, yet as they turn a blind eye towards it it's hard to deny that they are still transphobic. Or simply do not know.It's just too much of a cash cow for corpos to give a shit. You can see the cynical pivot to make "Harry Potter without Harry Potter" so they can continue to milk the Harry Potter fanbase without having to deal with any extant links with J.K. Rowling (besides paying her fat bags of money every six months)
What kind of answers would you get if you asked the bookstore manager who chose to put her book out front in the Christmas season? Or that other, separate bookstore manager who did the same. Or the employees who went along with it. At some level everyone is doing their job, and at least here (Sweden) I'm sure many people - out of a culture of compulsory goodness - would claim to have no hatred in them. But then a whole group of people are made an affordable loss, consistently. It turns out there's a whole lot of transphobia out there, and it is in the hearts of people, at times subtle, yet festering.
Let's hope, or see to, that that will change. And I'm sorry if my insight was too obvious.
I haven't really kept up to date on Rowling's comments, but... I don't see any discrimination?She's been regularly spewing and boosting TERF shit over on twitter, and publicly palling around with virulent transphobes, just as an easy starting point.
I haven't really kept up to date on Rowling's comments, but... I don't see any discrimination?She's been regularly spewing and boosting TERF shit over on twitter, and publicly palling around with virulent transphobes, just as an easy starting point.
Like, there's problems with her writing on the discrimination front, too, but so far as more recent stuff goes, it's been her public/social media comments that have been not exactly covering her in glory. I've been mostly avoiding exposure 'cause I don't need that shit in my life, but it hasn't been particularly subtle.
Question for yes who have gone the "Grow boobs" side of thing:Both are possible
Me left nipple's aching when I press it in now, but there's no bud as far as I can tell. This normal beginning-of-breast-growth, or have I just gone and prodded it so much it's got sore?
The issue with politics is that you can't live with it but you can't live without it. Ya gotta know what's happening to keep yourself and those close to you safe, but you gotta stay away from it cause in the grand scheme of things there's only so much one person can do about it all. It's true that This Too Shall Pass, but it's very easy to say that when you're not living through a major historical event.Yah even if you care not for politics, politics has a way for caring about you. But also it is true that getting over engrossed in politics can just poison people's mindsets. I tend to strike a middle ground of focusing on the kinds of politics I can actually influence in some way, or at least the kinds of politics that actually has a point (e.g. I don't give a fuck about people debating Prince Harry but will vociferously defend NHS strikers)
Question for yes who have gone the "Grow boobs" side of thing:Sounds like about the normal amount of weirdness to expect, yeah. There's a lot going on there, so expect soreness to just sorta come and go from time to time.
Me left nipple's aching when I press it in now, but there's no bud as far as I can tell. This normal beginning-of-breast-growth, or have I just gone and prodded it so much it's got sore?
Very happy for you, very cool that body does cool things when provided hormones. I'd like to make an "it's plug & play gender" joke, but I fear that might also be a) a woeful oversimplification and b) also crude and insensitive, and I don't personally know any enby/transfolk, so I don't have a good read for the community's sense of humor. Will accept recommendations and/or browbeating.
okay that was not NEARLY as recent as I thought O_oI refuse to "become" a woman via HRT, that's stupid anime BS. The true me is something I found through intense meditation and, primarily, dreams. I may be genderfluid, but I don't think I'm binary. I refuse to let hormones change me. They only let me unlock my true potential. I love my body, and I guide my body. It mustn't guide me.
If it turns out that you're a trans woman who prefers men, it won't make you any less queer. Many people have taken this journey with highly variable results. The outcome can't really be predicted in its concrete details, nor controlled.
If people haven't seen this (https://twitter.com/Azure_Husky/status/1420177933826732034) microfiction yet somehow, it's sweet.This is really something. (I was checking my posts to analyze my journey)
Also what the hell's up with the they/them "controversy?" I swear to God when I grew up we were all taught that you could use they to refer to people, and this was way before gender politics was in the public awareness or on educational syllabi. But then when it did come up, people were saying there's no they/them for people, only he/she. Witnessing this harsh reaction over what had seemed obvious and uncontroversial for ages felt like how I imagine the early-modern Christians felt seeing the rise of creationists taking the OT literally in response to archaeology and natural selectionIt's been approximately 99% bigots being assholes with everyone with sense telling them (to fuck) off, and little to nothing else (about the only exception is with some trans folk who strongly prefer to be called their preferred gender, and that is an even smaller minority of a small minority of the population; the 99% is probably not substantive hyperbole).
Also what the hell's up with the they/them "controversy?" I swear to God when I grew up we were all taught that you could use they to refer to people, and this was way before gender politics was in the public awareness or on educational syllabi. But then when it did come up, people were saying there's no they/them for people, only he/she. Witnessing this harsh reaction over what had seemed obvious and uncontroversial for ages felt like how I imagine the early-modern Christians felt seeing the rise of creationists taking the OT literally in response to archaeology and natural selectionMy favourite thing about "Nooooooo they is exclusively plural!!!!!" is that it's been used as neutral singular since the 13th century at least.
I guess that I'm a they/them now. In real life, not just internet imagination land. Neat huh?
Well, I asked my closest family to please update their usage of pronouns in regard to me, and they said sure.
And I got a little praise which doesn't feel entirely earned, if I'm being honest. It's just a simple thing.
(Yet once you start gravitating towards "xir"-type constructions, you have to acknowledge that you're going beyond a planned ambiguity and are now possibly trying to actively ellicit a reaction amongst the less enlightened/flexible. Or attempting some form of transhumanism. - I don't say you can't, of course. And maybe if the choice is particularly distinctive then perhaps it'll be more memorable, even for me. Yay!)
After over two months of hormones, I think I'm developing boobage.And I can confirm, something hath happened. Got a bud.
Mentioned the whole left nipple being sore, still is (A bit like a bruise in terms of feel), but I'm pretty sure I can feel something a little more solid under it now.
I think I've mentioned Ann Leckie's books, before. Maybe not this thread, but I'm not checking back.In my (basically post-bigotry) setting, they/them is standard. Neopronouns didn't catch on in the wider population. Sure there's ambiguity but it's usually obvious what you mean from the context and that's what matters in language. I think this is the most plausible situation, language is reluctant to that kind of change for better or for worse. And hey that covers everyone, even one of those alien species with 4 biological sexes and 16 "default" genders.
The generallly gender-agnostic SF universe of her Ancilliary novels has the main (focal) civilisation default to "she/her" for everyone. You know it s not an Amazon Civilisation (or parthenogenic, or LevGuinian but off-page, etc) just not a social distinction.
In co-universe book Provenance, the world(s) of a civilisation on fringe of the above Empire go for "e/er" (I think) until the person chooses to qualify either way. Self-selecting, as is their decision to 'come of age', or at least that's how it works with the protagonist and er contemporaries (seemingly without biological presumption), but I'm trying to remember if part of that was class-privilege.
It seems that other societies in the galaxy (further? I'm can't recall how far away the real non-human aliens of the series come from) may have different standards... Probably there's an "Earth vanilla" protocol out there but, without making it the issue of the writing, I think it'd be just mentioned in passing (like how the Ancillary concerned at one point says how she purposely does not wear gloves, to pose as an outsider for tactical reasons), letting the reader just settle into the gender-blindness as much as they do the idea of death-of-personality AI-controlled 'bio-drones'.
Anyway, I say fill your boots. I was just thinking about those who would feel self-righteously afronted. Who I don't think should be pandered to, so let 'em be... ;)
I dislike that Sweden's media has really latched on to our version of "xe/xir", which sees basically no use in the general populace (I'm not even sure they're used in the LGBTQ community, but that just might be that I'm not enough in it) while the neutral pronouns we have, including both the direct cognate of they/them and other possible choices, barely sees any use at all just because they're not "hip" enough.
And while I acknowledge I'm selection biased by being Swedish and limited in my interactions with English, but I'm pretty sure our they/them equivalent was more currently used than the English tongue's was too.
But you know me I get too emotional over language and semantics
[...] since we usually are strict with the singular/plural (unlike English, which does it all the time with "you"),Well, "you" is of course originally the plural, but we rarely use "ye", these days. And the rest. Plus 'tis likely most times usest thou it, thy intention really be þe article, I tells thee!
I'd be more enthusiastic about them if I saw a set I wanted to pronounce rather than ones which break the drivebelt in my brain when my eyes run over them. A nice "they" is a lot more pleasing to my inner voice. Maybe a nice loanword would feel better to me?
I dislike that Sweden's media has really latched on to our version of "xe/xir", which sees basically no use in the general populace (I'm not even sure they're used in the LGBTQ community, but that just might be that I'm not enough in it) while the neutral pronouns we have, including both the direct cognate of they/them and other possible choices, barely sees any use at all just because they're not "hip" enough.
And while I acknowledge I'm selection biased by being Swedish and limited in my interactions with English, but I'm pretty sure our they/them equivalent was more currently used than the English tongue's was too.
But you know me I get too emotional over language and semantics
I haven't heard of the "they/them" equivalent ("de/dem/dom") being used, though admittedly I know few Swedish enbies. It seems odd to me in Swedish since we usually are strict with the singular/plural (unlike English, which does it all the time with "you"), though I suppose it might both a positive and negative that it doesn't conflict with an "singular person, unknown gender" pronoun like "they" does in English (and the "xe/xir" "hen does).
Granted, I view "hen" mostly as a literal construct; really practical to avoid the "han eller hon"-s ("he or she"-s) of formal text, but impractical when spoken.
This is partially because it doesn't mesh well with dialectically omitting half of the "h"-es at the start of the pronouns. If "han" becomes "an", and "hon" "on", then "hen" collides with the "en" I overuse to avoid "man"1. I find it's usually not to difficult to either call the person by name, shuffle around the word order, or use some lazy construction like "männskan" instead.
1"Man/en" is a pronoun pair referring to a general person, used in cases where "one" or "you" would be used in English. "Man" is literally... "man" in English, so avoiding it is a speech quirk found among feminists. It's far from universal but not personal either.
Huh. I thought Swedish was one of those languages where masculine and feminine gender merged into common gender? Although a quick search shows that isn't the case for pronouns, which I guess is egg on my face.
Help me reclaim "man" into the old gender neutral instead! It's usage as a gender neutral pronoun is literally one of the ways the old, gender neutral "man as synonymous with human" still exists in our language (that and the suffix "-man" as a "somebody who does a thing-word"). The feminists are wrong, it is the usage of "man" as masculine and denying women grammatical humanhood which is the patriarchal construct.I kinda dig this in theory? We'd need a male equivalent to woman, of course. Apparently "werman" was not actually a thing, but I don't see why it couldn't be!
Disclaimer: I don't really try to do this in my daily speak because I am self-concious enough as it is and afraid of sounding weird. But you and me together voliol we will be the start of something bigger, I know it!
Apparently "werman" was not actually a thing, but I don't see why it couldn't be!
You know what, I don't know XDApparently "werman" was not actually a thing, but I don't see why it couldn't be!
Wait, it wasn't? But I've built me entire gender grammar philosphy on it D:
That's the thing though, "den/denne" (the singular variant of "de/dem") is already used that way, and completely smoothly so, because "han" och "hon" are genderised variants and developments if "den". Common phrases you would have heard used would be for example the Arthurian "den som drager detta svärd skola bli kung över hela England" ("they who draw this sword shall be crowned king of the whole of England" for the English speaker), or the very common child/play sayings like "den som sa det han va det" ("they who said it he was it" - "I am rubber you are glue") and "den som nämnde't han klämde't" ("they who mentioned it he squeezed it" -- it's our version of "smelt it dealt it"). In the two latter you can see the "den" pronoun slipping over into the gendered pronouns at the end usage. In both cases it could just as easily use the gender neutral at the second line and nothing would change, it runs just as smoothly in full gender neutral mode. I also always think of the tv-serien "Den som dräper" ("They who kills" from... 2000's sometime? You don't have to look far to see a host of it being used like this still around.
2. Likewise, understand that you are not an expert on this subject matter. Most cis people have a lot of learning to do on the basics of gender as applied to living in real life. If something seems weird and bizarre, it is most likely because you're the equivalent of a 3rd grader reading about calculus. You lack the context to make sense of it, rather than the thing itself being absurd and worthy of ridicule.
1. Whether you respect those around you
2. You lack the context to make sense of it, rather than the thing itself being absurd and worthy of ridicule.
3. Otherwise, nobody trusts you enough to not be weird about it if they go into more depth.
Points two and three strike me as.... condescending and gatekeeping, I suppose? Is the onus of proof on the believer, or the sceptic?
It should be "We are children in spiritual matters, and try discussing things that we can't possibly understand."QuotePoints two and three strike me as.... condescending and gatekeeping, I suppose? Is the onus of proof on the believer, or the sceptic?
I heard variations of that calculus analogy so many times from... religious people. "You are a child in spiritual matters and try discussing things you can't possibly understand."
This tactic is necessary because it's impossible to argue someone else's gender, and yet people feel compelled to try.
QuoteThis tactic is necessary because it's impossible to argue someone else's gender, and yet people feel compelled to try.
It is impossible to argue someone's gender if it is defined in a certain way. If this word is defined differently - it is absolutely possible.
Also, If I identify myself in a certain way (let's say an atheist) and someone doubts my self-identification I am not going to be insulted. I'll simply say - I am an atheist because of A, B, and C. If the person will disagree with me saying that A, B, and C are not enough (or irrelevant), I'll simply make a conclusion that we have different definitions\understandings and move on.
Other people have no obligation to agree with my self-identification. After all, I may be mistaken, missusing words, or lying.
Also, If I identify myself in a certain way (let's say an atheist) and someone doubts my self-identification I am not going to be insulted. I'll simply say - I am an atheist because of A, B, and C. If the person will disagree with me saying that A, B, and C are not enough (or irrelevant), I'll simply make a conclusion that we have different definitions\understandings and move on."I wouldn't be insulted" is such a fascinating argument.
Other people have no obligation to agree with my self-identification. After all, I may be mistaken, missusing words, or lying.
Yeah, I mean, I could define womanhood as "being me" and I'd be pretty set I guess. Though I guess I still couldn't prove it to anyone else... Radical skepticism is funny that way.QuoteThis tactic is necessary because it's impossible to argue someone else's gender, and yet people feel compelled to try.
It is impossible to argue someone's gender if it is defined in a certain way. If this word is defined differently - it is absolutely possible.
Here comes a simple problem. We don't even have a unified definition of the word "gender"This definition is plainly useless (redundant), very new (reactionary), and presupposes that sex is binary when there are obvious counterexamples. There are male traits and female traits, sure, and even one person with both destroys this definition.
I regularly encounter variations of 4 major definitions.
1) Gender is exactly the same thing as sex but when talking about humans. It is binary. Can be either male or female.
2) Gender is a biochemically determined behavioral pattern that usually matches sex but not always. It is also a spectrum. Can be male, female, both(or neither).This sounds like that "gendered brains" theory. I don't know what to make of it, but the data didn't sound conclusive. I'm very skeptical but I'm interested.
3) Gender is (quoting WHO) characteristics of women, men, girls and boys that are socially constructed. This includes norms, behaviors and roles associated with being a woman, man, girl or boy, as well as relationships with each other.Yeah, these last two make the most sense!
4) Gender is an internal feeling of being X. Usually it is male or female but can be both, neither, fluid, and more.
My problem is... those 4 are absolutely incompatible.
thats a misconception its actually progesterone that lets you use the morphing ballYESSS LET'S GO
There's some context missing here, in that doubting trans people's self-identified gender is often done in conjunction with denying them healthcare they could die without. Trans people are touchy about gender for a reason, that being a great deal of oppression.
Gender and sexuality both has lots of nuances, which we could learn about from each other, in and outside of this thread. At the same time there can be hardships in such a discussion, because LGBTQ+ people face a lot of unfair treatment, and the lot of us sadly bring with us some bias from the world we were brought up in. Going into that difficult discussion, hedging on the other person lying won't lead to anything constructive. Please don't.
Furthermore both are impossible. You cannot demonstrate you are an atheist. I cannot demonstrate that I'm non-binary. Not only do neither of have a responsibility to do so, we *can't*. There's some outside chance we could justify the existence of atheists or trans people to this random offensive person, but we cannot prove who we are. We don't need to. The burden is on them to, IDK, make whatever case they're actually making when they "express doubt"
Technically 3 is more accurate, though slightly incomplete. Genders are socially constructed and subjective. "Manhood" means very different things in different cultures, and often changes decade by decade. There are common ideas but the details evolve (or just change :P). Womanhood too. And other genders as well.
A man need not perform any masculinity whatsoever. He must simply identify as a man. Typically that means he wants to be manly, at least in some ways, but there is no requirement whatsoever.
But it is this messing with the rights that should be the focus, not trying to forcefully change someone's opinions on who other people are.Oh, sure!
Maaaybe. I'm not convinced of the "gendered brain" theory but I'm ready to listen. There's clearly a correlation between male physical traits and forming a more masculine gender identity. "Males tend to be men" you could say. But we constructed "manhood" in response to male traits, so that's not surprising. I'm curious what will happen when people grow up with more genders around.QuoteTechnically 3 is more accurate, though slightly incomplete. Genders are socially constructed and subjective. "Manhood" means very different things in different cultures, and often changes decade by decade. There are common ideas but the details evolve (or just change :P). Womanhood too. And other genders as well.
Doesn't it mean that being trans has nothing to do with genetics or other aspects of one's biology and it is simply the result of someone's upbringing and cultural background?
Dangit, I got in a conversation about this recently so I should have been more clear. That's on me.QuoteA man need not perform any masculinity whatsoever. He must simply identify as a man. Typically that means he wants to be manly, at least in some ways, but there is no requirement whatsoever.
So your definition of a man is "Man is any person who considers himself to be a man". Do I understand you correctly?
So your definition of a man is "Man is any person who considers himself to be a man". Do I understand you correctly?
There's some context missing here, in that doubting trans people's self-identified gender is often done in conjunction with denying them healthcare they could die without. Trans people are touchy about gender for a reason, that being a great deal of oppression.
Gender and sexuality both has lots of nuances, which we could learn about from each other, in and outside of this thread. At the same time there can be hardships in such a discussion, because LGBTQ+ people face a lot of unfair treatment, and the lot of us sadly bring with us some bias from the world we were brought up in. Going into that difficult discussion, hedging on the other person lying won't lead to anything constructive. Please don't.
I honestly don't understand how denying healthcare is legal. I am very confused why stories like Robert Eads' don't end in a bunch of people going to jail. Doctors may have a right to say "I disagree that you are a wo(man)", they shouldn't have a right to deny treatment because of that.
I also understand the desire of changing LEGAL definitions of the words gender, man, woman (not that I think it is a good idea in all cases) It can also be done without changing the definition by rewriting rules and replacing relevant instances of "(wo)men" with "men and trans(wo)men"
I never said that trans people are lying, Please don't put words in my mouth. I said that people have a full right to not believe someone when they say I am X. Demanding them to accept every "I am X" claim is just plain wrong and very anti-freedom of thought. Also, I listed lying as one of the possible reasons why a claim can be false. Why are you jumping on the lying part?
*I do think that not all people who claim to be trans are actually trans, some are mistaken, especially young people but it is a rather complicated discussion. Intentionally lying and putting yourself into a marginalized group is rather... unlikely
So your definition of a man is "Man is any person who considers himself to be a man". Do I understand you correctly?
no a man is just any member of our species the word you're looking for is wereman
sprints out of thread cackling madly
Much (all?) dysphoria is totally cultural, though. Many trans women shave their legs, but smooth legs are not a female trait. Leg shaving is just something (many) women do. It's still very important to people, but it's subjective.
Hmm...
Much (all?) dysphoria is totally cultural, though. Many trans women shave their legs, but smooth legs are not a female trait. Leg shaving is just something (many) women do. It's still very important to people, but it's subjective.
Wait. I am not sure I understand what you are saying.
Are you implying that a cisgender woman who shaves her legs has a slightly different version of female gender compared to a cisgender woman who doesn't?
And if I will start shaving my legs (let's say my girlfriend will say she prefers cleanly shaven male legs) will it mean that I moved somewhere on the spectrum and my gender has slightly changed to another variant of male?
I meant that women who shave their legs do so not because they are female, but because they are women.
My personal view on this is there needs to be a proper separation out of gender roles and gender. I see gender as an immutable, likely neurological in origin, self-perception. A bit like the mental blueprint you have of your body, and when the body and the blueprint don't match it often causes distress.
Then gender roles are then the stuff that a society expects someone of a specific gender to do. Much more mutable and varies from culture to culture.
It feels like a lot of the issues come from people saying that gender is a social construct while simultaneously saying it's immutable. If it's a social construct, then it can be changed, but if it's not able to be changed then it's not a social construct.
I have just seen a clip of a prominent American political commentator calling for "eradicating trangenderism from public life entirely" and I am both incredibly angry and wondering if anyone in the audience realized that he was effectively calling for genocide.
When they either forget not say the quiet part out loud, or no longer feel the need to hide it...once trans people are "dealt with" disabled people aren't going to be that far away on the list of "undesirables" to be handled next.
Thing is, even if you regard your brain/body not being matched as some form of 'mental disability', we already have legal and political agreement down in the books that society should accommodate others with mental and physical disabilities. There's already legal obligation to sure public buildings are wheel chair accessible, to not discriminate against people with Down's Syndrome. So even if you regard being transgender as some form of mental disability, then that doesn't change their being an obligation to accommodate, which means...allowing them to live as their 'preferred gender'.
Also mental disability is measured in distress and harm caused to the person with it, and treatment is about doing things to reduce or remove that distress. Since we already know 'conversion therapy' doesn't work for that and is instead just horribly abusive and cruel, that just leaves accommodation which is the approach proven to reduce the distress/harm.
So even by their professed 'logic', 'eradicating transgender' doesn't fit. Trying to present it in those terms is just a transparent attempt to mask their own hatred and prejudice, not that this wasn't already obvious.
-snipped for Vec's sake-With the whole federal marriage equality thingymabob, wouldn't that be explicitly overridden?
Doesn't that just mean they need to respect marriage license (gay or otherwise) of other states, but you still can't become gay married in that state?The law actually has nothing to do with gay marriage or anything else.
Hm, are you saying that gender is like an Operating System (or rather a part of it) which is independent of memories but needs time to form? And that merely copying memories into an empty brain will fail to produce a person because there is no OS in place which needs to be naturally developed? And that, unlike computers, hardware changes software, and software changes hardware and they can't be separated cleanly?
I like this perspective and it gives some food for thought.
Again, it comes to definitions.Of course. The rules of any game change depending on how you define the pieces. This argument pertains to the WHO definition. Other definitions bring different conclusions - for instance, the findings are mostly meaningless if one considers gender to be identical to sex.
If your definition of gender is something that looks like
Gender is norms, behaviors and roles associated with being a woman, man, girl or boy, as well as relationships with each other.
Then your study will show that norms, behaviors, and roles are mostly socially constructed with some hard-to-quantify influence of evolved behavioral patterns (aka gender according to a different definition).
I'd like to point out that Strongpoint is arguing for access to HRT, and so is moderately [slur] on-side despite all the words we've exchanged.
Death before detransition. Literally.
I can't do it again- the decade and a half as a scared adult, repressing, or the couple months where my hormones didn't work. F'ing castor oil.
I can't do it again. I won't.
All the changes to my sex, they're just gravy.
I lived a half-life until I started hormones. So, so late.
...
I'll also do my best to well-hydrate myself so hopefully... hopefully there aren't any problems this time.At least a pint beforehand to make sure your blood's "properly hydrated" as it were, I was told. More is better, stagger it to about 250ml (or half a pint, it's close enough) every 15 minutes since your body can only properly take up so much water at once.
Does anyone here would really like to have a partner in theory, but is absolutely horrified by the concept in reality? Can't be the only one.Mmm yeah a bit. I have a great partner (I had a nightmare about us breaking up yesterday, messed me up a bit) but it's long-distance, and I get... really awkward about being sexual with them, usually. A LOT more than I did with strangers, actually. I think there's some shame problems there.
Yay! Israel's right wing media is stocking the flames of transphobia! we are like the US or UK!
Kinda surprised they did that actually, thought they would be busy trying to defend the not so popular attempt of takeover by the elected government, but that multitasking for you.
Yay! Israel's right wing media is stocking the flames of transphobia! we are like the US or UK!Wish I could say I'm surprised but Israel's right-wing is, rather ironically, pretty damn fascist.
Kinda surprised they did that actually, thought they would be busy trying to defend the not so popular attempt of takeover by the elected government, but that multitasking for you.
I need to stop using Tumblr because I enjoy the bullshittery but there is no escape from the awful news of awful things happening around the world especially to queer people and it is well meaning but by God is it exhausting
I'm... not sure why it'd be relevant? Folks of all chromosomes end up with irregular numbers of ribs, and even non-LGBT folks occasionally get some removed for reasons varied. Rib count isn't strictly indicative of much of anything on its own.
The statement acknowledges that this has caused terrible harm to the persons involved.
The association hopes that their statement will support people who are coping with trauma.
On the subject of sport, the organisation said a biological definition of sex "would mean that organisers could exclude trans women from women's sport without this additional burden" of having to show it was necessary to do so in the interests of fairness or safety.AKA, "You had to provide a reason before, now we want it to be legal to exclude trans women for literally no reason."
Changing to a biological definition would also mean single-sex groups could restrict membership to biological women or men, the EHRC said, giving the example of lesbian groups or women's-only book clubs which would then be able to exclude trans people.Makes me wonder how many trans men are gonna turn up to those same lesbian groups or book clubs to prove a point (Everyone forgets about trans men).
The EHRC also said a change in the definition could be "more ambiguous or potentially disadvantageous" when it comes to equal pay provisions, direct sex discrimination and indirect sex discrimination."We're fucking you over in major ways, but we saved biological women from the horrible mean transes so hooray!"
QuoteOn the subject of sport, the organisation said a biological definition of sex "would mean that organisers could exclude trans women from women's sport without this additional burden" of having to show it was necessary to do so in the interests of fairness or safety.AKA, "You had to provide a reason before, now we want it to be legal to exclude trans women for literally no reason."
Not from a starting point of actual transgendered athletes who take hormones because of their earnest need but from the perspective of bad faith actors who might use it to cheat under the protection of a medical label, like the Norwegians do with asthma.See, this is one of those things I'd say would make more sense to worry about if it had, like. Ever? Ever. If it had ever happened. As far as I'm aware there has currently been exactly zero (0) cases of someone faking transitioning to get access to relevant hormones for a competitive advantage in sports. It's not entirely unreasonable to worry about specific expressions of bad faith, but it kinda' is unreasonable to worry about nonexistent ones, y'know?
Yes, I apologise, but I am making this trans issue about cis people :PFairness in sports is indeed complicated (arbitrary and based more in feeling and tradition, except for obvious profit-motive). I don't like to get into it, but trans people indeed are basically unrelated to the issue.
Not from a starting point of actual transgendered athletes who take hormones because of their earnest need but from the perspective of bad faith actors who might use it to cheat under the protection of a medical label, like the Norwegians do with asthma.See, this is one of those things I'd say would make more sense to worry about if it had, like. Ever? Ever. If it had ever happened. As far as I'm aware there has currently been exactly zero (0) cases of someone faking transitioning to get access to relevant hormones for a competitive advantage in sports. It's not entirely unreasonable to worry about specific expressions of bad faith, but it kinda' is unreasonable to worry about nonexistent ones, y'know?
The main idea of sports is determining the strongest peopleIs it? For what purpose? What's the ROI?
What? Some people just like playing sports. I like trying to challenge myself physically to play sports I enjoy. Can I get my body to do what my mind wants it to? Especially as I'm now firmly in middle age?Uh, yes, and the fact that people like you like it and will pay for it is why other people will pay to build stadiums, host sports tournaments, broadcast it, and so on. If people didn't like it, nobody would bother funding it.
Some people also like watching sports - it's amazing to watch what some people can do physically. Reaction time, endurance, sheer strength - whatever.
Thinking of things in ROI is just... too limiting.
What? Some people just like playing sports. I like trying to challenge myself physically to play sports I enjoy. Can I get my body to do what my mind wants it to? Especially as I'm now firmly in middle age?
Ultimately speaking, commercial success is the key but if we look from this capitalistic point of view, all rules should be determined only by the whims of paying customers. It would result in stuff like - If the majority of paying customers don't want to see members of a certain race competing then... Or "no not sexy female athletes on my TV, it is not what I pay money for"!I mean, yeah? It's not about what "the majority of paying customers want", it's about what makes the most money, so as long as the paying customers are still willing to pay you can disappoint them to whatever extent still gets you their money — but you can bet that if enough people were categorically unwilling to pay money "to see members of a certain race competing", the league would one way or another make that happen – because players need to be paid, officials and announcers need to be paid, camera crews need to be paid, uniforms need to be bought, transportation needs to be hired, and all the other employees at all levels who make the games happen all like to eat every day too, so without the money, there aren't any games.
Norwegians are all born with abnormal, monstrous feet, but it's also the case that all Norwegian skithletes happen to be asthmatics.If I've picked the right episode, from memory but without checking it, relevent to the above: https://www.bbc.co.uk/programmes/p0crdjjv (but maybe not to the thread - and if that's geofenced against you, there'll be a separate podcast-download you probably can find, perhaps via World Service pages...)
And this is why hormone treatment and sports has to be thought over, in my opinion. Not from a starting point of actual transgendered athletes[..]I agree with everything you said with two minor exceptions. First, I think that bearing some major event a broader discussion isn't likely to happen, and LGBTQ activist are smart to focus on their interests by pushing the envelope through legal means. Second, seems that the government got tired from getting sued for discrimination and made this legal clarification, as oppose to initiating some new legislation on the subject.
To me the trans rights feels a lot more bitter than the LGB rights is the thing.
Theory: Once 'out', a gay person transgresses by making themselves look and act different from the 'normal' person that they should/could be. You can at least be aware of them, tolerate them as long as it suits you, you know precisely whee they are, should you have any concerns about them.. But the "ultimate point" of being trans is to be at least as much like that they are not as they can, which means that they're dangerous to the less accepting kind of worldviews.
Of all tyrannies, a tyranny sincerely exercised for the good of its victims may be the most oppressive. It would be better to live under robber barons than under omnipotent moral busybodies. The robber baron's cruelty may sometimes sleep, his cupidity may at some point be satiated; but those who torment us for our own good will torment us without end for they do so with the approval of their own conscience.
Welp, spent £100+ on tucking underwear. They arrived, and they're not really all that similar to how they appeared on the site. Made of some crappy thin material that you can literally see through that feels artificial as all hell. Took them far longer than they'd said to arrive too, and it seems unlikely I can get a refund due to them being based in a foreign country and having a no refunds policy.Looks like you got scammed.
Screw you, Origami Customs.
What's that quote from CS Lewis? Ah yes:QuoteOf all tyrannies, a tyranny sincerely exercised for the good of its victims may be the most oppressive. It would be better to live under robber barons than under omnipotent moral busybodies. The robber baron's cruelty may sometimes sleep, his cupidity may at some point be satiated; but those who torment us for our own good will torment us without end for they do so with the approval of their own conscience.
I've heard bits and pieces about America's slide, but mostly revolving around 'protect the children.' Are they attacking adults' jobs now?Yeah. Conservative states are eliminating Tenure to silence teachers and professors. They've also been organizing Parent Mobs to lobby school boards against anything progressive.
Can you elaborate, what is this 'America's slide' and why/how Vector would be affected in finding jobs in the exact science math department?I've heard bits and pieces about America's slide, but mostly revolving around 'protect the children.' Are they attacking adults' jobs now?Yeah. Conservative states are eliminating Tenure to silence teachers and professors. They've also been organizing Parent Mobs to lobby school boards against anything progressive.
Vector couldn't get a job in Florida and be themselves, for instance.
California and NY are fairly safe, but safety is relative and subjective. Both states now have expanded their State-funded Colleges to the point that private colleges are slowly but surely going out of business, unless they advertise aggressively as ultra-conservative.
Oh... Wow. The W word. In this thread."Woke" literally started as a self-description, mainly among black activists in the US.
Jipehog, it is basic politeness to not use words describing a group of people (ethical, political, religious, whatever) unless the very same group describes themselves as such. Even if you dislike this group or strongly disagree with it. Evangelical is fine because they call themselves that, unlike something like, hmm. Bible thumpers. Woke is really NOT fine.
Personally, I am quite annoyed even by labels that aren't really meant to be offensive and used for convenience like "cishet". Woke is actually meant to be offensive
Also, I suspect that you have no clear definition of who this woke group are.
What are the reasons, when someone is recoounting experiencing oppression due to being trans, in the LGBTQ+ thread, to tell them to go somewhere else?:o I think you either misread or confused me with someone else.
I'm gonna miss jipehog when he gets banned...
"Woke" literally started as a self-description, mainly among black activists in the US.Etymology is irrelevant. Languages mutate. Also, it was a way more narrow group of people than what is meant nowadays (Not that there is a clear definition)
The point is that a thinking person looks at this situation, says: "well, I know of two working mathematicians in the whole country who are trans and sentiment is becoming worse and worse and worse. I will have to figure out what to do next."How many working mathematicians in the US were openly trans 20 years ago?
So, I'm going to clarify via a couple of bullet points:Since you didn't quoted anyone specific, i'd clarify that I am curious about the mentioned change in the last few months, labled as countrywide slide and alluded to widespread changes in univesrties (and education) system which would have wider implications. I don't belive anyone have questioned your expirences or the hardship of trans people in society as whole
There's days I'm kinda' disappointed GSRM/GRSM (Gender, Romantic, and Sexual Minorities) didn't catch on, though I suspect it's 'cause it's a little too broad. Could probably fix it slapping a "consensual" in there somewhere, but eh.
And I consider myself "one of the 'A's in LGBTQIAA++", so I'm not sure GRSM is inclusive of me. I'm being oppressed!The As would pretty straightforwardly fall under romantic (aro) or sexual (ace) minority, wouldn't it? Unless there's a third sort of A out there.
Ah I'd lazily put those two together as the one A. Mark me down (primarily, and hopefully) as Ally. But that's why I preserve the plusses. ;)And I consider myself "one of the 'A's in LGBTQIAA++", so I'm not sure GRSM is inclusive of me. I'm being oppressed!The As would pretty straightforwardly fall under romantic (aro) or sexual (ace) minority, wouldn't it? Unless there's a third sort of A out there.
It'd be in the sense that atheism is a position on theistic belief... which there's argument about at times from various strains of atheist, but it's probably close enough for general use.I'm much happier arguing my triple-A position on that issue: Atheist agnostic apatheist. (Don't believe, don't see any possibility of certainty, don't think it's worth bothering about.)
And I consider myself "one of the 'A's in LGBTQIAA++", so I'm not sure GRSM is inclusive of me. I'm being oppressed!The As would pretty straightforwardly fall under romantic (aro) or sexual (ace) minority, wouldn't it? Unless there's a third sort of A out there.
It'd be in the sense that atheism is a position on theistic belief... which there's argument about at times from various strains of atheist, but it's probably close enough for general use.
Why does it matter what the label does or does not include? Surely that's not the important thing here.I gather you don't work with people and groups for a living.
I gather you don't work with people and groups for a living.
The whole point of labels is to divide people.
Tell the blacks, the browns, and the others that they're different, and suddenly they need a white man to unify them. Start talking about the rights of people of color, and suddenly they figure out that they can start running their own political candidates.
... actually, good point Max.
(FYI, I lump Maximum Spin, MaxtheFox, and Maxtm into one entity, generally. But Maximum Zero usually gets his own identity, because I don't like getting bodyslammed)MaxtheFox is fine, but the cull:square dude called me a right-wing paleo dieter, so I'm not going to sign off on that one.
Why does it matter what the label does or does not include? Surely that's not the important thing here....as a more direct answer, my own 'raising' of the issue was just a flippant faux-outrage at being 'out-grouped' just because I was (adjacently) outside those various sets of people who could actually 'come out'... No real fuss, it just sparked a more semantic discussion than anticipated.
I think not all people who fall under the definition of LGBTQ+ actually want to be grouped together.
Like, I dunno, a lesbian who is also a radical feminist may not want to have anything to do with T and have extremely transphobic views. Or a religious asexual may find the LGB disgusting, sinful, and worthy of execution.
I appreciate that. I recall how blacks had several members in Congress before the Ku Klux Klan started terrorizing the South post-Civil War.I gather you don't work with people and groups for a living.
The whole point of labels is to divide people.
Tell the blacks, the browns, and the others that they're different, and suddenly they need a white man to unify them. Start talking about the rights of people of color, and suddenly they figure out that they can start running their own political candidates.
... actually, good point Max.
So uh, I don't want to make a big deal about this again because I know you don't mean it this way, but you are basically saying that minorities are too dumb or gullible to organize politically unless white people phrase it just right.
Blacks figured out how to run their own political candidates back when they were still called 'negroes', or worse (https://en.wikipedia.org/wiki/Frederick_Douglass).
People aren't really that easily led.
How dare he! We all know you would NEVER eat a salad!Quote(FYI, I lump Maximum Spin, MaxtheFox, and Maxtm into one entity, generally. But Maximum Zero usually gets his own identity, because I don't like getting bodyslammed)MaxtheFox is fine, but the cull:square dude called me a right-wing paleo dieter, so I'm not going to sign off on that one.
And I consider myself "one of the 'A's in LGBTQIAA++", so I'm not sure GRSM is inclusive of me. I'm being oppressed!
So, I'm going to clarify via a couple of bullet points:Since you didn't quoted anyone specific, i'd clarify that I am curious about the mentioned change in the last few months, labled as countrywide slide and alluded to widespread changes in univesrties (and education) system which would have wider implications. I don't belive anyone have questioned your expirences or the hardship of trans people in society as whole
Otherwise, this thread is usually more active, I hopped that by now someone with applicable experience in what you are going through would offer some advice. Best I can offer is an apology if the terminology ruckus have made you feel uncomfortable and in need to defend/educate about your position, I know this can get daunting over time.
How many working mathematicians in the US were openly trans 20 years ago?
How many are you likely to be unaware of, given your pool of known working mathematicians and expected total of known working mathematicians?
Huh, which one? I'm only aware of asexual.
Huh, which one? I'm only aware of asexual.
AAA is usually agender, aromantic, asexual.
'Legislation medically detransitioning adults'
I wonder if Google decided to stop being evil.
The thread title has made me realize that I am now the person who pronounces it "El Jibbitty"I do too.
Well, it's somewhere in the realm of random probability causing every atom in the sea to randomly move upwards into the sky simultaneously.I wonder if Google decided to stop being evil.
Physically impossible.
Or, if a rogue cycling promoter wanted to make some real money, they'd go full-inclusion in defiance of the BC decision.There is a reason such divide exist in competitive sports. An open sports events where everyone competes together means that biological female would be excluded from wining, as athletic performances clearly show that the best result female ever achieved in Olympics has been outperformed by hundreds and thousands of males tens of thousands of times.
Just factually untrue. Individual women win against individual men all the time, despite professional women's sports receiving far less funding and thus training budget and general support. It is harder to be a woman athlete, and less financially rewarding, yet they still sometimes outcompete... when they're allowed to. This is actually why women's sports leagues were formed, because men couldn't handle occasionally losing to mere women.Or, if a rogue cycling promoter wanted to make some real money, they'd go full-inclusion in defiance of the BC decision.There is a reason such divide exist in competitive sports. An open sports events where everyone competes together means that biological female would be excluded from wining,
as athletic performances clearly show that the best result female ever achieved in Olympics has been outperformed by hundreds and thousands of males tens of thousands of times.The fallacy here is looking at record-setting individuals to make policy for general competition. By this logic, it's unfair for US swimmers to compete against any other swimmers because Michael Phelps is just that good.
With this in mind and current data suggesting that Trans female enjoy performance advantage,Citation needed. Here's one that acknowledges some advantage:
what you suggest would at best be fad, since most female (who already get payed less than males) would not choose to participate, and trans community is too small to sustain such events. So fad slogans on its own wouldn't pave the way forward but further research to figure out what fields are comparable or come up with different classifications that would be fair for everyone.The real issues facing women athletes in general are pretty important to me, as a feminist. Professional sports is designed to be resistant to change, for better or for worse, and I don't have a magic bullet to fix the deep iniquities in it.
Just factually untrue. Individual women win against individual men all the time, despite professional women's sports receiving far less funding and thus training budget and general support. It is harder to be a woman athlete, and less financially rewarding, yet they still sometimes outcompete... when they're allowed to. This is actually why women's sports leagues were formed, because men couldn't handle occasionally losing to mere women
Ah, but the cycling rule that allowed trans athletes did in fact have testing and rules regarding hormone levels.QuoteJust factually untrue. Individual women win against individual men all the time, despite professional women's sports receiving far less funding and thus training budget and general support. It is harder to be a woman athlete, and less financially rewarding, yet they still sometimes outcompete... when they're allowed to. This is actually why women's sports leagues were formed, because men couldn't handle occasionally losing to mere women
This is some serious reality-denying stuff. No. Women can't compete with men in almost all sports. They simply can't. I am really curious to see some examples of "the Individual women win against individual men all the time"
I do agree that after a few years of HRT advantage of transwomen is minor enough to allow meaningful competition and there are enough evidence of that (like scientific studies)
For other sports any advantage is even less detectable. There are, in fact, physical advantages to being a woman.
You're burden shifting.For other sports any advantage is even less detectable. There are, in fact, physical advantages to being a woman.
Yes, that is why I said that "further research to figure out what fields are comparable or come up with different classifications that would be fair for everyone".
Otherwise you should be mindful about the balance between faith and railguns when claiming facts, especially in new field with a lot of political interest in it. Science tend to be shaped by systematic research not headlines.
Why not "And Trans should be allowed as human beings with equal rights and equal protections, unless and until it is scientifically proven to a reasonable scientific consensus that Trans enjoy an unfair advantage necessitating that their rights to their own identity should be invaded in the interests of fair competition?"Well, it has been. Also, what is a "right to one's own identity"? That's a silly concept. Would you be okay with keeping the same structure, but renaming it to "genetically male" and "genetically female"?
I'm anti cycling races, such a dumb sport they all stay in peloton until the last straight, and for that everybody needs to be bothered with roads closed off? Sit them on stationary bikes, measure their times and tape their mouths shut! At least there will be some variation in the ranking that way.Not all cycle events are like that. I can point you at almost 300 competitors who will be riding in nine different events across thebcountry, tomorrow, at distances from 10 to 50 miles (and more on Sunday, including at least one of 100 miles) where there'll be no group riding. In fact, that's against the rules[1]. And no need for closed roads. And there'll be more participations than that sample, but I'd need to dig about a bit for what else is on. Then there's Audax/Randoneurs and general leisure cycling which I suspect motorists will notice far more (and complain about the MAMILs, probably, causing more perceived obstruction by not racing).
And here we see examples of why transphobia and misogyny are the Spiderman pointing meme. Anyway, it's no surprise why bills taking away trans folks' bodily autonomy go hand in hand with bills taking away women's bodily autonomy, and are passed by the same fascists. There's no real interest in "protecting women" any more than there is interest in "protecting women" from having jobs or from black people or from immigrants or from engaging in politics. It's all about reinforcing supremacist notions and status quo hierarchies. Apply transphobia to that, and well, you get this! Trans people being repeatedly misgendered by proxy. Trans women being vilified (if you assume men are strictly superior, anyone who willingly is a woman must have ulterior motives and is suspect). Trans men are ignored and patronized as victims (oh those poor inferior women who have been misled into thinking they can be something better than they are; what an admirable notion, but ultimately confused). And nonbinary folks either lumped into one of these categories or otherwise denied to exist. Our autonomy is taken away simply because cis people find us inconvenient, that our existence might somehow impinge upon them pretending we aren't people deserving to exist in public like anyone else and engage in activities like anyone else. If you can't bother to afford us basic human dignity, why the fuck are yall cis people even in this thread?I am deeply concerned if you think athletic performance is evidence of absolute "superiority". That's an incredibly sexist, racist, and generally offensive notion, even if you only hold it to make accusations at other people.
I am unbelievably pissed that once again, the LGBTQ+ thread is being used as a "but is it even possible to integrate them into normal society???" thread. Fuck all y'all.I can't speak for everyone, but I don't think anyone here thinks that's impossible or even hard.
Ah, but the cycling rule that allowed trans athletes did in fact have testing and rules regarding hormone levels.
That is being Abandoned in favor of a "No Trans Allowed" rule.
But what I don't mind is actually unimportant, what athletes and audiences of a particular sport want is what matters. Note: athletes and audiences, - not a small minority.From my understanding, it isn't a grass-roots will. Certainly not the 'audience', which only has a "vote with its feet" influence, but are basically as likely to have any opinion as the general population (TERFs to 'FERT's, and everything between). I've heard a nearly full range from competitors/organisers/their representatives too. Caution, naturally, but also significant support for reasonable inclusion. It was under the air of inclusion that my cycling governing body was given freedom to mirror BC[1]
In the light of the recent well publicised decisions of British Cycling and UCI as to the requirements for a transgender cyclist to be permitted to compete and the potential need for a revision and/or a decision on eligibility to be made at short notice [...some lengthy procedural language here...] it may be imperative to act swiftly to implement changes in our policies to bring them into line with those of other National Governing Bodies.
I am unbelievably pissed that once again, the LGBTQ+ thread is being used as a "but is it even possible to integrate them into normal society???" thread. Fuck all y'all.Sports are always going to be a tough nut to crack.
A change in the rules in case anyone here is into cycle-racing in the UK (https://www.bbc.co.uk/sport/cycling/65718748).Going back to this particular example, it might help to explain, in the simplest possible terms, why this is bad.
(Though BC doesn't control all cycle-sport here, much as they like to make everyone think so. I know that at least one other governing body is in a position to quickly synchonise with BC/UCI rulings if it chooses to, quicker than it originally did to become permissive, but I'm not sure if it will tend to go back to dismissive again so automatically. It certainly ought to wait until the end of the season, though, even if the board thinks it must. And then there's time to go to the membership.)
They're still segregated by gender.They're segregated by sex. That isn't the same thing.
Your sleazy law school article from Duke has already had it's methodology questioned.They're still segregated by gender.They're segregated by sex. That isn't the same thing.
Historically, the decision was made to extend extra protection to sporting activities for female persons, who cannot compete at the same level as males in the vast majority of popular sports, and whose separate sports leagues rarely had enough interest to really justify the expense of running them, so that many sporting opportunities at the time were available only to males. If we still wish to guarantee equality of opportunity to female athletes, specifically, and not just as a side effect of their being the majority of 'women athletes', then some kind of accommodation still has to be made. In general, I don't see why anyone would think it would be wrong to support female athletes too. The problem seems to be the use of the dated terminology 'women's sports', which was understood to refer to female athletes.
I would also like to express a second time, just to be clear, that... well, first, "hormone levels read[ing] 'woman'" isn't really a thing. Hormones don't work like that. But second, more importantly, hormone levels are not significant to the difference in athletic performance, which is caused by gross skeletomuscular structural differences that cannot ever be changed.
Under the rule change, she must Abandon her gender and fake the gender she was assigned at birth, or not participate.
QuoteUnder the rule change, she must Abandon her gender and fake the gender she was assigned at birth, or not participate.
It is not true. Participating in the male (by sex) league has nothing to do with her gender. Yes, she will be DEMOLISHED in the male sport but... well it is one of the effects of body autonomy. You can't do things to your body that make you a worse athlete and then expect special rules just for you. And it doesn't change if you have good reasons to do so.
And I am amazed that some people pretend that leagues aresegregatedseparated because of misogyny.
Your sleazy law school article from Duke has already had it's methodology questioned.Do you seriously not believe there are differences in athletic output between males and females? Have you ever actually watched a sport?
The sample size of 8 men and women in your Springer Link article is too small.
"A cross-sectional study of muscle strength and mass in 45- to 78-yr-old men and women"...is not the age group of most athletes, and thus irrelevant.
"Hand-grip strength of young men, women and highly trained female athletes" while it's questionable why the sample size of men exceeded women by three-to-one, I am just going to say that firm handshakes do not solely define all athletic prowess, especially in cycling, and move on with my life.
Finally "But, women are actually more prone than men to suffer many of the most common sports-related injuries. There are a variety of reasons for this "gender gap," and there is much about it that remains uncertain." Does NOT justify segregation of gender in non-contact sports such as Cycling.
Got any real science to back up your junk pseudo-science beliefs?
QuoteUnder the rule change, she must Abandon her gender and fake the gender she was assigned at birth, or not participate.
It is not true. Participating in the male (by sex) league has nothing to do with her gender. Yes, she will be DEMOLISHED in the male sport but... well it is one of the effects of body autonomy. You can't do things to your body that make you a worse athlete and then expect special rules just for you. And it doesn't change if you have good reasons to do so.
And I am amazed that some people pretend that leagues aresegregatedseparated because of misogyny.
You clearly don't get the point, and frankly should leave this thread.
Well, I learned one thing today.Your sleazy law school article from Duke has already had it's methodology questioned.Do you seriously not believe there are differences in athletic output between males and females? Have you ever actually watched a sport?
The sample size of 8 men and women in your Springer Link article is too small.
"A cross-sectional study of muscle strength and mass in 45- to 78-yr-old men and women"...is not the age group of most athletes, and thus irrelevant.
"Hand-grip strength of young men, women and highly trained female athletes" while it's questionable why the sample size of men exceeded women by three-to-one, I am just going to say that firm handshakes do not solely define all athletic prowess, especially in cycling, and move on with my life.
Finally "But, women are actually more prone than men to suffer many of the most common sports-related injuries. There are a variety of reasons for this "gender gap," and there is much about it that remains uncertain." Does NOT justify segregation of gender in non-contact sports such as Cycling.
Got any real science to back up your junk pseudo-science beliefs?
https://pubmed.ncbi.nlm.nih.gov/33572280/
https://pubmed.ncbi.nlm.nih.gov/8477683/
https://pubmed.ncbi.nlm.nih.gov/8194544/
https://journals.humankinetics.com/view/journals/jab/7/1/article-p3.xml
https://www.tandfonline.com/doi/abs/10.1080/10671315.1979.10615607
https://www.tandfonline.com/doi/abs/10.1080/00140138708969760
https://journals.lww.com/acsm-msse/Abstract/1983/15030/Biological_determinants_of_the_sex_difference_in.7.aspx
https://journals.sagepub.com/doi/10.1177/036354657900700415
https://europepmc.org/article/med/1275845
https://pubmed.ncbi.nlm.nih.gov/15795811/
https://pubmed.ncbi.nlm.nih.gov/7942046/
ETA: Accidentally left off this one https://scholar.princeton.edu/sites/default/files/brzycki/files/mb-2002-01.pdf
I could keep going. The only reason I stopped after a handful of links last time is that I didn't think anyone would seriously contest one of the most replicated and, frankly, blatantly obvious effects in the field.
Well, I learned one thing today.Well, it is mandatory under Title IX.
The US Government is clearly in support of the gender divide in sports.
What you don't get is that this is the LGBTQ+ Thread, which would appear to me to be a thread to support the LGBTQ+ community, not to attack their members.QuoteUnder the rule change, she must Abandon her gender and fake the gender she was assigned at birth, or not participate.
It is not true. Participating in the male (by sex) league has nothing to do with her gender. Yes, she will be DEMOLISHED in the male sport but... well it is one of the effects of body autonomy. You can't do things to your body that make you a worse athlete and then expect special rules just for you. And it doesn't change if you have good reasons to do so.
And I am amazed that some people pretend that leagues aresegregatedseparated because of misogyny.
You clearly don't get the point, and frankly should leave this thread.
What exactly don't I get?
I should leave the thread because?
Well, I learned one thing today.Well, it is mandatory under Title IX.
The US Government is clearly in support of the gender divide in sports.
Why is a cisgender male fighting the culture wars with two anti-woke knuckleheads at 1am?
LOLWhy is a cisgender male fighting the culture wars with two anti-woke knuckleheads at 1am?
https://www.youtube.com/watch?v=xvdBrF5qaww
What you don't get is that this is the LGBTQ+ Thread, which would appear to me to be a thread to support the LGBTQ+ community, not to attack their members.I assume that on a public forum topics exist to... discuss topics. As long as it is done within the rules of the forum and respectfully.
What you don't get is that you are attacking one of their members, Emily BridgesI didn't attack anyone. Did you miss the part where I said that I personally don't mind her participation because I don't think that potential advantage is large enough?
What you don't get is that you are LYING about their member, Emily Bridges, by stating that "she will be DEMOLISHED in the male sport" because she was excelling in the Male side until she decided she couldn't live that life anymore. You don't KNOW how she might do against the males, you just ASSUME what you WANT to assume.The key word there WAS. If she will compete with men now, after reducing her testosterone levels, she will be demolished.
YOU are committing misogyny. Hopefully unintentionally.In homo sapiens (and most mammalian species) males are physically stronger than females. It is the reality of biology. If holding this view is misogyny then I guess I am committing it.
YOU are at risk of being banned, hence my not-so-friendly suggestion that you might want to leave this thread before Toady drops a nuke on us all.Banned for breaking what rules?
You are mischaracterizing the law. The law clearly states:That is the text of the law, yes. One of the key reasons it was adopted was explicitly to force colleges to fund "women's" leagues, and that's also the most common way it was used immediately after it was passed. The argument has been that female athletes are "denied the benefits of" combined leagues because they can't compete. You can disagree with that argument, but it's what courts accepted.
No person in the United States shall, on the basis of sex, be excluded from participation in, be denied the benefits of, or be subjected to discrimination under any education program or activity receiving Federal financial assistance (https://www.justice.gov/crt/title-ix-education-amendments-1972)
It does NOT divide the genders. In fact, it has been used to force male teams to accept female athletes.
FAKE NEWS is YOU
QuoteWhat you don't get is that you are LYING about their member, Emily Bridges, by stating that "she will be DEMOLISHED in the male sport" because she was excelling in the Male side until she decided she couldn't live that life anymore. You don't KNOW how she might do against the males, you just ASSUME what you WANT to assume.The key word there WAS. If she will compete with men now, after reducing her testosterone levels, she will be demolished.
General rule of thumb is - just be kind in everything. Try to understand each other. Discussing things like sports... does sound more like politics, rather than trying to understand or support each other.The discussion was on topic, we were talking about the way to achieve inclusion given the reality of competitive sports, but eventually it devolved into the internets beloved tradition of 'someone is wrong'.
EDIT: Have fun with with pride month !Thanks! :)
fuck, I guess with a Progress flag I have more plausible deniability. If it comes to that. I'm not sure if I'm being bitter or reassuring myself.
I'm a bit worried that a couple major companies will back out of their traditional support of Pride Month.Have there been any rumblings to that effect? I would seriously doubt it. It's still a huge moneymaker.
Live under a rock much?I'm a bit worried that a couple major companies will back out of their traditional support of Pride Month.Have there been any rumblings to that effect? I would seriously doubt it. It's still a huge moneymaker.
Live under a rock much?I already knew about that, but that's not at all the same story. Target isn't doing away with Pride merchandise at all - they still have a ton of it. It stopped carrying a specific line because of concerns about a specific person. While I don't really agree with the concerns, that's not in and of itself different from when companies drop products associated with people accused of sexual abuse and things like that. Target as a whole is still all in on Pride Month, although I'm sure that the extent differs by location (as it always has). You're somewhere in upstate New York too, aren't you? You can check for yourself: here, it's just as much a moneymaker as ever.
Target won't even sell some merchandise (https://amp.cnn.com/cnn/2023/05/23/business/target-lgbtq-merchandise/index.html)
Right. You will not stop your insincere rhetoric until they have zero pride merch, because that is your goal.I cannot believe you or anyone could seriously think this.
Can you *kindly* make another thread to "discuss" the best way to remove us from society?
Cry victim all you like. No company is pulling the Gadsden flag because of violent armed mobs.I'm not crying victim. There's no victimization involved. All that happened is that a rich person chose to accept a payday from a megacorp to sell cheap tat geared toward other rich people, but spoiled the deal by acting like a petulant child trying to consternate the olds with lame fake "Satanism", pulling bad press (as intended) and the predictable response from the megacorp.
If you gave a shit about freedom, you'd be supporting us.
By the way, I haven't heard a single credible report of a display being smashed as you claimed. Searching for it now, I see zero news stories even mentioning any such thing. I'm not buying it. If it really happened, then sure, the perpetrators should be arrested for property crime and treated like any other smash-and-grab criminals. This in no way faults Target for making the business decision to pull the line.https://www.youtube.com/watch?v=FscUyMuf-Fo
https://www.youtube.com/watch?v=FscUyMuf-Fo... this is supposed to be a "smash"? That was the saddest tik-tok stunt I've ever seen, although to be fair I intentionally don't look at tik-tok stunts. I actually saw this while I was looking, and I thought, that couldn't possibly be what you mean.
Maximum Spin, you got to start actually reading the links.I do, in fact, read the links. I never said a single word that would contradict any of those statements.
If you had read my link to the article, you would have seen Target didn't reveal what threats were made, nor support their actions in any way with any real info.
If you had read the second link from the designer of the merchandise, you would know that he was actually pretty cool about having his merchandise pulled.
Mainly he said "Yeah, I don't want anyone getting hurt over my merchandise"
He also didn't have any Satanic merchandise for sale at Target. Both Target and him agreed that would not be a good fit for Target.
Maybe the true Target is the Satan we made along the way
if nothing else, pride month gave me the rainbow Pinkerton logo 🌈Maybe the true Target is the Satan we made along the way
Seems fair.
Don't worry, there's always Raytheon. (Raytheon is apparently genuinely very inclusive, which is neat. Never mind the cluster bombs.)
2 days till pride month, heck yeah.
I will say despite all the shit we give megacorps, etc. about pride month, the fact that they consiser the LGBT+ market a target for money and advertising is genuinely a good sign.
"Is that supposed to be broken glass? The window barely even shattered. Really, I saw this and didn't care about it, surely you're not concerned about this. You're overreacting."https://www.youtube.com/watch?v=FscUyMuf-Fo... this is supposed to be a "smash"? That was the saddest tik-tok stunt I've ever seen, although to be fair I intentionally don't look at tik-tok stunts. I actually saw this while I was looking, and I thought, that couldn't possibly be what you mean.
I'm getting Ukraine flashbacks.
...that came out wrong.
This article seems fitting between Memorial Day and Pride Month: https://www.telegraph.co.uk/news/2023/05/26/gay-transgender-veterans-compensation/ (https://www.telegraph.co.uk/news/2023/05/26/gay-transgender-veterans-compensation/)I was initially thinking it'd be some sort of thing of veterans being denied pensions due to being LGBT or something, instead it's about literal torture being done on people because they were gay or trans, or even as much as suspected of it.
...to bad it's in the UK.
Gender is [insert thing], pretty much.Surely that's actually Sexuality? ;D
Get hype for several more days of pride month!DAY 26
Get hype for several more days of pride month!DAY 26
GIVE IT UP FOR DAY 26
Oooh I'll have to remember that trick. Looks very nice! *sending hugs*Get hype for several more days of pride month!DAY 26
GIVE IT UP FOR DAY 26
████████████████████
████████████████████
████████████████████
████████████████████
████████████████████
████████████████████
Dunno if anyone's been keeping track of it, but the UK has been throwing a dicky-fit over a schoolkid identifying as a cat, to the extent that the Education Secretary has gotten involved.Police are more likely to investigate catgate than MPs get investigated for embezzlement, tax evasion, bribery or noncery
It's also a load of bollocks, two students were clearly shit-stirring and selectively recording a teacher who was basically telling students to stop harassing another student and getting rather exasperated by that point. The Telegraph (AKA Torygraph for good reason) saw an opportunity to make shit up and pounced, so now we've got yet another bunch of people losing their shit over the Woke Mob(TM) existing.
But what should we actually do with people who define their gender as a pony, dragon, elf, etc? Some people do this for trolling, some do it genuinely. And this is becoming more popularYou seem to have this persistent problem where you have an inability to treat people unlike yourself with dignity, respect, or as people. You should probably start by talking to your therapist about that tbh.
It is a genuine question, not some kind of attempt to start a debate. I kinda know how to interact with a trans person but if someone will say to me that they are a cat... I honestly have no idea and no plan. And, unlike me, teachers in schools can't even avoid such situations.
But what should we actually do with people who define their gender as a pony, dragon, elf, etc? Some people do this for trolling, some do it genuinely. And this is becoming more popularKids have been pretending to be cats for decades, give me a break. And given that fursonas or otherkin haven't meaningfully shifted scientifically or socially how we understand the 'self,' I wouldn't put any concern about this.
It is a genuine question, not some kind of attempt to start a debate. I kinda know how to interact with a trans person but if someone will say to me that they are a cat... I honestly have no idea and no plan. And, unlike me, teachers in schools can't even avoid such situations.
Dunno if anyone's been keeping track of it, but the UK has been throwing a dicky-fit over a schoolkid identifying as a cat, to the extent that the Education Secretary has gotten involved.It's been a thing in the US too to some extent, but with a uniquely American character:
It's also a load of bollocks, two students were clearly shit-stirring and selectively recording a teacher who was basically telling students to stop harassing another student and getting rather exasperated by that point. The Telegraph (AKA Torygraph for good reason) saw an opportunity to make shit up and pounced, so now we've got yet another bunch of people losing their shit over the Woke Mob(TM) existing.
Your assumption is very wrong and I am really confused about what it has to do with my last message in this thread. Like really confused. It is so weird and random that I can't even see it as insulting. Also, my personality is not the subject of the thread or any discussion in the thread.But what should we actually do with people who define their gender as a pony, dragon, elf, etc? Some people do this for trolling, some do it genuinely. And this is becoming more popularYou seem to have this persistent problem where you have an inability to treat people unlike yourself with dignity, respect, or as people. You should probably start by talking to your therapist about that tbh.
It is a genuine question, not some kind of attempt to start a debate. I kinda know how to interact with a trans person but if someone will say to me that they are a cat... I honestly have no idea and no plan. And, unlike me, teachers in schools can't even avoid such situations.
But what should we actually do with people who define their gender as a pony, dragon, elf, etc? Some people do this for trolling, some do it genuinely. And this is becoming more popularKids have been pretending to be cats for decades, give me a break. And given that fursonas or otherkin haven't meaningfully shifted scientifically or socially how we understand the 'self,' I wouldn't put any concern about this.
It is a genuine question, not some kind of attempt to start a debate. I kinda know how to interact with a trans person but if someone will say to me that they are a cat... I honestly have no idea and no plan. And, unlike me, teachers in schools can't even avoid such situations.
That's also not how gender works? Typically claiming one's gender to be an inanimate object or creature is done in hyperbole to be transphobic...
I'd say that "I define my gender as a <helicopter/whatever>" is often bad-faith absurdism, by those that don't believe that "◇gender≠sex" and decide to go the "by supporting gay marriage, you'll have people marrying animals/buildings next" contrary argumentation.
It's been a thing in the US too to some extent, but with a uniquely American character:
Some US schools *do* have kitty litter.
For sheltering in place during... incidents.
And yet trolls and credulous bigots happily spun a culture-war narrative about it. Along with people demanding that we take their "concerns" seriously and be respectful.
Like no
The people spinning lies to incite hatred should be stopped. With state violence if necessary, AKA fines and whatever.
And the people who believe this shit are a combination of stupid and eager to believe hateful messaging. They don't deserve respect for that, they need deprogramming. The extent to which they actually *believe* what they're saying is debatable- they see a narrative that affirms their bigotry, they share it. Fuck'm. Kindness WILL NOT change their mind.
Obviously, if they *do* change their mind- perhaps because they're tired of being mocked for their gullibility and hatred- I fully believe in restorative justice, which in this case is just "Don't sweat it, cults are addictive, glad you're better now <3". I know many such people. Affirming and respecting their bigotry wasn't what snapped them out of it.
...I mean, I had shitty takes on trans people at first too. People were firm with me- AKA treated me with *actual* respect by calling out how I was wrong. That's been true on more political issues as well. Appeasement doesn't work and it's infantalizing.
The people spinning lies to incite hatred should be stopped. With state violence if necessary, AKA fines and whatever.
They don't deserve respect for that, they need deprogramming.
Kindness WILL NOT change their mind.
Appeasement doesn't work and it's infantalizing.Yea, appeasement is infantilising and a stupid idea. It's still not as stupid, nor as infantilising, as enforcing a nanny state over thought/belief.
Hmm, nope. For someone whose joy is in kicking over sandcastles, I'm not giving them the politeness to handle mine. They'll find a reason whether you give them one or not.Ehhh, I agree that sometimes you need to defend yourself. In practice, though, life is full of grey areas. And sometimes, you end up attacking someone who doesn't deserve it. This (https://youtu.be/zDw-Q7P25Mo) comes to mind.
Hmm, nope. For someone whose joy is in kicking over sandcastles, I'm not giving them the politeness to handle mine. They'll find a reason whether you give them one or not.
Calls for politeness and respectability all too often mean "accept oppression and don't complain". Making bigots feel bad is good. Bigots are cowards who crumple under criticism unless they're allowed to reach critical mass. Letting an "on the fence moderate" feel like big brained or an ally for only supporting *some* oppression is bad and insulting. Rights have never been won solely by being nice. There was always civil unrest driving authority to the table (with the nice, presentable leaders).Hmm, nope. For someone whose joy is in kicking over sandcastles, I'm not giving them the politeness to handle mine. They'll find a reason whether you give them one or not.Ehhh, I agree that sometimes you need to defend yourself. In practice, though, life is full of grey areas. And sometimes, you end up attacking someone who doesn't deserve it. This (https://youtu.be/zDw-Q7P25Mo) comes to mind.
Politeness should be exercised where possible, until the alternative is forced on you.
And Nazis SHOULD be deprogrammed. That's not fuckin shock therapy or castration, you know, the stuff that was done to us and sometimes still is. It's simply making them exist around the targets of their hate until they realize their targets are human beings.
Appeasement doesn't work yet I keep trying it. Then hating myself for it. Well too lateIndeed appeasement doesn't work. But being respectful and polite is not the same as appeasement. A firm polite "no, it won't be your way" or "I believe you are wrong", or "stop doing that if you want to have good relationships with me" are neither appeasement nor disrespect.
Letting an "on the fence moderate" feel like big brained or an ally for only supporting *some* oppression is bad and insultingI am curious, how would you define "an ally of LGBTQI+ or an ally of the trans community?" What are the minimum requirements for you to consider a person an ally?
And Nazis SHOULD be deprogrammed.Curiously this is the same language(reformat not deprogram) that were used by Russia prior to their invasion of Ukraine.
They've also said that they are invading to stop a ongoing genocide the Russian speaking population.And Nazis SHOULD be deprogrammed.Curiously this is the same language(reformat not deprogram) that were used by Russia prior to their invasion of Ukraine.
Rolan (or maybe magma?) also said there is an ongoing genocide of Trans people. That why keep saying that people should not confuse the political game (with media sensationalism etc) with reality.
That why keep saying that people should not confuse the political game (with media sensationalism etc) with reality.
And in case you forgot, the political right is literally doing just that.This is LGBTQ thread and I am not commenting on the issues insofar that I think it could help[1]. And yes I think that the uncompromising view that everyone are either angry bigots or insulting disingenuous moderates with hidden nefarious narratives playing into your prejudice. While there is a genocide on going on is essentially a sensationalist narrative that aligns with justification of violence (they are violent, irrational, and coming for me). Personally, I don't believe this is healthy and often result in comments that for anyone else would have been cause for ban.
-snip-I asked people to stop. It doesn't mean "stop after you get another word in" it means "stop before I lock the thread"
Iirc this thread was created to make a place to talk outside of America. There's no need to import Ameripol here. Concurring with thread maker.More because I'd be spamming other threads with LGBTQ goings-on, and I figured a thread to contain mine and others thoughts and comments would be a good idea.
Pride June is over. Happy Pride July!
Stay safe. Or don't stay, to be safe.They don't really do this on Western websites especially obscure ones lol. I don't use local social media.
In any case, consider that Bay 12 is yet on HTTP, without the S. I don't know what tapping of the lines is done in Russia, or to what resources they have to enact this law and others like it, but this is a tappable line.
99.7% satisfaction over several years and almost 2000 participants. Not at all surprising, but a convenient link to share with the open-minded. Or to refute the hateful lies people and bots spam incessantly.It is not exactly what the article says. It says that 99.7% didn't transition back and\or didn't request surgery to undo their GAS.
True, but the article does say that the 99.7% also expressed satisfaction. If true (I think the study is paywalled?) They both expressed satisfaction *and* declined to detransition.
I get the confusion though because that is two different data. Datum? Things
[...] and I'm frustrated with the lack of institutional support for HRT information.
These things are hidden from us. Deliberately.
Why? [...]
Might not be hidden, HRT is a young therapy so could just be that there aren't institutions in your area with that info yetIt's... been around for about a half a century, and used pretty regularly for better than twenty years. Not sure if young is the right word for that.
It's... been around for about a half a century, and used pretty regularly for better than twenty years. Not sure if young is the right word for that.Basically what TD1 said. Clinical trial research isn't just testing new drugs/procedures/medicines/treatments, but also testing new applications of them/different application methods/different combinations/methodologies e.t.c.
To date, no studies evaluating the perioperative risk of thromboembolism have been conducted in patients receiving feminizing hormone therapy.Some reasonable inferences and comparisons with other populations can be inferred, but are not sufficient, since everyone's body is unique and will respond to different therapies in different ways. Without that body of evidence it's harder to make an accurate and informed assessment over what are the most likely adverse outcomes.
AM. whereas there is a lack of comparable data on available, accessible and quality transgender-specific healthcare, and products used in hormone replacement therapy are not properly tested and licensed;Refer to this 2017 European Parliament notice discussing various gender related issues, including the paucity of clinical trial information
Clinical trials for HRT for gender reassignment started in 2019, so whether as gender identity treatment or as age/treatment/disease-related replacement therapy it's young. It's not an important distinction, and I don't know if there is any political value in a therapy being young or old, because the only value is really in as a descriptor between a therapy that has had hundreds of millions of users and generations of research in side-effects & uses like with salbutamol, versus ones where long term effects/side effects/applications are unknown and you literally just have to wait until studies are completed before you fill that blindspot, as with biologics.Spoiler (click to show/hide)
Spoiler (click to show/hide)
But Hobbs argues this criticism is based on a fundamental misunderstanding of what affirmative means. “For me, affirmative is starting from a stance that says gender diversity isn’t a disorder but has existed across cultures through history. It is saying ‘I believe you’ when you tell me about your experience. It is developing a strong relationship based on trust and mutual respect, but it doesn’t mean you don’t explore.”This is another thing that complicates how medicine & LGBTQ+ cross paths, because an endocrinologist or a gender specialist is going to be going in with the mindset of "identify pathology, identify cause(s) and come to cure" whereas for patients it's about choosing who they want to be. Which to be diplomatic, is not something someone with a "clinical" mindset may be equipped to deal with, as there's a reason why "clinical" is considered a synonym for "cold." The medical staff disagreeing even on how to identify and treat dysphoria in Tavistock is illustrative:
As a general rule I wouldn't recommend a PhD to my worst enemy, but I will say that LW would be good at one.LW probably already has one. Even if it's drawn in crayon.
Do any of you know Heartstopper (https://m.tapas.io/series/Heartstopper/info)? I discovered its existence just yesterday and read ALL of it in the same day.1-8
It is good shit. Maybe even the best. It is just so sweet. It warmed my cold, dead haert.
Please tell me you read it. I NEED to talk about it.
As a general rule I wouldn't recommend a PhD to my worst enemy, but I will say that LW would be good at one.The only thing that matters for PhDs is don't bully the technicians ;-;
1-8
I made a *mmph* squeal and grabbed my face, ironically enhancing the effect
You can't- you can't just do that, man!!
*blushing wildly*
1-9
"I could be anyone, you don't give a shit!" - mood
https://doc.fide.com/docs/DOC/2FC2023/CM2_2023_45.pdf
FIDE decides that transitioning means that you're to be stripped of your chess titles... If you're FTM. MTF is a-ok.
Also there's a two year ban on playing chess in gendered tournaments if you transition because... reasons.
I'm genuinely confused here, is the FIDE saying that there's a difference in intelligence between the genders?
Why they are doing this instead of allowing it instantly? Well, it is obvious. MONEY. It is better to check if some male GM is actually transitioning or decided to grab some easy cash in a women-only tournament.I mean. The eternal question pops up regarding shit propositions like that. Has that ever goddamn happened?
https://doc.fide.com/docs/DOC/2FC2023/CM2_2023_45.pdfApparently MTF isn't allowed too.
FIDE decides that transitioning means that you're to be stripped of your chess titles... If you're FTM. MTF is a-ok.
Also there's a two year ban on playing chess in gendered tournaments if you transition because... reasons.
I'm genuinely confused here, is the FIDE saying that there's a difference in intelligence between the genders?
Why they are doing this instead of allowing it instantly? Well, it is obvious. MONEY. It is better to check if some male GM is actually transitioning or decided to grab some easy cash in a women-only tournament.I mean. The eternal question pops up regarding shit propositions like that. Has that ever goddamn happened?
Has there ever, even once, been a case where a male GM decided all the abuse and frustration that comes from publicly claiming transitioning, nevermind the hellscreeching that would come from faking it, is worth the money from a tournament? Is there any grounds to think it would happen outside the delusions of transphobes?
So, your alternative is that everyone should be allowed to compete in the women's category after a simple "I transitioned" with no checks, no proofs, no prerequisites, no anything?I'd bet you 20 USD I've got laying around here somewhere it wouldn't invite chaos is they just went, "Yeah, you are what you say you are."
Up to 2 years to check is clearly excessive, but no checks at all is inviting chaos.
So, your alternative is that everyone should be allowed to compete in the women's category after a simple "I transitioned" with no checks, no proofs, no prerequisites, no anything?I'd bet you 20 USD I've got laying around here somewhere it wouldn't invite chaos is they just went, "Yeah, you are what you say you are."
Up to 2 years to check is clearly excessive, but no checks at all is inviting chaos.
The "check", here, is that publicly announcing you're transitioned or transitioning is not a bloody small thing. You probably aren't going to need organizational regulations on managing that, because society is going to do that job for you well damn enough.
There was a recent example a couple months ago, yes.Why they are doing this instead of allowing it instantly? Well, it is obvious. MONEY. It is better to check if some male GM is actually transitioning or decided to grab some easy cash in a women-only tournament.I mean. The eternal question pops up regarding shit propositions like that. Has that ever goddamn happened?
Has there ever, even once, been a case where a male GM decided all the abuse and frustration that comes from publicly claiming transitioning, nevermind the hellscreeching that would come from faking it, is worth the money from a tournament? Is there any grounds to think it would happen outside the delusions of transphobes?
Why the hell it is not a bloody small thing? What exactly can be done to a person who will openly go "I will legally change my gender to another one for two weeks to get benefits because there are no rules prohibiting me from doing so"?This is when you review the 'accomplishments' of those who transitoned (to whatever degree), made good profit from it then detransitioned. There are "bringing the sport into disrepute" rules that can be activated for anybody actually taking-the-proverbial in this way.
Hey, if you give me enough incentive and an easy legal procedure to do this I'll "transition" back in forth as many times as necessary
We are not talking about faking transitioning which is not without cost, we are talking about not even needing to fake it because no proof is requiredIn the long run, the proof is in the commitment. It all is. Even self-certification (available to various degrees in various jurisdictions) isn't just a case of hand-waving your status on a whim just like choosing a different jacket according to what the weather is on any given morning.
This is when you review the 'accomplishments' of those who transitoned (to whatever degree), made good profit from it then detransitioned. There are "bringing the sport into disrepute" rules that can be activated for anybody actually taking-the-proverbial in this way.
You don't just assume assume bad intent for everyone who makes an effort to change their status.
I feel like the solution here is: no divisions, just a single competition environment. You aren't in the top of humanity, you aren't gonna win. Sorry if you can't compete with the pros. Basketball? Yeah sorry unless you have mad shooting skills or something you're not competing with the 7-foot giants. Chess? Unless you have a mutant brain, you aren't competing.Yeah, this.
Interestingly this doesn't even have anything to do with sexuality, just artificial divisions/brackets in competitions.
I feel like the solution here is: no divisions, just a single competition environment. You aren't in the top of humanity, you aren't gonna win. Sorry if you can't compete with the pros. Basketball? Yeah sorry unless you have mad shooting skills or something you're not competing with the 7-foot giants. Chess? Unless you have a mutant brain, you aren't competing.
Interestingly this doesn't even have anything to do with sexuality, just artificial divisions/brackets in competitions.
Let's say FIDE goes tomorrow for "Alright, pals. From now on. No more women-only tournaments under FIDE." Do you think no one else will try to organize women-only tournaments? And then we'll still have transwomen wanting to compete there. Problem stays.It's remarkable how difficult it would be to phrase that worse. Women wanting to compete in a competition for women is a problem, alright. Not with anyone competing or wanting to compete, but it damn sure highlights a problem :-\
The problem is that different people mean different things by "women", and having different definitions for words isn't wrong, it just indicates you are not speaking the same dialect.Let's say FIDE goes tomorrow for "Alright, pals. From now on. No more women-only tournaments under FIDE." Do you think no one else will try to organize women-only tournaments? And then we'll still have transwomen wanting to compete there. Problem stays.It's remarkable how difficult it would be to phrase that worse. Women wanting to compete in a competition for women is a problem, alright. Not with anyone competing or wanting to compete, but it damn sure highlights a problem :-\
Let's say FIDE goes tomorrow for "Alright, pals. From now on. No more women-only tournaments under FIDE." Do you think no one else will try to organize women-only tournaments? And then we'll still have transwomen wanting to compete there. Problem stays.It's remarkable how difficult it would be to phrase that worse. Women wanting to compete in a competition for women is a problem, alright. Not with anyone competing or wanting to compete, but it damn sure highlights a problem :-\
FIDE decides that transitioning means that you're to be stripped of your chess titles... If you're FTM. MTF is a-ok.This is not true.
I find it INSANE that it is under flak for not going straight for "OK, anyone can change their chess gender any moment they please!"I find it insane that THIS is your interpretation of it. You seem convinced of it, though.
All this kind of discourse, over a year or so, accomplished to me is change my opinion to "there should be no gender segregation in sports altogether". Yeah it does mean that in many sports women don't have a chance to be "the best", but you don't see a separate league for short people in basketball, or slow-footed people in the 100m sprint, so why does it matter? Not everyone can be "the best", that is a fact.Paralympics too?
All this kind of discourse, over a year or so, accomplished to me is change my opinion to "there should be no gender segregation in sports altogether". Yeah it does mean that in many sports women don't have a chance to be "the best",Let's assume this will be done. The IOC will gather and say - No more male\female separation! It is an outdated sexist idea. The goal of the sport is to find the strongest among all humans.
but you don't see a separate league for short people in basketball, or slow-footed people in the 100m sprint, so why does it matter? Not everyone can be "the best", that is a fact.
I mean, I'm completely fine with this in theory, but as long as there's money to be made offering female leagues — and there will definitely always be money to be made for sufficiently bouncy sports, at least — people are going to organize them, unless you plan on shooting them for it.
Let's assume this will be done. The IOC will gather and say - No more male\female separation! It is an outdated sexist idea. The goal of the sport is to find the strongest among all humans.Let them be, I suppose. My gut says they will have less support than the "official" option because people flock to official things. If it doesn't work out and the IOC starts falling apart then I guess go back to the drawing board. Worth a try!
But what do you propose to do when other entities will start organizing leagues and competitions for women? Make it illegal?
Paralympics too?
We do see weight categories in many sports. Exactly because otherwise a 60kg guy wouldn't be able to meaningfully compete in boxing or weightlifting. Why it is not done in more sports? Not as large of a difference and no demand from athletes and\or spectators.Paralympics are fine, most disabled athletes can't compete in any kind of entertaining or safe way against able athletes-- imagine if a soccer team had the goalie be on a wheelchair. Same for weight categories in combat sports like boxing. Real life isn't Punch Out!! and a physically small person doesn't stand a chance against a larger fighter. In other sports there's not as much of a difference, even in basketball it is mitigable to an extent (at least mitigable enough to approach fairness) unless you have dwarfism or something.
I just want to know when the gay agenda is taking over.
Also what do ya'll think of Italy's "no more birth certificates you blasted homosexuals" ideas?Could you elaborate? I haven't heard of this. I'm trying to figure out what it could mean, but I have too many guesses.
I came out as "gay" to my mom over pizza, it was nice. My brother kinda arranged it and it went really well. She didn't seem surprised XD
Sounds like it's the situation described within this news article (https://www.bbc.co.uk/news/world-europe-66502936), that I saw the other day.
(The "told not to register the children of same-sex couples" bit, rather than the reported small victory against misappropriating the image. I don't know anything more about the registration thing, though.)
3-1(Link to Heartstopper page 1 since it has been a while: https://tapas.io/episode/428109 )
no dont cri. if u cri, i cri.
3-3
All is good.
And, rather depressingly, upon being rescued from the camps anyone who was gay was immediately sent to prison.Yeah, but not even just the older ones! Evangelicals have been exporting violent homophobia into Africa in the 21rst century.
As for protecting from "Western influences", it's a post-colonial nation. They're protecting Western influences, just older ones.
Ugandese politicians say the law is nescessary to protect Uganda from Western influences.
Ugandese politicians say the law is nescessary to protect Uganda from Western influences.
Didn't Ugandan homophobic beliefs stem directly from colonial Europe?
Didn't Ugandan homophobic beliefs stem directly fromYes it didcolonial EuropeChristianity?
To defeat the colonial Europe... You must BECOME the colonial EuropeUgandese politicians say the law is nescessary to protect Uganda from Western influences.Didn't Ugandan homophobic beliefs stem directly from colonial Europe?
Ohhhh, are there any pre-colonial records of Ugandan homosexual practices?The people of that area, like many in Africa (and Scandinavia), passed their histories on orally. From what we know this was very effective at keeping knowledge intact and alive in the face of centuries. It did less well against deliberate and violent procedures to wipe it out.
Ohhhh, are there any pre-colonial records of Ugandan homosexual practices?Their last king before colonization was openly bi and nobody cared.
Ohhhh, are there any pre-colonial records of Ugandan homosexual practices?The people of that area, like many in Africa (and Scandinavia), passed their histories on orally. From what we know this was very effective at keeping knowledge intact and alive in the face of centuries. It did less well against deliberate and violent procedures to wipe it out.
You might as well look at the Christian Norse writers who recorded syncretic, "corrected" versions of the old stories in order to figure out whether there were Norse Homosexual Practices.
Sorry if this comes off a bit aggressive but like... The answer is "Probably not anymore", and I'm trying to assume you somehow didn't already know that when you asked the question. Like, I don't consider myself a historian, particularly not of African history (I even just now fell in the trap of acting like the entire continent is one culture lmfao) but even I correctly guessed that Uganda did the oral history thing. I even checked :o
Anyway you know what we do have records of? The bloodthirsty fucksticks who went over there only a decade or two ago and pushed for these laws using colonial influence. I cited some of those records.
The fact that they felt the need to do that suggests to me that the Ugandans weren't sufficiently homophobic previously. Maybe that answers your question.
I'm so bad at coming out lol, but I think I stumbled into a good experience today? I barely slept last night but my mom's friend needed computer help again, so I downed a big soda and went over there. We recovered his passwords (again lol) and got all his contacts synced to a new phone, via cable, it was all very cool. He was extremely happy. I was too. He called me a "booger" and a "genius".
In my altered state I found myself immensely relieved he didn't call me a "young man" this time, and I kinda blurted that out. He didn't seem to get it. So we sat and had a nice conversation about nutrition, and diabetes, and then I explained that while most of my family takes insulin I take estrogen.
that got through lol
And he kinda reacted... perfectly?
He was a bit surprised- fair, because I've always dressed masc around him. But he didn't *say* that. He said he was happy for me, that he certainly didn't have a problem with it...
And then he started talking about how there are so many bigots these days, and (this is the part that surprised and touched me) that they don't make sense.
I kinda expected the liberal "Well I don't get it but you have a right to do whatever crazy thing" brand of tolerance. It's... not the worst. Instead he made a point that bigotry is *wrong*, and that bigots have lost sight of our common humanity.
like, waow *_*
And I got to talk about the friends I've lost to the fascist pipeline... but also how I've found new friends who *escaped* from that sort of thinking. We're faced with fear and hatred, and we offer forgiveness. Our enemies are still people with the ability to grow and change. Like many of us did.
It felt really good to get that out. I think a lot of classic-libs see bigots and queer people as two equal sides in a war- a message the fash constantly push in memes- but a bigot can always stop being a bigot. Forgiveness obviously isn't automatic but at least it's possible. Trying to ingratiate oneself to someone who hates you... goes poorly, in my experience. (and I didn't even get that sweet grift money...)
anyway I'm exhausted but I'm really glad I told him. Wasn't expecting it to go bad, but I wasn't expecting it to go so well either.
'Christian Norse writers' meaning the Saga writers? If it's good ole Snorri, it's hard to tell whether he let his Christianity run rampant in the Prose Edda. Undoubtedly it cropped up. I seem to recall he prefaced the Edda by saying 'hey this is Pagan malarkey but it's important to understand the kennings told here. They have literary value, whether for studying other Norse literature or creating your own, soooo....'Ohhhh, are there any pre-colonial records of Ugandan homosexual practices?You might as well look at the Christian Norse writers who recorded syncretic, "corrected" versions of the old stories in order to figure out whether there were Norse Homosexual Practices.
Sorry if this comes off a bit aggressive but like... The answer is "Probably not anymore", and I'm trying to assume you somehow didn't already know that when you asked the question. Like, I don't consider myself a historian, particularly not of African history (I even just now fell in the trap of acting like the entire continent is one culture lmfao) but even I correctly guessed that Uganda did the oral history thing. I even checked :o
Anyway you know what we do have records of? The bloodthirsty fucksticks who went over there only a decade or two ago and pushed for these laws using colonial influence. I cited some of those records.
The fact that they felt the need to do that suggests to me that the Ugandans weren't sufficiently homophobic previously. Maybe that answers your question.
Their last king before colonization was openly bi and nobody cared.It's way more complicated than that. There's no evidence that it's true, he's accused of raping male peasants as part of his extensive tyranny, and it's tightly meshed with the propaganda of missionaries trying to overthrow his strongly pro-pagan administration. So the whole thing is dubious.
Hang on, wasn't the thing about "topping" being OK also present in Greek and Roman religion/culture? Like, topping is manly, but bottoming is effeminate?Roman, yes. It was actually illegal for a Roman citizen to allow himself to be penetrated. That was what foreigners were for. There are some great literary scraps about this; Martial in particular.
What Starver's saying is largely irrelevant....but even you say that the ancient(ish) world has no monolithic sense of social mores. Please don't pretend to 'understand' what I say, as you argue against what I didn't. At least you could complain that I don't explain myself well enough and/or drift away from the point - that'd be fair enough, as I'm sure others would more readily agree, including me.
...but even you say that the ancient(ish) world has no monolithic sense of social mores. Please don't pretend to 'understand' what I say, as you argue against what I didn't. At least you could complain that I don't explain myself well enough and/or drift away from the point - that'd be fair enough, as I'm sure others would more readily agree, including me.Well, there is simply no monolithic ancient world in the first place (classical Greek and classical Rome aren't even the same time period), but that doesn't mean we can't say anything and don't know anything. I'm not arguing against anything you said. You don't appear to have said anything.
Hang on, wasn't the thing about "topping" being OK also present in Greek and Roman religion/culture? Like, topping is manly, but bottoming is effeminate?
Especially if we remember that there was no unified Greek culture. City-states were quite different.Mmm, yes, this is also true, but mostly people only care about Athens because that's what we know the most about, and a lot of what we do know about the others comes from Athenians. Athenians never shut up about anything.
I personally think Thebes is underrated. The city was universally credited as the scummiest and most bastard-filled den of wretched villainy for centuries. But it was a military power that crushed Sparta and a cultural powerhouse that made a great deal of the poems and epics the Athenians stole the credit for, and the most ancient of the Greek city states. Xenophon's anabasis is 100% a must read for how fun he characterises each citizen of their city state. (https://www.gutenberg.org/files/1170/1170-h/1170-h.htm) The Spartan general Clearchus is so war-hungry he got exiled from Sparta, and every piece of gold he acquires he just uses to recruit more soldiers. Everyone loves him. Proxenus the Boeotian is skilled at gaining promotions but utterly indifferent to actually leading his men, and no one respects him. Menon the Thessalian is such a wretched villain, that the only reason he makes friends with anyone is because friends are really easy to rob. Xenophon the Athenian himself, wasn't even supposed to be one of the generals there, essentially going as a student on his gap year abroad (after cheating the oracle by asking when should I join the expedition rather than if I should join the expedition). But due to unfortunate circumstances Xenophon ends up winning an election. Each of the Greek city states brings their own specialties to the fore. Guys whose specialties are light infantry peltasts, cavalry specialists - even Rhodian slingers. There's so many brilliant moments.Especially if we remember that there was no unified Greek culture. City-states were quite different.Mmm, yes, this is also true, but mostly people only care about Athens because that's what we know the most about, and a lot of what we do know about the others comes from Athenians. Athenians never shut up about anything.
The study is small - just 44 young people. And because of the way the original study was designed - without a control group - experts can't infer cause and effect or say these changes in wellbeing were caused by being on puberty blockers.Gee, I wonder why they didn't use a control group. Could they not find trans children without PB in the UK?? (this is a joke, the NHS lets most trans kids and adults suffer in absurdly long waiting lists).
Trans care has become one of the most debated issues of our time. Where one side believes that care saves lives, others believe that it dissolves the boundaries between the sexes and risks causing lifelong damage. The trans care of children has come into focus as the number of diagnoses of gender dysphoria has increased exponentially and the country's clinics have more enrolled children than ever. On what grounds is trans care conducted today - and what if those responsible are wrong?
Vaccines have become one of the most debated issues of our time. Where one side believes that they save lives, others believe that they weaken the immune system and risk causing lifelong damage. The vaccination of children has come into focus as the number of diagnoses of COVID-19 has increased exponentially and the country's clinics have more enrolled children than ever. On what grounds are vaccines administered today - and what if those responsible are wrong?
I am not intended to offend everyone here , but today I read a post here in China ,it is a joke , one red neck was bocked in a fence , he shouted for help but failed , then he shouted there are only two genders in the word ! He was heaped , but then he got a big fight!In some places, but mostly no.
Is that true , do there exsit such a sharp gender struggle?
(bocked==blocked, i.e. "stuck"? heaped==helped? ...if you don't mind me presuming what has been double-translated.)Sorry for my carelessness in typing English , these days I am trying to use my new English typing app , that might make me have some mistakes ....
Tayyip Erdogan of Turkiye recently got triggered by U.N. decor (https://en.wikipedia.org/wiki/Sustainable_Development_Goals#/media/File:Sustainable_Development_Goals_logo.svg) because it reminds him of LGBT rainbow symbolism.
Tayyip Erdogan of Turkiye recently got triggered by U.N. decor (https://en.wikipedia.org/wiki/Sustainable_Development_Goals#/media/File:Sustainable_Development_Goals_logo.svg) because it reminds him of LGBT rainbow symbolism.
The man must be fuming everytime the rain clears up a sunny day
Tayyip Erdogan of Turkiye recently got triggered by U.N. decor (https://en.wikipedia.org/wiki/Sustainable_Development_Goals#/media/File:Sustainable_Development_Goals_logo.svg) because it reminds him of LGBT rainbow symbolism.
The man must be fuming everytime the rain clears up a sunny day
There's literally Christians super angry about the LGBT flag because "rainbows were given to them by god" :D
Welllll, that's demonstrably false.
But they do get a buzz off relationships with extranatural beings, that is true. In that way the rainbow is God's.... wedding ring?
The rainbow flag adoption was a god-tier move in retrospect. It's symbolic, original, and commonplace.Haha god tier is apt
Jesus! Those horses are bloody colour nazis!The rainbow flag adoption was a god-tier move in retrospect. It's symbolic, original, and commonplace.Haha god tier is apt
It also has the side effect of creating magical barriers to police horses (https://youtu.be/Aj6gsKOiYBU?feature=shared)
I mean multi-bed dormitory(/recuperation)-room.I can say from experience that those are definitely not sex-segregated here in my part of America, so it would be surprising to me if they bothered to do it in the UK. Are you sure this is commonplace?
The UK's NHS is in a crisis, with strikes, crumbling infrastructure, insufficient funding, insufficient training, excessive wait times...I thought the punchline was going to be "privatise it"
So what's the Tory government to do about it?
They're gonna segregate trans people into their own rooms, of course!
Jesus! Those horses are bloody colour nazis!They're hardcore Stuart restoration monarchists (https://www.youtube.com/watch?v=NDp0cX8QtwA)
Might not have used the right term? I mean multi-bed dormitory(/recuperation)-room. And not whole specialist units/departments, if that's what you're thinking.
There certainly is an expectation of these not being mixed-gender (before complicating that in working with trans-gender needs, etc), though apparently not being guaranteed.
(And I don't think I've seen one (other than A&E, which is technically singular cubicles so long as it doesn't overflow into corridors) which hasn't arranged for a male/female split in different areas. Whether that be orthopedics, dementia or wherever else a spare bed has been obtained for the one who requires it. Even as a child (the longest stay in hospital that I ever had, and probably the largest 'open plan' occupancy I've experienced), it was one room (out of several) only of boys, and I must assume that there were girls' rooms elsewhere, with whom I can't remember mixing even in any additional common social area.)
News article on what is being talked about (https://www.bbc.co.uk/news/health-66994133) (which says 'wards', so...)
...well, are you going to have a second one?No. Though it was nice that he bought the popcorn and drinks.
...well, are you going to have a second one?No. Though it was nice that he bought the popcorn and drinks.
Weird, I've been in hospitals a lot [...]Thankfully, not so much for me[1], so I had definitely been hoping some of the actual NHS(ish) forum-members (that I think are occasionally hovering around this parish) would pipe up and be authoritatively "Yeah, we like have to shuffle someone into the 'wrong' ward every now and again, still, but policy is that..." or something. Not that gender-specific (sub)wards are the issue here, save that it creates the situation of what you can/should do once you get into nonbinary territory, and invoke these further inevitably controversial decisions.
Weird question, anyone know any cheap thigh-high trans flag sock manufacturers that sell to the UK? I'm planning on taking a joke stereotypical-as-possible-trans-woman picture. Outside of that, I don't plan to wear them so I don't give a damn if they're so cheap they'll fall apart after one wear.
Did you guys see any cute boys recently?I don't really go outside much, so no.
Cute Russian mixed-media short film about the Frog Prince (https://www.youtube.com/watch?v=Xme3tNS4rno)There's a Soviet cartoon called "The Blue Puppy" (https://www.youtube.com/watch?v=Ni-ZnoJ2IvY). It's... lowkey infamous these days in the Russian internet for reasons I'll now explain lol
Said to be more gay than trans but I consider it both. I am very good at media literacy: I can read trans gender in ANYTHING :D /j
You know how catterpillars melt down to reform into butterflies? If an LGBT person's sexuality is like that, I think mine came out all wrong. It is like this half-baked, ungainly abomination sprawled on the floor that sometimes has screaming fits of agony.Uh, no, that does not sound normal. That sounds like you might be clinically depressed.
I don't know what it is with me. It feels incomplete. I feel like I am missing something, some crucial component that makes it all click. Everyone else seems to have it all figured out. But not me.
You guys are all old, you would know. Did this happened to you as well?
You know how catterpillars melt down to reform into butterflies? If an LGBT person's sexuality is like that, I think mine came out all wrong. It is like this half-baked, ungainly abomination sprawled on the floor that sometimes has screaming fits of agony.Sort of, but I think it's internalised homophobia (I grew up in a not-very-forwards part of a country whose kids use(d? Been a while since I was in school) "gay" and "bender" as insults, so it's not too surprising). It could be anything really.
I don't know what it is with me. It feels incomplete. I feel like I am missing something, some crucial component that makes it all click. Everyone else seems to have it all figured out. But not me.
You guys are all old, you would know. Did this happened to you as well?
You know how catterpillars melt down to reform into butterflies? If an LGBT person's sexuality is like that,I think this whole premise, in fact, is guaranteed to lead you into misery.
Arthur Dent : You know, this explains a lot. Because all my life, I've had this unaccountable feeling in my bones that something sinister was happening in the universe and that no one would tell me what it was.
Slartibartfast : Oh, no. That's just perfectly normal paranoia. Everyone in the universe has that.
Uh, no, that does not sound normal. That sounds like you might be clinically depressed.
Is it that obvious? I suppose I should've figured it would be, for you guys anyways. Yes, yes, I am pretty depressed. Clinically, even. I am very mentally ill actually, in all sorts of exotic, queer ways. I lowkey should be institutionalised. Or at least observed. I wish I was joking.
Before you say it, no, I absolutely cannot seek help. Mental health care here is nigh-useless. It is all either conservative muslim woman hoping score heaven points by preaching about Islam, or old hags who use papers from 1960's and classify homosexuality as a mental illness. Not to mention the waiting times. It is not an option. Turkey is not a place that values mental health. Geography is fate.
I do not feel inadequate towards the greater society as a whole. I frankly do not care about the worthless opinions of their obviously false god and con artist, pedophile prophet. I've always found it very easy to completely disregard cultural norms, too. I do not have internalised homophobia. I am sure of that.
My feelings of inadequacy come from within. I can only describe it as a hunch. An overwhelming, dysphoric feeling. It isn't paranoia. It is not a distant, unsure "what-if". It is an alarm. An alarm that says "Something's not right. Something's missing." I don't know what, but it is just that.
Maybe this means I am nuts. Runs in the family, no big deal. Or maybe my subconscious is obsessing over nothing again, perceiving things where there are none. I might even be hyperfixated on a previously miniscule feeling in my attempts to understand it, and accidentally made it larger because feelings are fractal and all that.
I am rambling now. I'll probably be marginally better come spring.
Might be worth trying to find an online counsellor. There's a quite a few organisations that cater to LGBTQ youths with mental health concerns, and they aren't going to have the cultural hangups common in Turkey.
Do you have a group of friends that you spend time with? Proper friends I mean, with common interests and open mindsets. I struggled a lot with my mental health in my teens and the start of my twenties because I didn't fit in well with my peers, and that didn't really get better until I went to University and had a lot more people my age with shared interests to hang out with. While a lot of my struggles were unrelated to my sexuality, or rather my sexuality played only a minor part in them, having more friends helped me with feeling comfortable in myself in general, including my attraction to men and prompted me to confront my longstanding depression.
You'd think a game about pawns becoming queens would be more accepting.
I call myself bi but I was thinking about it and I can't recall feeling any particular sexual attraction to a man ever.If you self-identify as "male" at times and as "female" at times, and are always attracted to women, then the identify of "bi" makes sense to me.
I think I am homosexual/biromantic.
The bill amends the Civil and Commercial Code to change the words “men and women” and “husband and wife” to “individuals” and “marriage partners.” It would open up access to full legal, financial and medical rights for LGBTQ+ couples.I think it's very good to see this legislation happen in Thailand.
Lawmakers in Thailand overwhelmingly approve a bill to legalize same-sex marriageGreat law.
https://apnews.com/article/thailand-marriage-same-sex-equality-law-9a2f9da6b5b36a1cf70dee5caec70e23Quote from: apnewsThe bill amends the Civil and Commercial Code to change the words “men and women” and “husband and wife” to “individuals” and “marriage partners.” It would open up access to full legal, financial and medical rights for LGBTQ+ couples.I think it's very good to see this legislation happen in Thailand.
Today's theme seems to be, rather hilariously, right-wing chuds getting upset that Easter's been stolen from them.
I've... wanted to get it done for a while, but only if I could get a tiny pair of bone dice (several decades to over a century old, they've been in the family for a long while) turned into a pair of earrings (probably wrapped in copper or brass or bronze wire... whatever's in that general color direction but still easy on the ears), which never really fell through.It would be an interesting funeral request, if all else fails.
One of these days I'll both find wherever I squirreled those things away and actually go through with it, heh.
I've... wanted to get it done for a while, but only if I could get a tiny pair of bone dice (several decades to over a century old, they've been in the family for a long while) turned into a pair of earrings (probably wrapped in copper or brass or bronze wire... whatever's in that general color direction but still easy on the ears), which never really fell through.
One of these days I'll both find wherever I squirreled those things away and actually go through with it, heh.